Warning: Permanently added '2620:52:3:1:dead:beef:cafe:c154' (ED25519) to the list of known hosts. You can reproduce this build on your computer by running: sudo dnf install copr-rpmbuild /usr/bin/copr-rpmbuild --verbose --drop-resultdir --task-url https://copr.fedorainfracloud.org/backend/get-build-task/6118040-fedora-rawhide-x86_64 --chroot fedora-rawhide-x86_64 Version: 0.68 PID: 5610 Logging PID: 5611 Task: {'appstream': False, 'background': True, 'build_id': 6118040, 'buildroot_pkgs': [], 'chroot': 'fedora-rawhide-x86_64', 'enable_net': False, 'fedora_review': False, 'git_hash': '3cf78aa7d1cb5ea13198ebe52d96f91ad6737f06', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/jwakely/tbb-refresh/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-1', 'project_dirname': 'tbb-refresh', 'project_name': 'tbb-refresh', 'project_owner': 'jwakely', 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/jwakely/tbb-refresh/fedora-rawhide-x86_64/', 'id': 'copr_base', 'name': 'Copr repository'}], 'sandbox': 'jwakely/tbb-refresh--jwakely', 'source_json': {}, 'source_type': None, 'submitter': 'jwakely', 'tags': [], 'task_id': '6118040-fedora-rawhide-x86_64', 'timeout': 115200, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/jwakely/tbb-refresh/bowtie /var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/jwakely/tbb-refresh/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie'... Running: git checkout 3cf78aa7d1cb5ea13198ebe52d96f91ad6737f06 -- cmd: ['git', 'checkout', '3cf78aa7d1cb5ea13198ebe52d96f91ad6737f06', '--'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie rc: 0 stdout: stderr: Note: switching to '3cf78aa7d1cb5ea13198ebe52d96f91ad6737f06'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at 3cf78aa automatic import of bowtie Running: copr-distgit-client sources cmd: ['copr-distgit-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --remote-time --show-error --fail https://copr-dist-git.fedorainfracloud.org/repo/pkgs/jwakely/tbb-refresh/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 7293k 100 7293k 0 0 19.2M 0 --:--:-- --:--:-- --:--:-- 19.3M INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-tests.tgz --location --remote-time --show-error --fail https://copr-dist-git.fedorainfracloud.org/repo/pkgs/jwakely/tbb-refresh/bowtie/bowtie-1.3.1-tests.tgz/md5/efa4aeb774a0cd0255fe3f24caf64187/bowtie-1.3.1-tests.tgz % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed /usr/bin/tail: /var/lib/copr-rpmbuild/main.log: file truncated 100 34134 100 34134 0 0 541k 0 --:--:-- --:--:-- --:--:-- 546k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz Running (timeout=115200): unbuffer mock --buildsrpm --spec /var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1687861990.181316 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 4.1 starting (python version = 3.11.3, NVR = mock-4.1-1.fc38)... Start(bootstrap): init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish(bootstrap): init