Warning: Permanently added '2620:52:3:1:dead:beef:cafe:c24d' (ED25519) to the list of known hosts. You can reproduce this build on your computer by running: sudo dnf install copr-rpmbuild /usr/bin/copr-rpmbuild --verbose --drop-resultdir --task-url https://copr.fedorainfracloud.org/backend/get-build-task/8412002-fedora-rawhide-ppc64le --chroot fedora-rawhide-ppc64le Version: 1.2 PID: 23912 Logging PID: 23913 Task: {'allow_user_ssh': False, 'appstream': False, 'background': True, 'build_id': 8412002, 'buildroot_pkgs': [], 'chroot': 'fedora-rawhide-ppc64le', 'enable_net': False, 'fedora_review': False, 'git_hash': 'ca92ec3fe56d05aa6aa7a293e8330f2b68b4c61e', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/dmalcolm/gcc-15-smoketest-3/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-5', 'project_dirname': 'gcc-15-smoketest-3', 'project_name': 'gcc-15-smoketest-3', 'project_owner': 'dmalcolm', 'repo_priority': None, 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/dmalcolm/gcc-15-smoketest-3/fedora-rawhide-ppc64le/', 'id': 'copr_base', 'name': 'Copr repository', 'priority': None}, {'baseurl': 'https://fedorapeople.org/~dmalcolm/gcc/gcc-15-mass-prebuild/$basearch', 'id': 'https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch', 'name': 'Additional repo https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch'}], 'sandbox': 'dmalcolm/gcc-15-smoketest-3--dmalcolm', 'source_json': {}, 'source_type': None, 'ssh_public_keys': None, 'storage': 0, 'submitter': 'dmalcolm', 'tags': [], 'task_id': '8412002-fedora-rawhide-ppc64le', 'timeout': 115200, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/dmalcolm/gcc-15-smoketest-3/bowtie /var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/dmalcolm/gcc-15-smoketest-3/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie'... Running: git checkout ca92ec3fe56d05aa6aa7a293e8330f2b68b4c61e -- cmd: ['git', 'checkout', 'ca92ec3fe56d05aa6aa7a293e8330f2b68b4c61e', '--'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie rc: 0 stdout: stderr: Note: switching to 'ca92ec3fe56d05aa6aa7a293e8330f2b68b4c61e'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at ca92ec3 automatic import of bowtie Running: dist-git-client sources /usr/bin/tail: /var/lib/copr-rpmbuild/main.log: file truncated cmd: ['dist-git-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip INFO: Reading stdout from command: curl --help all INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/dmalcolm/gcc-15-smoketest-3/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 7293k 100 7293k 0 0 4711k 0 0:00:01 0:00:01 --:--:-- 4714k INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-tests.tgz --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/dmalcolm/gcc-15-smoketest-3/bowtie/bowtie-1.3.1-tests.tgz/md5/efa4aeb774a0cd0255fe3f24caf64187/bowtie-1.3.1-tests.tgz % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 34134 100 34134 0 0 547k 0 --:--:-- --:--:-- --:--:-- 555k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz Running (timeout=115200): unbuffer mock --spec /var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1734563230.610119 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 5.9 starting (python version = 3.13.0, NVR = mock-5.9-1.fc41), args: /usr/libexec/mock/mock --spec /var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1734563230.610119 -r /var/lib/copr-rpmbuild/results/configs/child.cfg Start(bootstrap): init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish(bootstrap): init plugins Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie/bowtie.spec) Config(fedora-rawhide-ppc64le) Start: clean chroot Finish: clean chroot Mock Version: 5.9 INFO: Mock Version: 5.9 Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-bootstrap-1734563230.610119/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata INFO: Guessed host environment type: unknown INFO: Using bootstrap image: registry.fedoraproject.org/fedora:rawhide INFO: Pulling image: registry.fedoraproject.org/fedora:rawhide INFO: Copy content of container registry.fedoraproject.org/fedora:rawhide to /var/lib/mock/fedora-rawhide-ppc64le-bootstrap-1734563230.610119/root INFO: Checking that registry.fedoraproject.org/fedora:rawhide image matches host's architecture INFO: mounting registry.fedoraproject.org/fedora:rawhide with podman image mount INFO: image registry.fedoraproject.org/fedora:rawhide as /var/lib/containers/storage/overlay/b87daa95da24dc32ae540884b84e9eaab11e81a266189d6b86717ac9358484b7/merged INFO: umounting image registry.fedoraproject.org/fedora:rawhide (/var/lib/containers/storage/overlay/b87daa95da24dc32ae540884b84e9eaab11e81a266189d6b86717ac9358484b7/merged) with podman image umount INFO: Package manager dnf5 detected and used (fallback) INFO: Not updating bootstrap chroot, bootstrap_image_ready=True Start(bootstrap): creating root cache Finish(bootstrap): creating root cache Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-1734563230.610119/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Package manager dnf5 detected and used (direct choice) INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-4.20.0-1.fc42.ppc64le rpm-sequoia-1.7.0-3.fc42.ppc64le dnf5-5.2.8.1-2.fc42.ppc64le dnf5-plugins-5.2.8.1-2.fc42.ppc64le Start: installing minimal buildroot with dnf5 Updating and loading repositories: fedora 100% | 69.9 KiB/s | 3.0 KiB | 00m00s Copr repository 100% | 27.3 KiB/s | 1.5 KiB | 00m00s Additional repo https_fedorapeople_org 100% | 22.4 KiB/s | 1.5 KiB | 00m00s Copr repository 100% | 6.7 MiB/s | 817.7 KiB | 00m00s Repositories loaded. Package Arch Version Repository Size Installing group/module packages: bash ppc64le 5.2.37-1.fc42 fedora 8.7 MiB bzip2 ppc64le 1.0.8-19.fc41 fedora 427.5 KiB coreutils ppc64le 9.5-11.fc42 fedora 9.4 MiB cpio ppc64le 2.15-2.fc41 fedora 1.2 MiB diffutils ppc64le 3.10-8.fc41 fedora 2.2 MiB fedora-release-common noarch 42-0.11 fedora 19.8 KiB findutils ppc64le 1:4.10.0-4.fc41 fedora 2.2 MiB gawk ppc64le 5.3.0-4.fc41 fedora 4.5 MiB glibc-minimal-langpack ppc64le 2.40.9000-24.fc42 fedora 0.0 B grep ppc64le 3.11-9.fc41 fedora 1.2 MiB gzip ppc64le 1.13-2.fc41 fedora 552.8 KiB info ppc64le 7.1.1-2.fc42 fedora 741.5 KiB patch ppc64le 2.7.6-25.fc41 fedora 390.5 KiB redhat-rpm-config noarch 300-1.no_annobin.0.fc42 copr_base 186.6 KiB rpm-build ppc64le 4.20.0-1.fc42 fedora 1.4 MiB sed ppc64le 4.9-3.fc41 fedora 1.0 MiB shadow-utils ppc64le 2:4.17.0~rc1-1.fc42 fedora 4.9 MiB tar ppc64le 2:1.35-4.fc41 fedora 3.2 MiB unzip ppc64le 6.0-65.fc42 fedora 2.3 MiB util-linux ppc64le 2.40.2-8.fc42 fedora 17.2 MiB which ppc64le 2.21-42.fc41 fedora 248.0 KiB xz ppc64le 1:5.6.3-2.fc42 fedora 1.5 MiB Installing dependencies: add-determinism ppc64le 0.4.3-1.fc42 fedora 2.6 MiB alternatives ppc64le 1.30-1.fc41 fedora 218.2 KiB ansible-srpm-macros noarch 1-16.fc41 fedora 35.7 KiB audit-libs ppc64le 4.0.2-1.fc42 copr_base 479.0 KiB authselect ppc64le 1.5.0-8.fc42 copr_base 179.8 KiB authselect-libs ppc64le 1.5.0-8.fc42 copr_base 865.4 KiB basesystem noarch 11-21.fc41 fedora 0.0 B binutils ppc64le 2.43.50-9.fc42 fedora 31.4 MiB build-reproducibility-srpm-macros noarch 0.4.3-1.fc42 fedora 735.0 B bzip2-libs ppc64le 1.0.8-19.fc41 fedora 200.6 KiB ca-certificates noarch 2024.2.69_v8.0.401-3.fc42 fedora 2.6 MiB coreutils-common ppc64le 9.5-11.fc42 fedora 11.2 MiB cracklib ppc64le 2.9.11-6.fc41 fedora 934.2 KiB crypto-policies noarch 20241128-1.gitbb7b0b0.fc42 fedora 137.3 KiB curl ppc64le 8.11.1-2.fc42 fedora 515.9 KiB cyrus-sasl-lib ppc64le 2.1.28-27.fc41 fedora 3.5 MiB debugedit ppc64le 5.1-2.fc42 fedora 308.1 KiB dwz ppc64le 0.15-8.fc42 fedora 450.8 KiB ed ppc64le 1.20.2-2.fc41 fedora 282.8 KiB efi-srpm-macros noarch 5-13.fc42 fedora 40.2 KiB elfutils ppc64le 0.192-7.fc42 fedora 3.4 MiB elfutils-debuginfod-client ppc64le 0.192-7.fc42 fedora 140.9 KiB elfutils-default-yama-scope noarch 0.192-7.fc42 fedora 1.8 KiB elfutils-libelf ppc64le 0.192-7.fc42 fedora 1.2 MiB elfutils-libs ppc64le 0.192-7.fc42 fedora 862.5 KiB fedora-gpg-keys noarch 42-0.3 fedora 126.4 KiB fedora-release noarch 42-0.11 fedora 0.0 B fedora-release-identity-basic noarch 42-0.11 fedora 719.0 B fedora-repos noarch 42-0.3 fedora 4.9 KiB fedora-repos-rawhide noarch 42-0.3 fedora 2.2 KiB file ppc64le 5.45-8.fc42 fedora 139.5 KiB file-libs ppc64le 5.45-8.fc42 fedora 10.0 MiB filesystem ppc64le 3.18-29.fc42 fedora 106.0 B filesystem-srpm-macros noarch 3.18-29.fc42 fedora 36.1 KiB fonts-srpm-macros noarch 1:2.0.5-17.fc41 fedora 55.8 KiB forge-srpm-macros noarch 0.4.0-1.fc42 fedora 38.9 KiB fpc-srpm-macros noarch 1.3-13.fc41 fedora 144.0 B gdb-minimal ppc64le 15.2-4.fc42 fedora 15.2 MiB gdbm ppc64le 1:1.23-7.fc41 fedora 928.3 KiB gdbm-libs ppc64le 1:1.23-7.fc41 fedora 425.5 KiB ghc-srpm-macros noarch 1.9.2-1.fc42 fedora 779.0 B glibc ppc64le 2.40.9000-24.fc42 fedora 11.6 MiB glibc-common ppc64le 2.40.9000-24.fc42 fedora 1.5 MiB glibc-gconv-extra ppc64le 2.40.9000-24.fc42 fedora 18.3 MiB gmp ppc64le 1:6.3.0-2.fc41 fedora 850.3 KiB gnat-srpm-macros noarch 6-6.fc41 fedora 1.0 KiB go-srpm-macros noarch 3.6.0-5.fc42 fedora 60.8 KiB jansson ppc64le 2.14-1.fc42 fedora 221.1 KiB json-c ppc64le 0.18-1.fc42 fedora 139.1 KiB kernel-srpm-macros noarch 1.0-24.fc41 fedora 1.9 KiB keyutils-libs ppc64le 1.6.3-4.fc41 fedora 226.1 KiB krb5-libs ppc64le 1.21.3-3.fc42 fedora 3.0 MiB libacl ppc64le 2.3.2-2.fc42 copr_base 66.0 KiB libarchive ppc64le 3.7.7-1.fc42 fedora 1.3 MiB libattr ppc64le 2.5.2-4.fc41 fedora 196.3 KiB libblkid ppc64le 2.40.2-8.fc42 fedora 482.6 KiB libbrotli ppc64le 1.1.0-5.fc41 fedora 1.3 MiB libcap ppc64le 2.71-1.fc42 fedora 508.8 KiB libcap-ng ppc64le 0.8.5-3.fc41 fedora 416.5 KiB libcom_err ppc64le 1.47.1-6.fc42 fedora 239.1 KiB libcurl ppc64le 8.11.1-2.fc42 fedora 1.0 MiB libeconf ppc64le 0.7.5-1.fc42 fedora 78.6 KiB libevent ppc64le 2.1.12-14.fc41 fedora 1.6 MiB libfdisk ppc64le 2.40.2-8.fc42 fedora 611.0 KiB libffi ppc64le 3.4.6-3.fc42 fedora 218.0 KiB libgcc ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 282.8 KiB libgomp ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 629.0 KiB libidn2 ppc64le 2.3.7-2.fc41 fedora 456.8 KiB libmount ppc64le 2.40.2-8.fc42 fedora 548.0 KiB libnghttp2 ppc64le 1.64.0-1.fc42 fedora 326.1 KiB libpkgconf ppc64le 2.3.0-1.fc42 fedora 198.0 KiB libpsl ppc64le 0.21.5-4.fc41 fedora 196.2 KiB libpwquality ppc64le 1.4.5-11.fc41 fedora 1.1 MiB librtas ppc64le 2.0.6-2.fc41 fedora 497.6 KiB libselinux ppc64le 3.8-0.rc1.2.fc42 fedora 259.5 KiB libsemanage ppc64le 3.8-0.rc1.1.fc42 fedora 417.0 KiB libsepol ppc64le 3.8-0.rc1.1.fc42 fedora 1.0 MiB libsmartcols ppc64le 2.40.2-8.fc42 fedora 353.5 KiB libssh ppc64le 0.11.1-1.fc42 fedora 777.7 KiB libssh-config noarch 0.11.1-1.fc42 fedora 277.0 B libstdc++ ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 3.8 MiB libtasn1 ppc64le 4.19.0-9.fc41 fedora 347.4 KiB libtirpc ppc64le 1.3.6-1.fc42 fedora 276.8 KiB libtool-ltdl ppc64le 2.5.4-1.fc42 copr_base 92.0 KiB libunistring ppc64le 1.1-8.fc41 fedora 1.9 MiB libuuid ppc64le 2.40.2-8.fc42 fedora 197.4 KiB libverto ppc64le 0.3.2-9.fc41 fedora 197.2 KiB libxcrypt ppc64le 4.4.36-11.fc42 fedora 335.1 KiB libxml2 ppc64le 2.12.8-2.fc41 fedora 2.5 MiB libzstd ppc64le 1.5.6-2.fc41 fedora 988.0 KiB lua-libs ppc64le 5.4.7-1.fc42 fedora 521.0 KiB lua-srpm-macros noarch 1-14.fc41 fedora 1.3 KiB lz4-libs ppc64le 1.10.0-1.fc41 fedora 325.2 KiB mpfr ppc64le 4.2.1-5.fc41 fedora 976.9 KiB ncurses-base noarch 6.5-2.20240629.fc41 fedora 