Ensembl Rest

A Ruby library for the RESTful Ensembl API.

Obtaining

gem install bio-ensembl-rest

for the repository:

git clone git://github.com/ALTree/bio-ensembl-rest

Usage

Each of the endpoint group listed in the Ensembl REST documentation has its own ruby module with the same name (except for Ontologies and Taxonomy, wich is split in two modules).

A full list of modules and methods, with documentation, is available {here}[https://github.com/ALTree/bio-ensembl-rest/wiki/modules-and-methods-list].

To make a request to an endpoint, use the appropriate method in the relative module. For example, to access the sequence/region/:species/:region endpoint in the Sequence group, use the sequence_region method in the Sequence module:

require 'bio-ensembl-rest'
include EnsemblRest

EnsemblRest.connect_db # connect to database
puts Sequence.sequence_region 'Homo sapiens', 'X:1000000..1000025:1'

# GAAACAGCTACTTGGAAGGCTGAAGC

Documentation

See the ensembl-rest wiki page.

Known issues

version-specific issues