read.phylip {phylotools} | R Documentation |
read the phylip file, and store the sequences and their names in data frame.
read.phylip(infile, clean_name = TRUE)
infile |
character string for the name of the phylip file. |
clean_name |
logical, representing cleaning of the names will be performed. |
read.phylip accepts both interleaved and sequential phylip, the number of sequences is identified by parsing the first line of the file. Sequences and their names will be stored in a data frame.
If clean_name is TRUE, punctuation characters and white space be replaced by "_". Definition of punctuation characters can be found at regex
.
a data frame with two columns: (1) seq.name, the names for all the sequences; (2) seq.text, the raw sequence data.
the Punctuation characters and white space in the names of the sequences will be replaced by "_".
Jinlong Zhang <jinlongzhang01@gmail.com>
cat("6 22",
"seq_1 --TTACAAATTGACTTATTATA",
"seq_2 GATTACAAATTGACTTATTATA",
"seq_3 GATTACAAATTGACTTATTATA",
"seq_5 GATTACAAATTGACTTATTATA",
"seq_8 GATTACAAATTGACTTATTATA",
"seq_10 ---TACAAATTGAATTATTATA",
file = "matk.phy", sep = "\n")
res <- read.phylip(infile = "matk.phy")
unlink("matk.phy")