326.3 KiB ncurses-libs ppc64le 6.5-2.20240629.fc41 fedora 2.4 MiB ocaml-srpm-macros noarch 10-3.fc41 fedora 1.9 KiB openblas-srpm-macros noarch 2-18.fc41 fedora 112.0 B openldap ppc64le 2.6.8-6.fc42 fedora 874.8 KiB openssl-libs ppc64le 1:3.2.2-8.fc42 fedora 8.6 MiB p11-kit ppc64le 0.25.5-4.fc42 fedora 3.1 MiB p11-kit-trust ppc64le 0.25.5-4.fc42 fedora 655.4 KiB package-notes-srpm-macros noarch 0.5-12.fc41 fedora 1.6 KiB pam ppc64le 1.7.0-3.fc42 fedora 4.2 MiB pam-libs ppc64le 1.7.0-3.fc42 fedora 286.9 KiB pcre2 ppc64le 10.44-1.fc41.1 fedora 968.8 KiB pcre2-syntax noarch 10.44-1.fc41.1 fedora 251.6 KiB perl-srpm-macros noarch 1-56.fc41 fedora 861.0 B pkgconf ppc64le 2.3.0-1.fc42 fedora 240.5 KiB pkgconf-m4 noarch 2.3.0-1.fc42 fedora 14.4 KiB pkgconf-pkg-config ppc64le 2.3.0-1.fc42 fedora 990.0 B popt ppc64le 1.19-7.fc41 fedora 272.8 KiB publicsuffix-list-dafsa noarch 20240107-4.fc41 fedora 67.5 KiB pyproject-srpm-macros noarch 1.16.3-1.fc42 fedora 1.9 KiB python-srpm-macros noarch 3.13-3.fc41 fedora 51.0 KiB qt5-srpm-macros noarch 5.15.15-1.fc42 fedora 500.0 B qt6-srpm-macros noarch 6.8.1-4.fc42 fedora 456.0 B readline ppc64le 8.2-11.fc42 fedora 881.0 KiB rpm ppc64le 4.20.0-1.fc42 fedora 4.8 MiB rpm-build-libs ppc64le 4.20.0-1.fc42 fedora 390.6 KiB rpm-libs ppc64le 4.20.0-1.fc42 fedora 1.2 MiB rpm-sequoia ppc64le 1.7.0-3.fc42 fedora 2.7 MiB rust-srpm-macros noarch 26.3-3.fc42 fedora 4.8 KiB setup noarch 2.15.0-5.fc41 fedora 720.7 KiB sqlite-libs ppc64le 3.47.2-1.fc42 fedora 1.8 MiB systemd-libs ppc64le 257-1.fc42 fedora 2.9 MiB util-linux-core ppc64le 2.40.2-8.fc42 fedora 6.2 MiB xxhash-libs ppc64le 0.8.2-4.fc42 fedora 211.9 KiB xz-libs ppc64le 1:5.6.3-2.fc42 fedora 394.1 KiB zig-srpm-macros noarch 1-3.fc41 fedora 1.1 KiB zip ppc64le 3.0-42.fc42 fedora 883.2 KiB zlib-ng-compat ppc64le 2.2.2-1.fc42 fedora 197.7 KiB zstd ppc64le 1.5.6-2.fc41 fedora 2.1 MiB Installing groups: Buildsystem building group Transaction Summary: Installing: 155 packages Total size of inbound packages is 56 MiB. Need to download 0 B. After this operation, 262 MiB extra will be used (install 262 MiB, remove 0 B). [1/1] tar-2:1.35-4.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [1/1] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/2] bzip2-0:1.0.8-19.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [2/2] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/3] rpm-build-0:4.20.0-1.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [3/3] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/4] unzip-0:6.0-65.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [4/4] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/5] cpio-0:2.15-2.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [5/5] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/6] which-0:2.21-42.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [6/6] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/7] bash-0:5.2.37-1.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [7/7] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/8] coreutils-0:9.5-11.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [8/8] Total 100% | 0.0 B/s | 0.0 B | 00m00s [1/9] grep-0:3.11-9.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [9/9] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/10] patch-0:2.7.6-25.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [10/10] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/11] sed-0:4.9-3.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [11/11] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/12] shadow-utils-2:4.17.0~rc1-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [12/12] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/13] util-linux-0:2.40.2-8.fc42.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [13/13] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/14] diffutils-0:3.10-8.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [14/14] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/15] fedora-release-common-0:42-0.11 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [15/15] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/16] findutils-1:4.10.0-4.fc41.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [16/16] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/17] gawk-0:5.3.0-4.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [17/17] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/18] glibc-minimal-langpack-0:2.40.9 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [18/18] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/19] gzip-0:1.13-2.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [19/19] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/20] info-0:7.1.1-2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [20/20] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/21] xz-1:5.6.3-2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [21/21] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/22] redhat-rpm-config-0:300-1.no_an 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [22/22] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/23] glibc-0:2.40.9000-24.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [23/23] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/24] libselinux-0:3.8-0.rc1.2.fc42.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [24/24] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/25] bzip2-libs-0:1.0.8-19.fc41.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [25/25] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/26] binutils-0:2.43.50-9.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [26/26] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/27] debugedit-0:5.1-2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [27/27] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/28] elfutils-0:0.192-7.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [28/28] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/29] elfutils-libelf-0:0.192-7.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [29/29] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/30] file-0:5.45-8.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [30/30] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/31] libarchive-0:3.7.7-1.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [31/31] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/32] pkgconf-pkg-config-0:2.3.0-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [32/32] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/33] popt-0:1.19-7.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [33/33] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/34] readline-0:8.2-11.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [34/34] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/35] rpm-0:4.20.0-1.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [35/35] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/36] rpm-build-libs-0:4.20.0-1.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [36/36] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/37] rpm-libs-0:4.20.0-1.fc42.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [37/37] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/38] zstd-0:1.5.6-2.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [38/38] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/39] filesystem-0:3.18-29.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [39/39] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/40] ncurses-libs-0:6.5-2.20240629.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [40/40] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/41] coreutils-common-0:9.5-11.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [41/41] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/42] gmp-1:6.3.0-2.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [42/42] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/43] libattr-0:2.5.2-4.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [43/43] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/44] libcap-0:2.71-1.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [44/44] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/45] openssl-libs-1:3.2.2-8.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [45/45] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/46] systemd-libs-0:257-1.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [46/46] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/47] pcre2-0:10.44-1.fc41.1.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [47/47] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/48] ed-0:1.20.2-2.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [48/48] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/49] libeconf-0:0.7.5-1.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [49/49] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/50] libsemanage-0:3.8-0.rc1.1.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [50/50] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/51] libxcrypt-0:4.4.36-11.fc42.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [51/51] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/52] pam-libs-0:1.7.0-3.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [52/52] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/53] setup-0:2.15.0-5.fc41.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [53/53] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/54] libblkid-0:2.40.2-8.fc42.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [54/54] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/55] libcap-ng-0:0.8.5-3.fc41.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [55/55] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/56] libfdisk-0:2.40.2-8.fc42.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [56/56] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/57] libmount-0:2.40.2-8.fc42.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [57/57] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/58] librtas-0:2.0.6-2.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [58/58] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/59] libsmartcols-0:2.40.2-8.fc42.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [59/59] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/60] libuuid-0:2.40.2-8.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [60/60] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/61] pam-0:1.7.0-3.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [61/61] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/62] util-linux-core-0:2.40.2-8.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [62/62] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/63] zlib-ng-compat-0:2.2.2-1.fc42.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [63/63] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/64] fedora-repos-0:42-0.3.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [64/64] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/65] mpfr-0:4.2.1-5.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [65/65] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/66] glibc-common-0:2.40.9000-24.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [66/66] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/67] xz-libs-1:5.6.3-2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [67/67] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/68] ansible-srpm-macros-0:1-16.fc41 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [68/68] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/69] build-reproducibility-srpm-macr 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [69/69] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/70] dwz-0:0.15-8.