plugins Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie/bowtie.spec) Config(fedora-rawhide-x86_64) Start: clean chroot Finish: clean chroot Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1687861990.181316/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata INFO: enabled HW Info plugin Mock Version: 4.1 INFO: Mock Version: 4.1 INFO: Package manager dnf detected and used (fallback) Start(bootstrap): installing dnf tooling No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 85 kB/s | 14 kB 00:00 fedora 24 MB/s | 71 MB 00:03 Dependencies resolved. ================================================================================ Package Arch Version Repo Size ================================================================================ Installing: dnf-plugins-core noarch 4.4.1-3.fc39 fedora 38 k python3-dnf noarch 4.16.1-2.fc39 fedora 604 k Installing dependencies: alternatives x86_64 1.24-1.fc39 fedora 39 k audit-libs x86_64 3.1.1-1.fc39 fedora 117 k basesystem noarch 11-17.fc39 fedora 7.0 k bash x86_64 5.2.15-3.fc38 fedora 1.8 M bzip2-libs x86_64 1.0.8-13.fc38 fedora 41 k ca-certificates noarch 2023.2.60-2.fc38 fedora 845 k coreutils x86_64 9.3-1.fc39 fedora 1.1 M coreutils-common x86_64 9.3-1.fc39 fedora 2.1 M crypto-policies noarch 20230614-1.git5f3458e.fc39 fedora 94 k curl x86_64 8.1.2-1.fc39 fedora 345 k cyrus-sasl-lib x86_64 2.1.28-10.fc39 fedora 792 k dbus-libs x86_64 1:1.14.8-1.fc39 fedora 156 k dnf-data noarch 4.16.1-2.fc39 fedora 38 k elfutils-default-yama-scope noarch 0.189-2.fc39 fedora 15 k elfutils-libelf x86_64 0.189-2.fc39 fedora 196 k elfutils-libs x86_64 0.189-2.fc39 fedora 260 k expat x86_64 2.5.0-2.fc38 fedora 110 k fedora-gpg-keys noarch 39-0.1 fedora 126 k fedora-release noarch 39-0.14 fedora 6.6 k fedora-release-common noarch 39-0.14 fedora 17 k fedora-release-identity-basic noarch 39-0.14 fedora 7.4 k fedora-repos noarch 39-0.1 fedora 9.4 k fedora-repos-rawhide noarch 39-0.1 fedora 9.0 k file-libs x86_64 5.44-3.fc39 fedora 730 k filesystem x86_64 3.18-4.fc39 fedora 1.1 M findutils x86_64 1:4.9.0-4.fc39 fedora 491 k fmt x86_64 9.1.0-2.fc38 fedora 117 k gawk x86_64 5.2.2-1.fc39 fedora 1.1 M gdbm-libs x86_64 1:1.23-3.fc38 fedora 56 k glib2 x86_64 2.76.3-1.fc39 fedora 2.8 M glibc x86_64 2.37.9000-14.fc39 fedora 2.2 M glibc-common x86_64 2.37.9000-14.fc39 fedora 339 k glibc-minimal-langpack x86_64 2.37.9000-14.fc39 fedora 59 k gmp x86_64 1:6.2.1-4.fc38 fedora 313 k gnupg2 x86_64 2.4.2-2.fc39 fedora 2.6 M gnutls x86_64 3.8.0-6.fc39 fedora 1.1 M gpgme x86_64 1.17.1-5.fc39 fedora 206 k grep x86_64 3.11-1.fc39 fedora 298 k ima-evm-utils x86_64 1.5-1.fc39 fedora 63 k json-c x86_64 0.16-4.fc38 fedora 41 k keyutils-libs x86_64 1.6.1-6.fc38 fedora 31 k krb5-libs x86_64 1.21-1.fc39 fedora 765 k libacl x86_64 2.3.1-7.fc39 fedora 23 k libarchive x86_64 3.6.1-5.fc39 fedora 400 k libassuan x86_64 2.5.6-1.fc39 fedora 67 k libattr x86_64 2.5.1-7.fc39 fedora 18 k libb2 x86_64 0.98.1-8.fc38 fedora 25 k libblkid x86_64 2.39-4.fc39 fedora 116 k libbrotli x86_64 1.0.9-11.fc38 fedora 317 k libcap x86_64 2.48-6.fc38 fedora 67 k libcap-ng x86_64 0.8.3-5.fc38 fedora 32 k libcom_err x86_64 1.47.0-1.fc39 fedora 26 k libcomps x86_64 0.1.19-1.fc39 fedora 77 k libcurl x86_64 8.1.2-1.fc39 fedora 323 k libdnf x86_64 0.70.1-3.fc39 fedora 667 k libdnf5 x86_64 5.0.14-1.fc39 fedora 866 k libeconf x86_64 0.4.0-5.fc38 fedora 27 k libevent x86_64 2.1.12-8.fc38 fedora 257 k libffi x86_64 3.4.4-2.fc38 fedora 38 k libfsverity x86_64 1.4-9.fc38 fedora 19 k libgcc x86_64 13.1.1-4.fc39 fedora 107 k libgcrypt x86_64 1.10.2-1.fc39 fedora 514 k libgomp x86_64 13.1.1-4.fc39 fedora 317 k libgpg-error x86_64 1.47-1.fc39 fedora 230 k libidn2 x86_64 2.3.4-2.fc38 fedora 160 k libksba x86_64 1.6.4-1.fc39 fedora 159 k libmodulemd x86_64 2.15.0-3.fc39 fedora 232 k libmount x86_64 2.39-4.fc39 fedora 155 k libnghttp2 x86_64 1.54.0-1.fc39 fedora 75 k libnsl2 x86_64 2.0.0-5.fc38 fedora 30 k libpsl x86_64 0.21.2-3.fc39 fedora 63 k librepo x86_64 1.15.1-2.fc38 fedora 96 k libreport-filesystem noarch 2.17.10-1.fc39 fedora 14 k libselinux x86_64 3.5-1.fc39 fedora 87 k libsemanage x86_64 3.5-2.fc39 fedora 120 k libsepol x86_64 3.5-1.fc39 fedora 324 k libsigsegv x86_64 2.14-4.fc38 fedora 27 k libsmartcols x86_64 2.39-4.fc39 fedora 67 k libsolv x86_64 0.7.24-4.fc39 fedora 425 k libssh x86_64 0.10.5-1.fc39 fedora 211 k libssh-config noarch 0.10.5-1.fc39 fedora 9.0 k libstdc++ x86_64 13.1.1-4.fc39 fedora 861 k libtasn1 x86_64 4.19.0-2.fc38 fedora 74 k libtirpc x86_64 1.3.3-1.rc1.fc39 fedora 93 k libunistring x86_64 1.1-3.fc38 fedora 545 k libunistring1.0 x86_64 1.0-1.fc38 fedora 539 k libuuid x86_64 2.39-4.fc39 fedora 28 k libverto x86_64 0.3.2-5.fc38 fedora 21 k libxcrypt x86_64 4.4.35-1.fc39 fedora 119 k libxml2 x86_64 2.10.4-1.fc39 fedora 700 k libyaml x86_64 0.2.5-9.fc38 fedora 59 k libzstd x86_64 1.5.5-1.fc39 fedora 308 k lua-libs x86_64 5.4.4-9.fc39 fedora 133 k lz4-libs x86_64 1.9.4-3.fc39 fedora 67 k mpdecimal x86_64 2.5.1-6.fc38 fedora 89 k mpfr x86_64 4.1.1-3.fc38 fedora 600 k ncurses-base noarch 6.4-4.20230520.fc39 fedora 86 k ncurses-libs x86_64 6.4-4.20230520.fc39 fedora 336 k nettle x86_64 3.9.1-1.fc39 fedora 425 k npth x86_64 1.6-13.fc39 fedora 24 k openldap x86_64 2.6.4-2.fc39 fedora 255 k openssl-libs x86_64 1:3.0.8-2.fc39 fedora 2.1 M p11-kit x86_64 0.24.1-6.fc38 fedora 359 k p11-kit-trust x86_64 0.24.1-6.fc38 fedora 136 k pcre2 x86_64 10.42-1.fc38.1 fedora 234 k pcre2-syntax noarch 10.42-1.fc38.1 fedora 144 k popt x86_64 1.19-2.fc38 fedora 67 k publicsuffix-list-dafsa noarch 20230614-1.fc39 fedora 57 k python-pip-wheel noarch 23.1.2-1.fc39 fedora 1.4 M python-setuptools-wheel noarch 67.7.2-2.fc39 fedora 661 k python3 x86_64 3.11.4-1.fc39 fedora 28 k python3-dateutil noarch 1:2.8.2-6.fc39 fedora 360 k python3-dbus x86_64 1.3.2-2.fc38 fedora 157 k python3-distro