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [70/70] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/71] efi-srpm-macros-0:5-13.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [71/71] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/72] filesystem-srpm-macros-0:3.18-2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [72/72] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/73] fonts-srpm-macros-1:2.0.5-17.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [73/73] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/74] forge-srpm-macros-0:0.4.0-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [74/74] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/75] fpc-srpm-macros-0:1.3-13.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [75/75] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/76] ghc-srpm-macros-0:1.9.2-1.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [76/76] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/77] gnat-srpm-macros-0:6-6.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [77/77] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/78] go-srpm-macros-0:3.6.0-5.fc42.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [78/78] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/79] kernel-srpm-macros-0:1.0-24.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [79/79] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/80] lua-srpm-macros-0:1-14.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [80/80] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/81] ocaml-srpm-macros-0:10-3.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [81/81] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/82] openblas-srpm-macros-0:2-18.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [82/82] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/83] package-notes-srpm-macros-0:0.5 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [83/83] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/84] perl-srpm-macros-0:1-56.fc41.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [84/84] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/85] pyproject-srpm-macros-0:1.16.3- 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [85/85] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/86] python-srpm-macros-0:3.13-3.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [86/86] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/87] qt5-srpm-macros-0:5.15.15-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [87/87] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/88] qt6-srpm-macros-0:6.8.1-4.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [88/88] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/89] rust-srpm-macros-0:26.3-3.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [89/89] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/90] zig-srpm-macros-0:1-3.fc41.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [90/90] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/91] zip-0:3.0-42.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [91/91] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/92] glibc-gconv-extra-0:2.40.9000-2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [92/92] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/93] basesystem-0:11-21.fc41.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [93/93] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/94] libsepol-0:3.8-0.rc1.1.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [94/94] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/95] alternatives-0:1.30-1.fc41.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [95/95] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/96] elfutils-debuginfod-client-0:0. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [96/96] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/97] jansson-0:2.14-1.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [97/97] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/98] elfutils-libs-0:0.192-7.fc42.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [98/98] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/99] libzstd-0:1.5.6-2.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [99/99] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/100] file-libs-0:5.45-8.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [100/100] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/101] libxml2-0:2.12.8-2.fc41.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [101/101] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/102] lz4-libs-0:1.10.0-1.fc41.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [102/102] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/103] pkgconf-0:2.3.0-1.fc42.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [103/103] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/104] pkgconf-m4-0:2.3.0-1.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [104/104] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/105] curl-0:8.11.1-2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [105/105] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/106] lua-libs-0:5.4.7-1.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [106/106] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/107] rpm-sequoia-0:1.7.0-3.fc42.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [107/107] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/108] sqlite-libs-0:3.47.2-1.fc42.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [108/108] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/109] ncurses-base-0:6.5-2.20240629 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [109/109] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/110] ca-certificates-0:2024.2.69_v 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [110/110] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/111] crypto-policies-0:20241128-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [111/111] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/112] pcre2-syntax-0:10.44-1.fc41.1 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [112/112] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/113] gdbm-1:1.23-7.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [113/113] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/114] gdbm-libs-1:1.23-7.fc41.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [114/114] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/115] libpwquality-0:1.4.5-11.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [115/115] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/116] libtirpc-0:1.3.6-1.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [116/116] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/117] fedora-gpg-keys-0:42-0.3.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [117/117] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/118] fedora-repos-rawhide-0:42-0.3 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [118/118] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/119] add-determinism-0:0.4.3-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [119/119] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/120] json-c-0:0.18-1.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [120/120] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/121] elfutils-default-yama-scope-0 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [121/121] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/122] libpkgconf-0:2.3.0-1.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [122/122] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/123] libffi-0:3.4.6-3.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [123/123] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/124] p11-kit-0:0.25.5-4.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [124/124] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/125] p11-kit-trust-0:0.25.5-4.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [125/125] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/126] cracklib-0:2.9.11-6.fc41.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [126/126] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/127] krb5-libs-0:1.21.3-3.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [127/127] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/128] libcom_err-0:1.47.1-6.fc42.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [128/128] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/129] libtasn1-0:4.19.0-9.fc41.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [129/129] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/130] keyutils-libs-0:1.6.3-4.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [130/130] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/131] libverto-0:0.3.2-9.fc41.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [131/131] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/132] libgcc-0:15.0.0-0.2.fc42.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [132/132] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/133] libstdc++-0:15.0.0-0.2.fc42.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [133/133] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/134] audit-libs-0:4.0.2-1.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [134/134] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/135] authselect-libs-0:1.5.0-8.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [135/135] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/136] libacl-0:2.3.2-2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [136/136] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/137] libgomp-0:15.0.0-0.2.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [137/137] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/138] authselect-0:1.5.0-8.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [138/138] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/139] fedora-release-0:42-0.11.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [139/139] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/140] gdb-minimal-0:15.2-4.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [140/140] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/141] xxhash-libs-0:0.8.2-4.fc42.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [141/141] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/142] fedora-release-identity-basic 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [142/142] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/143] libcurl-0:8.11.1-2.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [143/143] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/144] libbrotli-0:1.1.0-5.fc41.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [144/144] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/145] libidn2-0:2.3.7-2.fc41.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [145/145] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/146] libnghttp2-0:1.64.0-1.fc42.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [146/146] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/147] libpsl-0:0.21.5-4.fc41.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [147/147] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/148] libssh-0:0.11.1-1.fc42.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [148/148] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/149] openldap-0:2.6.8-6.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [149/149] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/150] libunistring-0:1.1-8.fc41.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [150/150] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/151] publicsuffix-list-dafsa-0:202 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [151/151] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/152] libssh-config-0:0.11.1-1.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [152/152] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/153] cyrus-sasl-lib-0:2.1.28-27.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [153/153] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/154] libevent-0:2.1.12-14.fc41.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [154/154] Total 100% | 0.0 B/s | 0.0 B | 00m00s [ 1/155] libtool-ltdl-0:2.5.4-1.fc42.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [155/155] Total 100% | 0.0 B/s | 0.0 B | 00m00s Running transaction Importing OpenPGP key 0x105EF944: UserID : "Fedora (42) " Fingerprint: B0F4950458F69E1150C6C5EDC8AC4916105EF944 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-42-primary The key was successfully imported. Importing OpenPGP key 0x105EF944: UserID : "Fedora (42) " Fingerprint: B0F4950458F69E1150C6C5EDC8AC4916105EF944 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-42-primary The key was successfully imported. Importing OpenPGP key 0xE99D6AD1: UserID : "Fedora (41) " Fingerprint: 466CF2D8B60BC3057AA9453ED0622462E99D6AD1 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-41-primary The key was successfully imported. Importing OpenPGP key 0x31645531: UserID : "Fedora (43) " Fingerprint: C6E7F081CF80E13146676E88829B606631645531 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-43-primary The key was successfully imported. [ 1/157] Verify package files 100% | 298.0 B/s | 155.0 B | 00m01s >>> Running pre-transaction scriptlet: filesystem-0:3.18-29.fc42.ppc64le >>> Finished pre-transaction scriptlet: filesystem-0:3.18-29.fc42.ppc64le >>> [RPM] /var/lib/mock/fedora-rawhide-ppc64le-1734563230.610119/root/var/cache/ [ 2/157] Prepare transaction 100% | 1.1 KiB/s | 155.0 B | 00m00s [ 3/157] Installing libgcc-0:15.0.0-0. 100% | 92.6 MiB/s | 284.4 KiB | 00m00s [ 4/157] Installing libssh-config-0:0. 100% | 0.0 B/s | 816.0 B | 00m00s [ 5/157] Installing publicsuffix-list- 100% | 66.7 MiB/s | 68.3 KiB | 00m00s [ 6/157] Installing fedora-release-ide 100% | 953.1 KiB/s | 976.0 B | 00m00s [ 7/157] Installing fedora-gpg-keys-0: 100% | 14.0 MiB/s | 172.2 KiB | 00m00s [ 8/157] Installing fedora-repos-rawhi 100% | 2.4 MiB/s | 2.4 KiB | 00m00s [ 9/157] Installing fedora-repos-0:42- 100% | 5.6 MiB/s | 5.7 KiB | 00m00s [ 10/157] Installing fedora-release-com 100% | 11.8 MiB/s | 24.1 KiB | 00m00s [ 11/157] Installing fedora-release-0:4 100% | 0.0 B/s | 124.0 B | 00m00s [ 12/157] Installing setup-0:2.15.0-5.f 100% | 19.2 MiB/s | 726.1 KiB | 00m00s >>> [RPM] /etc/hosts created as /etc/hosts.rpmnew [ 13/157] Installing filesystem-0:3.18- 100% | 1.1 MiB/s | 212.6 KiB | 00m00s [ 14/157] Installing basesystem-0:11-21 100% | 0.0 B/s | 124.0 B | 00m00s [ 15/157] Installing pcre2-syntax-0:10. 100% | 82.7 MiB/s | 254.1 KiB | 00m00s [ 16/157] Installing ncurses-base-0:6.5 100% | 22.9 MiB/s | 351.7 KiB | 00m00s [ 17/157] Installing glibc-minimal-lang 100% | 0.0 B/s | 124.0 B | 00m00s [ 18/157] Installing ncurses-libs-0:6.5 100% | 143.2 MiB/s | 2.4 MiB | 00m00s [ 19/157] Installing glibc-0:2.40.9000- 100% | 146.5 MiB/s | 11.6 MiB | 00m00s [ 20/157] Installing bash-0:5.2.37-1.fc 100% | 149.5 MiB/s | 8.7 MiB | 00m00s [ 21/157] Installing glibc-common-0:2.4 100% | 88.1 MiB/s | 1.5 MiB | 00m00s [ 22/157] Installing glibc-gconv-extra- 100% | 155.6 MiB/s | 18.4 MiB | 00m00s [ 23/157] Installing zlib-ng-compat-0:2 100% | 96.9 MiB/s | 198.5 KiB | 00m00s [ 24/157] Installing bzip2-libs-0:1.0.8 100% | 98.5 MiB/s | 201.8 KiB | 00m00s [ 25/157] Installing xz-libs-1:5.6.3-2. 100% | 128.6 MiB/s | 395.2 KiB | 00m00s [ 26/157] Installing popt-0:1.19-7.fc41 100% | 39.0 MiB/s | 279.4 KiB | 00m00s [ 27/157] Installing readline-0:8.2-11. 100% | 143.7 MiB/s | 883.1 KiB | 00m00s [ 28/157] Installing libuuid-0:2.40.2-8 100% | 96.9 MiB/s | 198.5 KiB | 00m00s [ 29/157] Installing libblkid-0:2.40.2- 100% | 118.1 MiB/s | 483.8 KiB | 00m00s [ 30/157] Installing gmp-1:6.3.0-2.fc41 100% | 138.8 MiB/s | 852.5 KiB | 00m00s [ 31/157] Installing libattr-0:2.5.2-4. 100% | 96.3 MiB/s | 197.2 KiB | 00m00s [ 32/157] Installing libacl-0:2.3.2-2.f 100% | 65.2 MiB/s | 66.8 KiB | 00m00s [ 33/157] Installing libxcrypt-0:4.4.36 100% | 82.5 MiB/s | 337.8 KiB | 00m00s [ 34/157] Installing libzstd-0:1.5.6-2. 100% | 138.0 MiB/s | 989.2 KiB | 00m00s [ 35/157] Installing elfutils-libelf-0: 100% | 156.1 MiB/s | 1.2 MiB | 00m00s [ 36/157] Installing libstdc++-0:15.0.0 100% | 156.8 MiB/s | 3.8 MiB | 00m00s [ 37/157] Installing libeconf-0:0.7.5-1 100% | 39.2 MiB/s | 80.2 KiB | 00m00s [ 38/157] Installing gdbm-libs-1:1.23-7 100% | 139.1 MiB/s | 427.2 KiB | 00m00s [ 39/157] Installing dwz-0:0.15-8.fc42. 100% | 110.4 MiB/s | 452.1 KiB | 00m00s [ 40/157] Installing mpfr-0:4.2.1-5.fc4 100% | 119.5 MiB/s | 978.6 KiB | 00m00s [ 41/157] Installing gawk-0:5.3.0-4.fc4 100% | 173.6 MiB/s | 4.5 MiB | 00m00s [ 42/157] Installing unzip-0:6.0-65.fc4 100% | 213.2 MiB/s | 2.3 MiB | 00m00s [ 43/157] Installing file-libs-0:5.45-8 100% | 237.2 MiB/s | 10.0 MiB | 00m00s [ 44/157] Installing file-0:5.45-8.fc42 100% | 15.3 MiB/s | 140.9 KiB | 00m00s [ 45/157] Installing crypto-policies-0: 100% | 11.4 MiB/s | 163.7 KiB | 00m00s [ 46/157] Installing pcre2-0:10.44-1.fc 100% | 135.4 MiB/s | 970.3 KiB | 00m00s [ 47/157] Installing grep-0:3.11-9.fc41 100% | 82.8 MiB/s | 1.2 MiB | 00m00s [ 48/157] Installing xz-1:5.6.3-2.fc42. 100% | 94.4 MiB/s | 1.5 MiB | 00m00s [ 49/157] Installing libcap-ng-0:0.8.5- 100% | 136.2 MiB/s | 418.4 KiB | 00m00s [ 50/157] Installing audit-libs-0:4.0.2 100% | 94.0 MiB/s | 481.1 KiB | 00m00s [ 51/157] Installing pam-libs-0:1.7.0-3 100% | 94.2 MiB/s | 289.3 KiB | 00m00s [ 52/157] Installing libcap-0:2.71-1.fc 100% | 83.6 MiB/s | 513.6 KiB | 00m00s [ 53/157] Installing systemd-libs-0:257 100% | 150.5 MiB/s | 2.9 MiB | 00m00s [ 54/157] Installing libsmartcols-0:2.4 100% | 115.4 MiB/s | 354.6 KiB | 00m00s [ 55/157] Installing libsepol-0:3.8-0.r 100% | 148.9 MiB/s | 1.0 MiB | 00m00s [ 56/157] Installing libselinux-0:3.8-0 100% | 84.9 MiB/s | 260.7 KiB | 00m00s [ 57/157] Installing sed-0:4.9-3.fc41.p 100% | 82.2 MiB/s | 1.0 MiB | 00m00s [ 58/157] Installing findutils-1:4.10.0 100% | 120.6 MiB/s | 2.2 MiB | 00m00s [ 59/157] Installing libmount-0:2.40.2- 100% | 134.1 MiB/s | 549.1 KiB | 00m00s [ 60/157] Installing alternatives-0:1.3 100% | 107.3 MiB/s | 219.8 KiB | 00m00s [ 61/157] Installing lz4-libs-0:1.10.0- 100% | 106.2 MiB/s | 326.3 KiB | 00m00s [ 62/157] Installing lua-libs-0:5.4.7-1 100% | 127.5 MiB/s | 522.2 KiB | 00m00s [ 63/157] Installing libffi-0:3.4.6-3.f 100% | 107.1 MiB/s | 219.4 KiB | 00m00s [ 64/157] Installing libcom_err-0:1.47. 100% | 117.3 MiB/s | 240.2 KiB | 00m00s [ 65/157] Installing libtasn1-0:4.19.0- 100% | 113.7 MiB/s | 349.2 KiB | 00m00s [ 66/157] Installing p11-kit-0:0.25.5-4 100% | 121.0 MiB/s | 3.1 MiB | 00m00s [ 67/157] Installing libunistring-0:1.1 100% | 144.0 MiB/s | 1.9 MiB | 00m00s [ 68/157] Installing libidn2-0:2.3.7-2. 100% | 64.6 MiB/s | 462.8 KiB | 00m00s [ 69/157] Installing libpsl-0:0.21.5-4. 100% | 96.4 MiB/s | 197.3 KiB | 00m00s [ 70/157] Installing p11-kit-trust-0:0. 100% | 53.5 MiB/s | 657.1 KiB | 00m00s [ 71/157] Installing zstd-0:1.5.6-2.fc4 100% | 147.6 MiB/s | 2.1 MiB | 00m00s [ 72/157] Installing util-linux-core-0: 100% | 177.1 MiB/s | 6.2 MiB | 00m00s [ 73/157] Installing tar-2:1.35-4.fc41. 100% | 138.8 MiB/s | 3.2 MiB | 00m00s [ 74/157] Installing libsemanage-0:3.8- 100% | 68.2 MiB/s | 418.8 KiB | 00m00s [ 75/157] Installing shadow-utils-2:4.1 100% | 89.3 MiB/s | 5.0 MiB | 00m00s [ 76/157] Installing zip-0:3.0-42.fc42. 100% | 123.8 MiB/s | 887.1 KiB | 00m00s [ 77/157] Installing gdbm-1:1.23-7.fc41 100% | 113.9 MiB/s | 933.2 KiB | 00m00s [ 78/157] Installing cyrus-sasl-lib-0:2 100% | 161.1 MiB/s | 3.5 MiB | 00m00s [ 79/157] Installing libfdisk-0:2.40.2- 100% | 149.5 MiB/s | 612.2 KiB | 00m00s [ 80/157] Installing libxml2-0:2.12.8-2 100% | 139.8 MiB/s | 2.5 MiB | 00m00s [ 81/157] Installing bzip2-0:1.0.8-19.f 100% | 105.5 MiB/s | 432.0 KiB | 00m00s [ 82/157] Installing sqlite-libs-0:3.47 100% | 137.7 MiB/s | 1.8 MiB | 00m00s [ 83/157] Installing add-determinism-0: 100% | 144.3 MiB/s | 2.6 MiB | 00m00s [ 84/157] Installing build-reproducibil 100% | 1.0 MiB/s | 1.0 KiB | 00m00s [ 85/157] Installing ed-0:1.20.2-2.fc41 100% | 92.8 MiB/s | 285.1 KiB | 00m00s [ 86/157] Installing patch-0:2.7.6-25.f 100% | 95.7 MiB/s | 392.1 KiB | 00m00s [ 87/157] Installing filesystem-srpm-ma 100% | 35.9 MiB/s | 36.8 KiB | 00m00s [ 88/157] Installing elfutils-default-y 100% | 340.5 KiB/s | 2.0 KiB | 00m00s [ 89/157] Installing elfutils-libs-0:0. 100% | 120.6 MiB/s | 864.3 KiB | 00m00s [ 90/157] Installing cpio-0:2.15-2.fc41 100% | 101.7 MiB/s | 1.2 MiB | 00m00s [ 91/157] Installing diffutils-0:3.10-8 100% | 127.7 MiB/s | 2.2 MiB | 00m00s [ 92/157] Installing librtas-0:2.0.6-2. 100% | 44.4 MiB/s | 499.7 KiB | 00m00s [ 93/157] Installing jansson-0:2.14-1.f 100% | 108.6 MiB/s | 222.5 KiB | 00m00s [ 94/157] Installing json-c-0:0.18-1.fc 100% | 68.5 MiB/s | 140.4 KiB | 00m00s [ 95/157] Installing libpkgconf-0:2.3.0 100% | 97.2 MiB/s | 199.1 KiB | 00m00s [ 96/157] Installing pkgconf-0:2.3.0-1. 100% | 79.1 MiB/s | 243.0 KiB | 00m00s [ 97/157] Installing keyutils-libs-0:1. 100% | 111.1 MiB/s | 227.5 KiB | 00m00s [ 98/157] Installing libverto-0:0.3.2-9 100% | 97.2 MiB/s | 199.0 KiB | 00m00s [ 99/157] Installing libgomp-0:15.0.0-0 100% | 123.1 MiB/s | 630.4 KiB | 00m00s [100/157] Installing xxhash-libs-0:0.8. 100% | 104.2 MiB/s | 213.3 KiB | 00m00s [101/157] Installing libbrotli-0:1.1.0- 100% | 140.6 MiB/s | 1.3 MiB | 00m00s [102/157] Installing libnghttp2-0:1.64. 100% | 106.5 MiB/s | 327.2 KiB | 00m00s [103/157] Installing libtool-ltdl-0:2.5 100% | 90.9 MiB/s | 93.1 KiB | 00m00s [104/157] Installing pkgconf-m4-0:2.3.0 100% | 14.5 MiB/s | 14.8 KiB | 00m00s [105/157] Installing pkgconf-pkg-config 100% | 1.7 MiB/s | 1.8 KiB | 00m00s [106/157] Installing rust-srpm-macros-0 100% | 5.4 MiB/s | 5.6 KiB | 00m00s [107/157] Installing qt6-srpm-macros-0: 100% | 0.0 B/s | 732.0 B | 00m00s [108/157] Installing qt5-srpm-macros-0: 100% | 757.8 KiB/s | 776.0 B | 00m00s [109/157] Installing perl-srpm-macros-0 100% | 0.0 B/s | 1.1 KiB | 00m00s [110/157] Installing package-notes-srpm 100% | 2.0 MiB/s | 2.0 KiB | 00m00s [111/157] Installing openblas-srpm-macr 100% | 0.0 B/s | 392.0 B | 00m00s [112/157] Installing ocaml-srpm-macros- 100% | 0.0 B/s | 2.2 KiB | 00m00s [113/157] Installing kernel-srpm-macros 100% | 2.3 MiB/s | 2.3 KiB | 00m00s [114/157] Installing gnat-srpm-macros-0 100% | 0.0 B/s | 1.3 KiB | 00m00s [115/157] Installing ghc-srpm-macros-0: 100% | 0.0 B/s | 1.0 KiB | 00m00s [116/157] Installing fpc-srpm-macros-0: 100% | 0.0 B/s | 420.0 B | 00m00s [117/157] Installing ansible-srpm-macro 100% | 17.7 MiB/s | 36.2 KiB | 00m00s [118/157] Installing coreutils-common-0 100% | 147.2 MiB/s | 11.2 MiB | 00m00s [119/157] Installing openssl-libs-1:3.2 100% | 163.2 MiB/s | 8.7 MiB | 00m00s [120/157] Installing coreutils-0:9.5-11 100% | 145.9 MiB/s | 9.5 MiB | 00m00s [121/157] Installing ca-certificates-0: 100% | 950.3 KiB/s | 2.4 MiB | 00m03s [122/157] Installing krb5-libs-0:1.21.3 100% | 129.3 MiB/s | 3.0 MiB | 00m00s [123/157] Installing libarchive-0:3.7.7 100% | 126.8 MiB/s | 1.3 MiB | 00m00s [124/157] Installing gzip-0:1.13-2.fc41 100% | 77.9 MiB/s | 558.4 KiB | 00m00s [125/157] Installing authselect-libs-0: 100% | 61.4 MiB/s | 880.4 KiB | 00m00s [126/157] Installing cracklib-0:2.9.11- 100% | 77.0 MiB/s | 945.6 KiB | 00m00s [127/157] Installing libpwquality-0:1.4 100% | 79.1 MiB/s | 1.1 MiB | 00m00s [128/157] Installing libtirpc-0:1.3.6-1 100% | 54.4 MiB/s | 278.5 KiB | 00m00s [129/157] Installing pam-0:1.7.0-3.fc42 100% | 93.4 MiB/s | 4.3 MiB | 00m00s [130/157] Installing libssh-0:0.11.1-1. 100% | 108.8 MiB/s | 779.8 KiB | 00m00s [131/157] Installing rpm-sequoia-0:1.7. 100% | 143.3 MiB/s | 2.7 MiB | 00m00s [132/157] Installing rpm-libs-0:4.20.0- 100% | 144.5 MiB/s | 1.2 MiB | 00m00s [133/157] Installing rpm-build-libs-0:4 100% | 127.4 MiB/s | 391.4 KiB | 00m00s [134/157] Installing libevent-0:2.1.12- 100% | 158.5 MiB/s | 1.6 MiB | 00m00s [135/157] Installing openldap-0:2.6.8-6 100% | 107.2 MiB/s | 878.5 KiB | 00m00s [136/157] Installing libcurl-0:8.11.1-2 100% | 126.7 MiB/s | 1.0 MiB | 00m00s [137/157] Installing elfutils-debuginfo 100% | 34.9 MiB/s | 143.1 KiB | 00m00s [138/157] Installing binutils-0:2.43.50 100% | 166.2 MiB/s | 31.4 MiB | 00m00s [139/157] Installing elfutils-0:0.192-7 100% | 154.9 MiB/s | 3.4 MiB | 00m00s [140/157] Installing gdb-minimal-0:15.2 100% | 163.1 MiB/s | 15.2 MiB | 00m00s [141/157] Installing debugedit-0:5.1-2. 100% | 75.9 MiB/s | 310.8 KiB | 00m00s [142/157] Installing curl-0:8.11.1-2.fc 100% | 31.6 MiB/s | 518.4 KiB | 00m00s [143/157] Installing rpm-0:4.20.0-1.fc4 100% | 79.9 MiB/s | 3.4 MiB | 00m00s [144/157] Installing efi-srpm-macros-0: 100% | 40.2 MiB/s | 41.2 KiB | 00m00s [145/157] Installing lua-srpm-macros-0: 100% | 1.9 MiB/s | 1.9 KiB | 00m00s [146/157] Installing zig-srpm-macros-0: 100% | 1.6 MiB/s | 1.7 KiB | 00m00s [147/157] Installing fonts-srpm-macros- 100% | 55.7 MiB/s | 57.0 KiB | 00m00s [148/157] Installing forge-srpm-macros- 100% | 39.3 MiB/s | 40.3 KiB | 00m00s [149/157] Installing go-srpm-macros-0:3 100% | 30.3 MiB/s | 62.0 KiB | 00m00s [150/157] Installing python-srpm-macros 100% | 25.5 MiB/s | 52.2 KiB | 00m00s [151/157] Installing redhat-rpm-config- 100% | 37.7 MiB/s | 193.2 KiB | 00m00s [152/157] Installing rpm-build-0:4.20.0 100% | 139.6 MiB/s | 1.4 MiB | 00m00s [153/157] Installing pyproject-srpm-mac 100% | 834.6 KiB/s | 2.5 KiB | 00m00s [154/157] Installing util-linux-0:2.40. 100% | 170.9 MiB/s | 17.3 MiB | 00m00s [155/157] Installing authselect-0:1.5.0 100% | 36.0 MiB/s | 184.2 KiB | 00m00s [156/157] Installing which-0:2.21-42.fc 100% | 81.5 MiB/s | 250.2 KiB | 00m00s [157/157] Installing info-0:7.1.1-2.fc4 100% | 231.1 KiB/s | 741.9 KiB | 00m03s Warning: skipped OpenPGP checks for 9 packages from repositories: copr_base, https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch Complete! Finish: installing minimal buildroot with dnf5 Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: add-determinism-0.4.3-1.fc42.ppc64le alternatives-1.30-1.fc41.ppc64le ansible-srpm-macros-1-16.fc41.noarch audit-libs-4.0.2-1.fc42.ppc64le authselect-1.5.0-8.fc42.ppc64le authselect-libs-1.5.0-8.fc42.ppc64le basesystem-11-21.fc41.noarch bash-5.2.37-1.fc42.ppc64le binutils-2.43.50-9.fc42.ppc64le build-reproducibility-srpm-macros-0.4.3-1.fc42.noarch bzip2-1.0.8-19.fc41.ppc64le bzip2-libs-1.0.8-19.fc41.ppc64le ca-certificates-2024.2.69_v8.0.401-3.fc42.noarch coreutils-9.5-11.fc42.ppc64le coreutils-common-9.5-11.fc42.ppc64le cpio-2.15-2.fc41.ppc64le cracklib-2.9.11-6.fc41.ppc64le crypto-policies-20241128-1.gitbb7b0b0.fc42.noarch curl-8.11.1-2.fc42.ppc64le cyrus-sasl-lib-2.1.28-27.fc41.ppc64le debugedit-5.1-2.fc42.ppc64le diffutils-3.10-8.fc41.ppc64le dwz-0.15-8.fc42.ppc64le ed-1.20.2-2.fc41.ppc64le efi-srpm-macros-5-13.fc42.noarch elfutils-0.192-7.fc42.ppc64le elfutils-debuginfod-client-0.192-7.fc42.ppc64le elfutils-default-yama-scope-0.192-7.fc42.noarch elfutils-libelf-0.192-7.fc42.ppc64le elfutils-libs-0.192-7.fc42.ppc64le fedora-gpg-keys-42-0.3.noarch fedora-release-42-0.11.noarch fedora-release-common-42-0.11.noarch fedora-release-identity-basic-42-0.11.noarch fedora-repos-42-0.3.noarch fedora-repos-rawhide-42-0.3.noarch file-5.45-8.fc42.ppc64le file-libs-5.45-8.fc42.ppc64le filesystem-3.18-29.fc42.ppc64le filesystem-srpm-macros-3.18-29.fc42.noarch findutils-4.10.0-4.fc41.ppc64le fonts-srpm-macros-2.0.5-17.fc41.noarch forge-srpm-macros-0.4.0-1.fc42.noarch fpc-srpm-macros-1.3-13.fc41.noarch gawk-5.3.0-4.fc41.ppc64le gdb-minimal-15.2-4.fc42.ppc64le gdbm-1.23-7.fc41.ppc64le gdbm-libs-1.23-7.fc41.ppc64le ghc-srpm-macros-1.9.2-1.fc42.noarch glibc-2.40.9000-24.fc42.ppc64le glibc-common-2.40.9000-24.fc42.ppc64le glibc-gconv-extra-2.40.9000-24.fc42.ppc64le glibc-minimal-langpack-2.40.9000-24.fc42.ppc64le gmp-6.3.0-2.fc41.ppc64le gnat-srpm-macros-6-6.fc41.noarch go-srpm-macros-3.6.0-5.fc42.noarch gpg-pubkey-105ef944-65ca83d1 gpg-pubkey-31645531-66b6dccf gpg-pubkey-e99d6ad1-64d2612c grep-3.11-9.fc41.ppc64le gzip-1.13-2.fc41.ppc64le info-7.1.1-2.fc42.ppc64le jansson-2.14-1.fc42.ppc64le json-c-0.18-1.fc42.ppc64le kernel-srpm-macros-1.0-24.fc41.noarch keyutils-libs-1.6.3-4.fc41.ppc64le krb5-libs-1.21.3-3.fc42.ppc64le libacl-2.3.2-2.fc42.ppc64le libarchive-3.7.7-1.fc42.ppc64le libattr-2.5.2-4.fc41.ppc64le libblkid-2.40.2-8.fc42.ppc64le libbrotli-1.1.0-5.fc41.ppc64le libcap-2.71-1.fc42.ppc64le libcap-ng-0.8.5-3.fc41.ppc64le libcom_err-1.47.1-6.fc42.ppc64le libcurl-8.11.1-2.fc42.ppc64le libeconf-0.7.5-1.fc42.ppc64le libevent-2.1.12-14.fc41.ppc64le libfdisk-2.40.2-8.fc42.ppc64le libffi-3.4.6-3.fc42.ppc64le libgcc-15.0.0-0.2.fc42.ppc64le libgomp-15.0.0-0.2.fc42.ppc64le libidn2-2.3.7-2.fc41.ppc64le libmount-2.40.2-8.fc42.ppc64le libnghttp2-1.64.0-1.fc42.ppc64le libpkgconf-2.3.0-1.fc42.ppc64le libpsl-0.21.5-4.fc41.ppc64le libpwquality-1.4.5-11.fc41.ppc64le librtas-2.0.6-2.fc41.ppc64le libselinux-3.8-0.rc1.2.fc42.ppc64le libsemanage-3.8-0.rc1.1.fc42.ppc64le libsepol-3.8-0.rc1.1.fc42.ppc64le libsmartcols-2.40.2-8.fc42.ppc64le libssh-0.11.1-1.fc42.ppc64le libssh-config-0.11.1-1.fc42.noarch libstdc++-15.0.0-0.2.fc42.ppc64le libtasn1-4.19.0-9.fc41.ppc64le libtirpc-1.3.6-1.fc42.ppc64le libtool-ltdl-2.5.4-1.fc42.ppc64le libunistring-1.1-8.fc41.ppc64le libuuid-2.40.2-8.fc42.ppc64le libverto-0.3.2-9.fc41.ppc64le libxcrypt-4.4.36-11.fc42.ppc64le libxml2-2.12.8-2.fc41.ppc64le libzstd-1.5.6-2.fc41.ppc64le lua-libs-5.4.7-1.fc42.ppc64le lua-srpm-macros-1-14.fc41.noarch lz4-libs-1.10.0-1.fc41.ppc64le mpfr-4.2.1-5.fc41.ppc64le ncurses-base-6.5-2.20240629.fc41.noarch ncurses-libs-6.5-2.20240629.fc41.ppc64le ocaml-srpm-macros-10-3.fc41.noarch openblas-srpm-macros-2-18.fc41.noarch openldap-2.6.8-6.fc42.ppc64le openssl-libs-3.2.2-8.fc42.ppc64le p11-kit-0.25.5-4.fc42.ppc64le p11-kit-trust-0.25.5-4.fc42.ppc64le package-notes-srpm-macros-0.5-12.fc41.noarch pam-1.7.0-3.fc42.ppc64le pam-libs-1.7.0-3.fc42.ppc64le patch-2.7.6-25.fc41.ppc64le pcre2-10.44-1.fc41.1.ppc64le pcre2-syntax-10.44-1.fc41.1.noarch perl-srpm-macros-1-56.fc41.noarch pkgconf-2.3.0-1.fc42.ppc64le pkgconf-m4-2.3.0-1.fc42.noarch pkgconf-pkg-config-2.3.0-1.fc42.ppc64le popt-1.19-7.fc41.ppc64le publicsuffix-list-dafsa-20240107-4.fc41.noarch pyproject-srpm-macros-1.16.3-1.fc42.noarch python-srpm-macros-3.13-3.fc41.noarch qt5-srpm-macros-5.15.15-1.fc42.noarch qt6-srpm-macros-6.8.1-4.fc42.noarch readline-8.2-11.fc42.ppc64le redhat-rpm-config-300-1.no_annobin.0.fc42.noarch rpm-4.20.0-1.fc42.ppc64le rpm-build-4.20.0-1.fc42.ppc64le rpm-build-libs-4.20.0-1.fc42.ppc64le rpm-libs-4.20.0-1.fc42.ppc64le rpm-sequoia-1.7.0-3.fc42.ppc64le rust-srpm-macros-26.3-3.fc42.noarch sed-4.9-3.fc41.ppc64le setup-2.15.0-5.fc41.noarch shadow-utils-4.17.0~rc1-1.fc42.ppc64le sqlite-libs-3.47.2-1.fc42.ppc64le systemd-libs-257-1.fc42.ppc64le tar-1.35-4.fc41.ppc64le unzip-6.0-65.fc42.ppc64le util-linux-2.40.2-8.fc42.ppc64le util-linux-core-2.40.2-8.fc42.ppc64le which-2.21-42.fc41.ppc64le xxhash-libs-0.8.2-4.fc42.ppc64le xz-5.6.3-2.fc42.ppc64le xz-libs-5.6.3-2.fc42.ppc64le zig-srpm-macros-1-3.fc41.noarch zip-3.0-42.fc42.ppc64le zlib-ng-compat-2.2.2-1.fc42.ppc64le zstd-1.5.6-2.fc41.ppc64le Start: buildsrpm Start: rpmbuild -bs Building target platforms: ppc64le Building for target ppc64le setting SOURCE_DATE_EPOCH=1721174400 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-5.fc42.src.rpm Finish: rpmbuild -bs INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-ppc64le-1734563230.610119/root/var/log/dnf5.log INFO: chroot_scan: creating tarball /var/lib/copr-rpmbuild/results/chroot_scan.tar.gz /bin/tar: Removing leading `/' from member names Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-cin4kuuu/bowtie/bowtie.spec) Config(child) 0 minutes 25 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-5.fc42.src.rpm) Config(fedora-rawhide-ppc64le) Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-bootstrap-1734563230.610119/root. INFO: reusing tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-bootstrap-1734563230.610119/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-1734563230.610119/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-4.20.0-1.fc42.ppc64le rpm-sequoia-1.7.0-3.fc42.ppc64le dnf5-5.2.8.1-2.fc42.ppc64le dnf5-plugins-5.2.8.1-2.fc42.ppc64le Finish: chroot init Start: build phase for bowtie-1.3.1-5.fc42.src.rpm Start: build setup for bowtie-1.3.1-5.fc42.src.rpm Building target platforms: ppc64le Building for target ppc64le setting SOURCE_DATE_EPOCH=1721174400 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-5.fc42.src.rpm Updating and loading repositories: fedora 100% | 75.1 KiB/s | 3.0 KiB | 00m00s Copr repository 100% | 40.3 KiB/s | 1.5 KiB | 00m00s Additional repo https_fedorapeople_org 100% | 23.5 KiB/s | 1.5 KiB | 00m00s Copr repository 100% | 4.3 MiB/s | 818.7 KiB | 00m00s Repositories loaded. Package Arch Version Repository Size Installing: gcc-c++ ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 38.2 MiB hostname ppc64le 3.25-1.fc42 fedora 217.4 KiB make ppc64le 1:4.4.1-9.fc42 fedora 2.0 MiB perl-Clone ppc64le 0.47-1.fc42 fedora 208.2 KiB perl-Data-Dumper ppc64le 2.189-512.fc41 fedora 263.4 KiB perl-FindBin noarch 1.54-512.fc42 fedora 6.7 KiB perl-Getopt-Long noarch 1:2.58-2.fc41 fedora 144.5 KiB perl-Test-Deep noarch 1.204-6.fc41 fedora 264.1 KiB perl-interpreter ppc64le 4:5.40.0-512.fc42 fedora 302.2 KiB perl-lib ppc64le 0.65-512.fc42 fedora 8.5 KiB python3 ppc64le 3.13.1-2.fc42 fedora 82.5 KiB tbb-devel ppc64le 2022.0.0-2.fc42 fedora 1.4 MiB zlib-ng-compat-devel ppc64le 2.2.2-1.fc42 fedora 106.8 KiB Installing dependencies: annobin-docs noarch 12.79-1.fc42 copr_base 98.6 KiB annobin-plugin-gcc ppc64le 12.79-1.fc42 copr_base 997.1 KiB cmake-filesystem ppc64le 3.31.2-1.fc42 fedora 0.0 B cpp ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 34.5 MiB expat ppc64le 2.6.4-1.fc42 fedora 349.2 KiB gcc ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 96.5 MiB gcc-plugin-annobin ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 67.4 KiB glibc-devel ppc64le 2.40.9000-24.fc42 fedora 2.6 MiB groff-base ppc64le 1.23.0-7.fc41 fedora 5.4 MiB hwloc-libs ppc64le 2.11.2-1.fc42 fedora 3.1 MiB kernel-headers ppc64le 6.13.0-0.rc3.29.fc42 fedora 6.5 MiB libasan ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 2.1 MiB libatomic ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 65.8 KiB libb2 ppc64le 0.98.1-12.fc41 fedora 202.1 KiB libmpc ppc64le 1.3.1-6.fc41 fedora 345.6 KiB libstdc++-devel ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 15.6 MiB libubsan ppc64le 15.0.0-0.2.fc42 https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch 652.6 KiB libxcrypt-devel ppc64le 4.4.36-11.fc42 fedora 30.5 KiB mpdecimal ppc64le 2.5.1-16.fc41 fedora 328.9 KiB ncurses ppc64le 6.5-2.20240629.fc41 fedora 1.7 MiB perl-AutoLoader noarch 5.74-512.fc42 fedora 20.5 KiB perl-B ppc64le 1.89-512.fc42 fedora 605.9 KiB perl-Carp noarch 1.54-511.fc41 fedora 46.6 KiB perl-Class-Struct noarch 0.68-512.fc42 fedora 25.4 KiB perl-Digest noarch 1.20-511.fc41 fedora 35.3 KiB perl-Digest-MD5 ppc64le 2.59-5.fc41 fedora 231.5 KiB perl-DynaLoader ppc64le 1.56-512.fc42 fedora 32.1 KiB perl-Encode ppc64le 4:3.21-511.fc41 fedora 5.9 MiB perl-Errno ppc64le 1.38-512.fc42 fedora 8.4 KiB perl-Exporter noarch 5.78-511.fc41 fedora 54.3 KiB perl-Fcntl ppc64le 1.18-512.fc42 fedora 220.7 KiB perl-File-Basename noarch 2.86-512.fc42 fedora 14.0 KiB perl-File-Path noarch 2.18-511.fc41 fedora 63.5 KiB perl-File-Temp noarch 1:0.231.100-511.fc41 fedora 162.3 KiB perl-File-stat noarch 1.14-512.fc42 fedora 12.5 KiB perl-FileHandle noarch 2.05-512.fc42 fedora 9.3 KiB perl-Getopt-Std noarch 1.14-512.fc42 fedora 11.2 KiB perl-HTTP-Tiny noarch 0.090-1.fc42 fedora 154.4 KiB perl-IO ppc64le 1.55-512.fc42 fedora 318.8 KiB perl-IO-Socket-IP noarch 0.43-1.fc42 fedora 100.3 KiB perl-IO-Socket-SSL noarch 2.089-1.fc42 fedora 703.3 KiB perl-IPC-Open3 noarch 1.22-512.fc42 fedora 22.5 KiB perl-JSON-PP noarch 1:4.16-512.fc41 fedora 141.8 KiB perl-MIME-Base32 noarch 1.303-21.fc41 fedora 30.7 KiB perl-MIME-Base64 ppc64le 3.16-511.fc41 fedora 221.8 KiB perl-Math-BigInt noarch 1:2.0030.03-3.fc41 fedora 957.7 KiB perl-Math-Complex noarch 1.62-512.fc42 fedora 85.0 KiB perl-Net-SSLeay ppc64le 1.94-7.fc41 fedora 1.6 MiB perl-POSIX ppc64le 2.20-512.fc42 fedora 392.0 KiB perl-PathTools ppc64le 3.91-511.fc41 fedora 351.9 KiB perl-Pod-Escapes noarch 1:1.07-511.fc41 fedora 24.9 KiB perl-Pod-Perldoc noarch 3.28.01-512.fc41 fedora 163.7 KiB perl-Pod-Simple noarch 1:3.45-511.fc41 fedora 560.9 KiB perl-Pod-Usage noarch 4:2.03-511.fc41 fedora 84.8 KiB perl-Scalar-List-Utils ppc64le 5:1.68-1.fc42 fedora 280.6 KiB perl-SelectSaver noarch 1.02-512.fc42 fedora 2.2 KiB perl-Socket ppc64le 4:2.038-511.fc41 fedora 271.7 KiB perl-Storable ppc64le 1:3.32-511.fc41 fedora 372.3 KiB perl-Symbol noarch 1.09-512.fc42 fedora 6.8 KiB perl-Term-ANSIColor noarch 5.01-512.fc41 fedora 97.5 KiB perl-Term-Cap noarch 1.18-511.fc41 fedora 29.3 KiB perl-Term-Table noarch 0.023-2.fc42 fedora 77.7 KiB perl-Test-Simple noarch 3:1.302204-1.fc42 fedora 1.7 MiB perl-Text-ParseWords noarch 3.31-511.fc41 fedora 13.6 KiB perl-Text-Tabs+Wrap noarch 2024.001-511.fc41 fedora 22.6 KiB perl-Time-HiRes ppc64le 4:1.9777-511.fc41 fedora 279.6 KiB perl-Time-Local noarch 2:1.350-511.fc41 fedora 69.0 KiB perl-URI noarch 5.31-1.fc42 fedora 257.0 KiB perl-base noarch 2.27-512.fc42 fedora 12.5 KiB perl-constant noarch 1.33-512.fc41 fedora 26.2 KiB perl-if noarch 0.61.000-512.fc42 fedora 5.8 KiB perl-libnet noarch 3.15-512.fc41 fedora 289.4 KiB perl-libs ppc64le 4:5.40.0-512.fc42 fedora 11.5 MiB perl-locale noarch 1.12-512.fc42 fedora 6.5 KiB perl-mro ppc64le 1.29-512.fc42 fedora 209.3 KiB perl-overload noarch 1.37-512.fc42 fedora 71.5 KiB perl-overloading noarch 0.02-512.fc42 fedora 4.8 KiB perl-parent noarch 1:0.244-1.fc42 fedora 10.3 KiB perl-podlators noarch 1:6.0.2-2.fc41 fedora 317.5 KiB perl-threads ppc64le 1:2.40-511.fc41 fedora 263.1 KiB perl-vars noarch 1.05-512.fc42 fedora 3.9 KiB python-pip-wheel noarch 24.3.1-1.fc42 fedora 1.2 MiB python3-libs ppc64le 3.13.1-2.fc42 fedora 42.8 MiB tbb ppc64le 2022.0.0-2.fc42 fedora 680.5 KiB tbb-bind ppc64le 2022.0.0-2.fc42 fedora 66.3 KiB tzdata noarch 2024b-1.fc42 fedora 1.6 MiB Transaction Summary: Installing: 99 packages Total size of inbound packages is 89 MiB. Need to download 4 MiB. After this operation, 290 MiB extra will be used (install 290 MiB, remove 0 B). [1/2] make-1:4.4.1-9.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [2/4] perl-Data-Dumper-0:2.189-512.fc41 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [3/6] perl-Getopt-Long-1:2.58-2.fc41.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [4/9] perl-interpreter-4:5.40.0-512.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 5/10] python3-0:3.13.1-2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 6/12] zlib-ng-compat-devel-0:2.2.2-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 7/13] gcc-c++-0:15.0.0-0.2.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 8/14] perl-AutoLoader-0:5.74-512.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 9/15] perl-Exporter-0:5.78-511.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [10/16] perl-libs-4:5.40.0-512.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [11/17] perl-B-0:1.89-512.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [12/18] perl-Carp-0:1.54-511.fc41.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [13/19] perl-Scalar-List-Utils-5:1.68-1 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [14/20] perl-constant-0:1.33-512.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [15/21] perl-File-Basename-0:2.86-512.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [16/22] perl-PathTools-0:3.91-511.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [17/23] perl-Pod-Usage-4:2.03-511.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [18/24] perl-Text-ParseWords-0:3.31-511 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [19/25] perl-base-0:2.27-512.fc42.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [20/26] perl-overload-0:1.37-512.fc42.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [21/28] python3-libs-0:3.13.1-2.fc42.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [22/29] cmake-filesystem-0:3.31.2-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [23/32] libmpc-0:1.3.1-6.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [24/33] gcc-0:15.0.0-0.2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [25/34] libstdc++-devel-0:15.0.0-0.2.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [26/35] perl-DynaLoader-0:1.56-512.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [27/36] perl-Encode-4:3.21-511.fc41.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [28/37] perl-if-0:0.61.000-512.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [29/38] perl-overloading-0:0.02-512.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [30/39] perl-Errno-0:1.38-512.fc42.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [31/40] perl-Pod-Perldoc-0:3.28.01-512. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [32/41] perl-podlators-1:6.0.2-2.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [33/42] perl-mro-0:1.29-512.fc42.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [34/43] perl-File-Temp-1:0.231.100-511. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [35/44] perl-IO-0:1.55-512.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [36/46] perl-POSIX-0:2.20-512.fc42.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [37/47] perl-Storable-1:3.32-511.fc41.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [38/48] perl-Symbol-0:1.09-512.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [39/49] perl-Term-ANSIColor-0:5.01-512. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [40/53] perl-vars-0:1.05-512.fc42.noarc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [41/54] expat-0:2.6.4-1.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [42/55] libb2-0:0.98.1-12.fc41.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [43/56] mpdecimal-0:2.5.1-16.fc41.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [44/57] python-pip-wheel-0:24.3.1-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [45/58] tzdata-0:2024b-1.fc42.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [46/60] glibc-devel-0:2.40.9000-24.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [47/61] cpp-0:15.0.0-0.2.fc42.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [48/62] perl-Getopt-Std-0:1.14-512.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [49/63] perl-MIME-Base64-0:3.16-511.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [50/64] perl-parent-1:0.244-1.fc42.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [51/65] groff-base-0:1.23.0-7.fc41.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [52/66] perl-Fcntl-0:1.18-512.fc42.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [53/67] perl-HTTP-Tiny-0:0.090-1.fc42.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [54/68] perl-IPC-Open3-0:1.22-512.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [55/69] perl-Pod-Simple-1:3.45-511.fc41 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [56/70] perl-Term-Cap-0:1.18-511.fc41.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [57/71] perl-File-Path-0:2.18-511.fc41. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [58/72] perl-File-stat-0:1.14-512.fc42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [59/73] perl-SelectSaver-0:1.02-512.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [60/74] perl-Socket-4:2.038-511.fc41.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [61/76] perl-locale-0:1.12-512.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [62/77] kernel-headers-0:6.13.0-0.rc3.2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [63/78] libxcrypt-devel-0:4.4.36-11.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [64/79] perl-IO-Socket-SSL-0:2.089-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [65/80] perl-Net-SSLeay-0:1.94-7.fc41.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [66/81] perl-Time-Local-2:1.350-511.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [67/82] perl-Pod-Escapes-1:1.07-511.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [68/83] perl-Text-Tabs+Wrap-0:2024.001- 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [69/84] ncurses-0:6.5-2.20240629.fc41.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [70/85] perl-Class-Struct-0:0.68-512.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [71/87] perl-IO-Socket-IP-0:0.43-1.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [72/88] perl-URI-0:5.31-1.fc42.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [73/89] perl-MIME-Base32-0:1.303-21.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [74/90] perl-libnet-0:3.15-512.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [75/91] perl-Digest-MD5-0:2.59-5.fc41.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [76/92] perl-FileHandle-0:2.05-512.fc42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [77/93] perl-Digest-0:1.20-511.fc41.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [78/94] libasan-0:15.0.0-0.2.fc42.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [79/95] libatomic-0:15.0.0-0.2.fc42.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [80/96] libubsan-0:15.0.0-0.2.fc42.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [81/97] gcc-plugin-annobin-0:15.0.0-0.2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [82/98] annobin-plugin-gcc-0:12.79-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [83/99] annobin-docs-0:12.79-1.fc42.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [84/99] perl-Clone-0:0.47-1.fc42.ppc64l 100% | 357.2 KiB/s | 22.9 KiB | 00m00s [85/99] perl-FindBin-0:1.54-512.fc42.no 100% | 199.7 KiB/s | 14.2 KiB | 00m00s [86/99] hostname-0:3.25-1.fc42.ppc64le 100% | 376.3 KiB/s | 27.8 KiB | 00m00s [87/99] perl-lib-0:0.65-512.fc42.ppc64l 100% | 925.9 KiB/s | 14.8 KiB | 00m00s [88/99] perl-Test-Deep-0:1.204-6.fc41.n 100% | 3.7 MiB/s | 118.6 KiB | 00m00s [89/99] tbb-devel-0:2022.0.0-2.fc42.ppc 100% | 8.5 MiB/s | 244.8 KiB | 00m00s [90/99] perl-Test-Simple-3:1.302204-1.f 100% | 23.4 MiB/s | 863.0 KiB | 00m00s [91/99] tbb-bind-0:2022.0.0-2.fc42.ppc6 100% | 828.4 KiB/s | 18.2 KiB | 00m00s [92/99] tbb-0:2022.0.0-2.fc42.ppc64le 100% | 5.5 MiB/s | 167.5 KiB | 00m00s [93/99] perl-Term-Table-0:0.023-2.fc42. 100% | 4.2 MiB/s | 42.9 KiB | 00m00s [94/99] perl-Time-HiRes-4:1.9777-511.fc 100% | 5.7 MiB/s | 58.4 KiB | 00m00s [95/99] perl-JSON-PP-1:4.16-512.fc41.no 100% | 3.8 MiB/s | 66.1 KiB | 00m00s [96/99] perl-threads-1:2.40-511.fc41.pp 100% | 5.7 MiB/s | 58.4 KiB | 00m00s [97/99] perl-Math-Complex-0:1.62-512.fc 100% | 3.7 MiB/s | 46.0 KiB | 00m00s [98/99] perl-Math-BigInt-1:2.0030.03-3. 100% | 8.8 MiB/s | 225.7 KiB | 00m00s [99/99] hwloc-libs-0:2.11.2-1.fc42.ppc6 100% | 45.0 MiB/s | 2.1 MiB | 00m00s -------------------------------------------------------------------------------- [99/99] Total 100% | 8.1 MiB/s | 4.1 MiB | 00m01s Running transaction [ 1/101] Verify package files 100% | 133.0 B/s | 99.0 B | 00m01s [ 2/101] Prepare transaction 100% | 630.0 B/s | 99.0 B | 00m00s [ 3/101] Installing libmpc-0:1.3.1-6.f 100% | 84.7 MiB/s | 347.1 KiB | 00m00s [ 4/101] Installing tbb-0:2022.0.0-2.f 100% | 111.2 MiB/s | 683.5 KiB | 00m00s [ 5/101] Installing cmake-filesystem-0 100% | 2.5 MiB/s | 7.6 KiB | 00m00s [ 6/101] Installing cpp-0:15.0.0-0.2.f 100% | 150.5 MiB/s | 34.5 MiB | 00m00s [ 7/101] Installing annobin-docs-0:12. 100% | 97.4 MiB/s | 99.7 KiB | 00m00s [ 8/101] Installing libubsan-0:15.0.0- 100% | 127.6 MiB/s | 653.4 KiB | 00m00s [ 9/101] Installing libatomic-0:15.0.0 100% | 65.1 MiB/s | 66.7 KiB | 00m00s [ 10/101] Installing libasan-0:15.0.0-0 100% | 172.9 MiB/s | 2.1 MiB | 00m00s [ 11/101] Installing ncurses-0:6.5-2.20 100% | 116.7 MiB/s | 1.8 MiB | 00m00s [ 12/101] Installing kernel-headers-0:6 100% | 66.7 MiB/s | 6.6 MiB | 00m00s [ 13/101] Installing libxcrypt-devel-0: 100% | 6.4 MiB/s | 32.9 KiB | 00m00s [ 14/101] Installing glibc-devel-0:2.40 100% | 49.6 MiB/s | 2.7 MiB | 00m00s [ 15/101] Installing groff-base-0:1.23. 100% | 109.0 MiB/s | 5.4 MiB | 00m00s [ 16/101] Installing perl-Digest-0:1.20 100% | 18.1 MiB/s | 37.1 KiB | 00m00s [ 17/101] Installing perl-B-0:1.89-512. 100% | 99.2 MiB/s | 609.3 KiB | 00m00s [ 18/101] Installing perl-FileHandle-0: 100% | 9.5 MiB/s | 9.8 KiB | 00m00s [ 19/101] Installing perl-Digest-MD5-0: 100% | 76.0 MiB/s | 233.4 KiB | 00m00s [ 20/101] Installing perl-MIME-Base32-0 100% | 31.4 MiB/s | 32.2 KiB | 00m00s [ 21/101] Installing perl-libnet-0:3.15 100% | 57.6 MiB/s | 294.7 KiB | 00m00s [ 22/101] Installing perl-Data-Dumper-0 100% | 86.4 MiB/s | 265.3 KiB | 00m00s [ 23/101] Installing perl-AutoLoader-0: 100% | 20.5 MiB/s | 20.9 KiB | 00m00s [ 24/101] Installing perl-IO-Socket-IP- 100% | 49.9 MiB/s | 102.2 KiB | 00m00s [ 25/101] Installing perl-URI-0:5.31-1. 100% | 32.9 MiB/s | 269.6 KiB | 00m00s [ 26/101] Installing perl-if-0:0.61.000 100% | 6.1 MiB/s | 6.2 KiB | 00m00s [ 27/101] Installing perl-File-Path-0:2 100% | 63.0 MiB/s | 64.5 KiB | 00m00s [ 28/101] Installing perl-locale-0:1.12 100% | 6.7 MiB/s | 6.9 KiB | 00m00s [ 29/101] Installing perl-Net-SSLeay-0: 100% | 95.3 MiB/s | 1.6 MiB | 00m00s [ 30/101] Installing perl-Time-Local-2: 100% | 34.5 MiB/s | 70.6 KiB | 00m00s [ 31/101] Installing perl-Pod-Escapes-1 100% | 25.3 MiB/s | 25.9 KiB | 00m00s [ 32/101] Installing perl-Text-Tabs+Wra 100% | 23.3 MiB/s | 23.9 KiB | 00m00s [ 33/101] Installing perl-IO-Socket-SSL 100% | 115.1 MiB/s | 707.4 KiB | 00m00s [ 34/101] Installing perl-Term-ANSIColo 100% | 48.4 MiB/s | 99.2 KiB | 00m00s [ 35/101] Installing perl-Term-Cap-0:1. 100% | 29.9 MiB/s | 30.6 KiB | 00m00s [ 36/101] Installing perl-POSIX-0:2.20- 100% | 128.0 MiB/s | 393.3 KiB | 00m00s [ 37/101] Installing perl-File-Temp-1:0 100% | 80.1 MiB/s | 164.1 KiB | 00m00s [ 38/101] Installing perl-IPC-Open3-0:1 100% | 22.7 MiB/s | 23.3 KiB | 00m00s [ 39/101] Installing perl-Class-Struct- 100% | 25.3 MiB/s | 25.9 KiB | 00m00s [ 40/101] Installing perl-Pod-Simple-1: 100% | 69.6 MiB/s | 570.5 KiB | 00m00s [ 41/101] Installing perl-HTTP-Tiny-0:0 100% | 76.4 MiB/s | 156.4 KiB | 00m00s [ 42/101] Installing perl-Symbol-0:1.09 100% | 7.0 MiB/s | 7.2 KiB | 00m00s [ 43/101] Installing perl-SelectSaver-0 100% | 2.5 MiB/s | 2.6 KiB | 00m00s [ 44/101] Installing perl-Socket-4:2.03 100% | 89.1 MiB/s | 273.8 KiB | 00m00s [ 45/101] Installing perl-File-stat-0:1 100% | 12.7 MiB/s | 13.1 KiB | 00m00s [ 46/101] Installing perl-podlators-1:6 100% | 78.5 MiB/s | 321.4 KiB | 00m00s [ 47/101] Installing perl-Pod-Perldoc-0 100% | 41.3 MiB/s | 169.3 KiB | 00m00s [ 48/101] Installing perl-Text-ParseWor 100% | 14.2 MiB/s | 14.6 KiB | 00m00s [ 49/101] Installing perl-base-0:2.27-5 100% | 12.6 MiB/s | 12.9 KiB | 00m00s [ 50/101] Installing perl-overloading-0 100% | 5.4 MiB/s | 5.5 KiB | 00m00s [ 51/101] Installing perl-mro-0:1.29-51 100% | 102.7 MiB/s | 210.4 KiB | 00m00s [ 52/101] Installing perl-Fcntl-0:1.18- 100% | 108.3 MiB/s | 221.8 KiB | 00m00s [ 53/101] Installing perl-IO-0:1.55-512 100% | 78.9 MiB/s | 323.1 KiB | 00m00s [ 54/101] Installing perl-Pod-Usage-4:2 100% | 42.2 MiB/s | 86.3 KiB | 00m00s [ 55/101] Installing perl-Scalar-List-U 100% | 69.4 MiB/s | 284.3 KiB | 00m00s [ 56/101] Installing perl-constant-0:1. 100% | 26.7 MiB/s | 27.4 KiB | 00m00s [ 57/101] Installing perl-File-Basename 100% | 14.2 MiB/s | 14.6 KiB | 00m00s [ 58/101] Installing perl-Errno-0:1.38- 100% | 8.6 MiB/s | 8.8 KiB | 00m00s [ 59/101] Installing perl-overload-0:1. 100% | 70.3 MiB/s | 71.9 KiB | 00m00s [ 60/101] Installing perl-vars-0:1.05-5 100% | 4.2 MiB/s | 4.3 KiB | 00m00s [ 61/101] Installing perl-Getopt-Std-0: 100% | 11.5 MiB/s | 11.7 KiB | 00m00s [ 62/101] Installing perl-MIME-Base64-0 100% | 72.9 MiB/s | 224.1 KiB | 00m00s [ 63/101] Installing perl-parent-1:0.24 100% | 10.7 MiB/s | 11.0 KiB | 00m00s [ 64/101] Installing perl-Storable-1:3. 100% | 121.7 MiB/s | 373.9 KiB | 00m00s [ 65/101] Installing perl-Getopt-Long-1 100% | 47.9 MiB/s | 147.2 KiB | 00m00s [ 66/101] Installing perl-Exporter-0:5. 100% | 54.3 MiB/s | 55.6 KiB | 00m00s [ 67/101] Installing perl-Carp-0:1.54-5 100% | 46.6 MiB/s | 47.7 KiB | 00m00s [ 68/101] Installing perl-PathTools-0:3 100% | 87.0 MiB/s | 356.5 KiB | 00m00s [ 69/101] Installing perl-DynaLoader-0: 100% | 31.7 MiB/s | 32.5 KiB | 00m00s [ 70/101] Installing perl-Encode-4:3.21 100% | 151.4 MiB/s | 5.9 MiB | 00m00s [ 71/101] Installing perl-libs-4:5.40.0 100% | 103.1 MiB/s | 11.6 MiB | 00m00s [ 72/101] Installing perl-interpreter-4 100% | 98.9 MiB/s | 303.9 KiB | 00m00s [ 73/101] Installing perl-Term-Table-0: 100% | 26.3 MiB/s | 80.9 KiB | 00m00s [ 74/101] Installing perl-Time-HiRes-4: 100% | 91.7 MiB/s | 281.7 KiB | 00m00s [ 75/101] Installing perl-threads-1:2.4 100% | 86.3 MiB/s | 265.1 KiB | 00m00s [ 76/101] Installing perl-Math-Complex- 100% | 83.8 MiB/s | 85.8 KiB | 00m00s [ 77/101] Installing perl-Math-BigInt-1 100% | 117.4 MiB/s | 961.8 KiB | 00m00s [ 78/101] Installing perl-JSON-PP-1:4.1 100% | 35.0 MiB/s | 143.6 KiB | 00m00s [ 79/101] Installing perl-Test-Simple-3 100% | 44.4 MiB/s | 1.8 MiB | 00m00s [ 80/101] Installing hwloc-libs-0:2.11. 100% | 182.3 MiB/s | 3.1 MiB | 00m00s [ 81/101] Installing tbb-bind-0:2022.0. 100% | 8.2 MiB/s | 67.1 KiB | 00m00s [ 82/101] Installing tzdata-0:2024b-1.f 100% | 17.9 MiB/s | 1.9 MiB | 00m00s [ 83/101] Installing python-pip-wheel-0 100% | 207.4 MiB/s | 1.2 MiB | 00m00s [ 84/101] Installing mpdecimal-0:2.5.1- 100% | 107.4 MiB/s | 330.0 KiB | 00m00s [ 85/101] Installing libb2-0:0.98.1-12. 100% | 99.2 MiB/s | 203.2 KiB | 00m00s [ 86/101] Installing expat-0:2.6.4-1.fc 100% | 24.5 MiB/s | 351.3 KiB | 00m00s [ 87/101] Installing python3-libs-0:3.1 100% | 122.3 MiB/s | 43.2 MiB | 00m00s [ 88/101] Installing libstdc++-devel-0: 100% | 125.0 MiB/s | 15.7 MiB | 00m00s [ 89/101] Installing make-1:4.4.1-9.fc4 100% | 116.2 MiB/s | 2.0 MiB | 00m00s [ 90/101] Installing gcc-0:15.0.0-0.2.f 100% | 163.3 MiB/s | 96.5 MiB | 00m01s [ 91/101] Installing gcc-c++-0:15.0.0-0 100% | 154.3 MiB/s | 38.3 MiB | 00m00s [ 92/101] Installing gcc-plugin-annobin 100% | 4.0 MiB/s | 69.0 KiB | 00m00s [ 93/101] Installing annobin-plugin-gcc 100% | 42.4 MiB/s | 998.8 KiB | 00m00s [ 94/101] Installing python3-0:3.13.1-2 100% | 27.4 MiB/s | 84.2 KiB | 00m00s [ 95/101] Installing tbb-devel-0:2022.0 100% | 82.2 MiB/s | 1.4 MiB | 00m00s [ 96/101] Installing perl-Test-Deep-0:1 100% | 30.3 MiB/s | 279.2 KiB | 00m00s [ 97/101] Installing perl-Clone-0:0.47- 100% | 102.5 MiB/s | 209.9 KiB | 00m00s [ 98/101] Installing perl-FindBin-0:1.5 100% | 7.0 MiB/s | 7.1 KiB | 00m00s [ 99/101] Installing perl-lib-0:0.65-51 100% | 8.7 MiB/s | 8.9 KiB | 00m00s [100/101] Installing zlib-ng-compat-dev 100% | 52.9 MiB/s | 108.3 KiB | 00m00s [101/101] Installing hostname-0:3.25-1. 100% | 945.8 KiB/s | 220.4 KiB | 00m00s Warning: skipped OpenPGP checks for 10 packages from repositories: copr_base, https_fedorapeople_org_dmalcolm_gcc_gcc_15_mass_prebuild_basearch Complete! Finish: build setup for bowtie-1.3.1-5.fc42.src.rpm Start: rpmbuild bowtie-1.3.1-5.fc42.src.rpm Building target platforms: ppc64le Building for target ppc64le setting SOURCE_DATE_EPOCH=1721174400 Executing(%mkbuilddir): /bin/sh -e /var/tmp/rpm-tmp.DL0XM7 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + test -d /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/rm -rf /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/SPECPARTS + RPM_EC=0 ++ jobs -p + exit 0 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.MMtSr6 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd /builddir/build/BUILD/bowtie-1.3.1-build + rm -rf bowtie-1.3.1-src + /usr/lib/rpm/rpmuncompress -x /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-inspect + RPM_EC=0 ++ jobs -p + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.pWu29G + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + export POPCNT_CAPABILITY=0 + POPCNT_CAPABILITY=0 ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CFLAGS ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CXXFLAGS + /usr/bin/make -O -j2 V=1 VERBOSE=1 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt_build.cpp:8: In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ In file included from diff_sample.h:14, from blockwise_sa.h:17, from ebwt.h:25, from ebwt_build.cpp:10: multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt_build.cpp:8: In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ In file included from diff_sample.h:14, from blockwise_sa.h:17, from ebwt.h:25, from ebwt_build.cpp:10: multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop.isra’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop.isra’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘tokenize’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct ’ at ds.h:373:9, inlined from ‘__ct_base ’ at pat.h:321:3: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base ’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct_base ’ at pat.h:330:37: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base ’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘patsrcFromStrings’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base .constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘tokenize’ at tokenize.h:32:15: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘tokenize’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct ’ at ds.h:373:9, inlined from ‘__ct_base ’ at pat.h:321:3: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base ’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct_base ’ at pat.h:330:37: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base ’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘patsrcFromStrings’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base .constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:31, from ebwt_build.cpp:10: ref_read.h: In function ‘fastaRefReadAppend(FileBuf&, bool, S2bDnaString&, unsigned long&, RefReadInParams&, std::__cxx11::basic_string, std::allocator >*)RefRecord’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t[]’ [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ In file included from ebwt.h:21: alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ ref_read.h: In function ‘fastaRefReadAppend >(FileBuf&, bool, SString&, unsigned long&, RefReadInParams&, std::__cxx11::basic_string, std::allocator >*)RefRecord’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t[]’ [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:521:22: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread In file included from ebwt.h:31, from ebwt_build.cpp:10: ref_read.h: In function ‘fastaRefReadAppend(FileBuf&, bool, S2bDnaString&, unsigned int&, RefReadInParams&, std::__cxx11::basic_string, std::allocator >*)RefRecord’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t[]’ [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ In file included from ebwt.h:21: alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ ref_read.h: In function ‘fastaRefReadAppend >(FileBuf&, bool, SString&, unsigned int&, RefReadInParams&, std::__cxx11::basic_string, std::allocator >*)RefRecord’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t[]’ [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘patsrcFromStrings’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base .constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In function ‘patsrcFromStrings’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/15/new: In member function ‘__ct_base .constprop’: /usr/include/c++/15/new:140:26: note: in a call to allocation function ‘operator new []’ declared here 140 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2024-07-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here + RPM_EC=0 ++ jobs -p + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.0iggTx + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + '[' /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT '!=' / ']' + rm -rf /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT ++ dirname /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT + mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build + mkdir /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/bin ; \ done + mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie + cp -a reads /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + /usr/bin/find-debuginfo -j2 --strict-build-id -m -i --build-id-seed 1.3.1-5.fc42 --unique-debug-suffix -1.3.1-5.fc42.ppc64le --unique-debug-src-base bowtie-1.3.1-5.fc42.ppc64le --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 50000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src find-debuginfo: starting Extracting debug info from 12 files DWARF-compressing 12 files sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. Creating .debug symlinks for symlinks to ELF files Copying sources found by 'debugedit -l' to /usr/src/debug/bowtie-1.3.1-5.fc42.ppc64le find-debuginfo: done + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig + /usr/lib/rpm/brp-compress + /usr/lib/rpm/redhat/brp-strip-lto /usr/bin/strip + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/check-rpaths + /usr/lib/rpm/redhat/brp-mangle-shebangs mangling shebang in /usr/share/bowtie/scripts/make_rn4.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_e_coli.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi36.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_galGal3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_d_melanogaster.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_s_cerevisiae.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_b_taurus_UMD3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_m_musculus_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_a_thaliana_tair.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_canFam2.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/bowtie-hbb.sh from /bin/bash to #!/usr/bin/bash mangling shebang in /usr/share/bowtie/scripts/make_c_elegans.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm9.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg18.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/build_test.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/run-hbb.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg19.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm8.sh from /bin/sh to #!/usr/bin/sh + /usr/lib/rpm/brp-remove-la-files + env /usr/lib/rpm/redhat/brp-python-bytecompile '' 1 0 -j2 + /usr/lib/rpm/redhat/brp-python-hardlink + /usr/bin/add-determinism --brp -j2 /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT Scanned 17 directories and 167 files, processed 0 inodes, 0 modified (0 replaced + 0 rewritten), 0 unsupported format, 0 errors Reading /builddir/build/BUILD/bowtie-1.3.1-build/SPECPARTS/rpm-debuginfo.specpart Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.HzMjaC + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl scripts/test/cs_dec.pl scripts/test/random_bowtie_tests.sh scripts/test/btface.py scripts/test/long_read.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/random_bowtie_tests.pl scripts/test/args.pl scripts/test/DNA.pm scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/cs_trim.pl scripts/test/btdata.py scripts/test/build_big.py scripts/test/large_idx.py scripts/test/all.sh + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: @SQ SN:0 LN:25 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1@SQ SN:0 LN:19 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1@SQ SN:0 LN:25 (100.00@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq 0.00%) # reads that failed to align: 0 (0.00%) No alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00@SQ SN:0 LN:16 %) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (@SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 0@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 0@SQ SN:0 LN:19 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1@SQ SN:0 LN:25 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: @SQ SN:0 LN:8 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments PASSED + RPM_EC=0 ++ jobs -p + exit 0 Processing files: bowtie-1.3.1-5.fc42.ppc64le Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.CSgTx6 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + export LC_ALL=C.UTF-8 + LC_ALL=C.UTF-8 + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/MANUAL /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/NEWS /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/VERSION /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/AUTHORS /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/TUTORIAL /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/doc/manual.html /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/doc/style.css /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.L3tcd5 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + export LC_ALL=C.UTF-8 + LC_ALL=C.UTF-8 + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/LICENSE /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Provides: bowtie = 1.3.1-5.fc42 bowtie(ppc-64) = 1.3.1-5.fc42 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /usr/bin/bash /usr/bin/perl /usr/bin/python3 /usr/bin/sh libc.so.6()(64bit) libc.so.6(GLIBC_2.17)(64bit) libc.so.6(GLIBC_2.32)(64bit) libc.so.6(GLIBC_2.33)(64bit) libc.so.6(GLIBC_2.34)(64bit) libc.so.6(GLIBC_2.38)(64bit) libc.so.6(GLIBC_ABI_DT_RELR)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.3.1)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.17)(64bit) libm.so.6(GLIBC_2.27)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.15)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.26)(64bit) libstdc++.so.6(GLIBCXX_3.4.30)(64bit) libstdc++.so.6(GLIBCXX_3.4.32)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-5.fc42.ppc64le Provides: bowtie-debugsource = 1.3.1-5.fc42 bowtie-debugsource(ppc-64) = 1.3.1-5.fc42 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-5.fc42.ppc64le Provides: bowtie-debuginfo = 1.3.1-5.fc42 bowtie-debuginfo(ppc-64) = 1.3.1-5.fc42 debuginfo(build-id) = 4586985463f6862b36d25429922476c788af2243 debuginfo(build-id) = 5dae70d6764c383e01e249f4e5b0157d92cef3f4 debuginfo(build-id) = 622beab233c1aae4075339f5474087853a96129d debuginfo(build-id) = 6d4c1ec60e571a7edb286b2b8c18774a8a3ee219 debuginfo(build-id) = 7a2c6df04abdcf0eb2c6162d78b925ad59d7140c debuginfo(build-id) = 7e63571f86793fdadb13c4dbd2b8ac7c276315f8 debuginfo(build-id) = 94166ebd996390e04a7096e34fd33551fc91d9cd debuginfo(build-id) = 98f81edc6a3085e6148b2b12b8918b32fe0c8a3b debuginfo(build-id) = e0e4a2fdb3bb779f2db47f2d0b13dcc2b0374e28 debuginfo(build-id) = e3f605db48ada690026659fbe3bcc2f35cacdd28 debuginfo(build-id) = ecc2ace3e91c742b0f06d23cd69e68bc794314e7 debuginfo(build-id) = fb5c58c8d1dc3d6010aefce34dee3a08b618a8bf Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(ppc-64) = 1.3.1-5.fc42 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT Wrote: /builddir/build/RPMS/bowtie-1.3.1-5.fc42.ppc64le.rpm Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-5.fc42.ppc64le.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-5.fc42.ppc64le.rpm Executing(rmbuild): /bin/sh -e /var/tmp/rpm-tmp.hpIEHv + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + test -d /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w /builddir/build/BUILD/bowtie-1.3.1-build + rm -rf /builddir/build/BUILD/bowtie-1.3.1-build + RPM_EC=0 ++ jobs -p + exit 0 Finish: rpmbuild bowtie-1.3.1-5.fc42.src.rpm Finish: build phase for bowtie-1.3.1-5.fc42.src.rpm INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-ppc64le-1734563230.610119/root/var/log/dnf5.log INFO: chroot_scan: creating tarball /var/lib/copr-rpmbuild/results/chroot_scan.tar.gz /bin/tar: Removing leading `/' from member names INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-5.fc42.src.rpm) Config(child) 6 minutes 45 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool Package info: { "packages": [ { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "5.fc42", "arch": "src" }, { "name": "bowtie-debuginfo", "epoch": null, "version": "1.3.1", "release": "5.fc42", "arch": "ppc64le" }, { "name": "bowtie-debugsource", "epoch": null, "version": "1.3.1", "release": "5.fc42", "arch": "ppc64le" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "5.fc42", "arch": "ppc64le" } ] } RPMResults finished