noarch 1.8.0-4.fc39 fedora 49 k python3-dnf-plugins-core noarch 4.4.1-3.fc39 fedora 299 k python3-gpg x86_64 1.17.1-5.fc39 fedora 295 k python3-hawkey x86_64 0.70.1-3.fc39 fedora 107 k python3-libcomps x86_64 0.1.19-1.fc39 fedora 47 k python3-libdnf x86_64 0.70.1-3.fc39 fedora 826 k python3-libs x86_64 3.11.4-1.fc39 fedora 9.6 M python3-rpm x86_64 4.18.91-1.fc39 fedora 67 k python3-six noarch 1.16.0-9.fc38 fedora 42 k python3-systemd x86_64 235-2.fc38 fedora 108 k readline x86_64 8.2-3.fc38 fedora 212 k rpm x86_64 4.18.91-1.fc39 fedora 528 k rpm-build-libs x86_64 4.18.91-1.fc39 fedora 95 k rpm-libs x86_64 4.18.91-1.fc39 fedora 308 k rpm-sequoia x86_64 1.4.0-3.fc39 fedora 848 k rpm-sign-libs x86_64 4.18.91-1.fc39 fedora 26 k sed x86_64 4.8-12.fc38 fedora 306 k setup noarch 2.14.3-3.fc39 fedora 152 k shadow-utils x86_64 2:4.13-7.fc39 fedora 1.3 M sqlite-libs x86_64 3.41.2-3.fc39 fedora 669 k systemd-libs x86_64 253.5-6.fc39 fedora 652 k tpm2-tss x86_64 4.0.1-3.fc38 fedora 675 k tzdata noarch 2023c-1.fc39 fedora 718 k xz-libs x86_64 5.4.3-1.fc39 fedora 108 k zchunk-libs x86_64 1.3.1-1.fc39 fedora 52 k zlib x86_64 1.2.13-3.fc38 fedora 95 k Transaction Summary ================================================================================ Install 141 Packages Total download size: 59 M Installed size: 205 M Downloading Packages: (1/141): basesystem-11-17.fc39.noarch.rpm 172 kB/s | 7.0 kB 00:00 (2/141): alternatives-1.24-1.fc39.x86_64.rpm 509 kB/s | 39 kB 00:00 (3/141): audit-libs-3.1.1-1.fc39.x86_64.rpm 656 kB/s | 117 kB 00:00 (4/141): bash-5.2.15-3.fc38.x86_64.rpm 5.9 MB/s | 1.8 MB 00:00 (5/141): ca-certificates-2023.2.60-2.fc38.noarc 3.1 MB/s | 845 kB 00:00 (6/141): coreutils-9.3-1.fc39.x86_64.rpm 9.4 MB/s | 1.1 MB 00:00 (7/141): crypto-policies-20230614-1.git5f3458e. 5.2 MB/s | 94 kB 00:00 (8/141): curl-8.1.2-1.fc39.x86_64.rpm 14 MB/s | 345 kB 00:00 (9/141): cyrus-sasl-lib-2.1.28-10.fc39.x86_64.r 13 MB/s | 792 kB 00:00 (10/141): dbus-libs-1.14.8-1.fc39.x86_64.rpm 6.5 MB/s | 156 kB 00:00 (11/141): dnf-data-4.16.1-2.fc39.noarch.rpm 1.9 MB/s | 38 kB 00:00 (12/141): dnf-plugins-core-4.4.1-3.fc39.noarch. 2.1 MB/s | 38 kB 00:00 (13/141): elfutils-default-yama-scope-0.189-2.f 917 kB/s | 15 kB 00:00 (14/141): coreutils-common-9.3-1.fc39.x86_64.rp 9.5 MB/s | 2.1 MB 00:00 (15/141): elfutils-libelf-0.189-2.fc39.x86_64.r 8.1 MB/s | 196 kB 00:00 (16/141): expat-2.5.0-2.fc38.x86_64.rpm 5.7 MB/s | 110 kB 00:00 (17/141): fedora-gpg-keys-39-0.1.noarch.rpm 5.9 MB/s | 126 kB 00:00 (18/141): fedora-release-39-0.14.noarch.rpm 322 kB/s | 6.6 kB 00:00 (19/141): elfutils-libs-0.189-2.fc39.x86_64.rpm 4.0 MB/s | 260 kB 00:00 (20/141): fedora-release-common-39-0.14.noarch. 1.0 MB/s | 17 kB 00:00 (21/141): fedora-release-identity-basic-39-0.14 454 kB/s | 7.4 kB 00:00 (22/141): fedora-repos-39-0.1.noarch.rpm 560 kB/s | 9.4 kB 00:00 (23/141): fedora-repos-rawhide-39-0.1.noarch.rp 547 kB/s | 9.0 kB 00:00 (24/141): file-libs-5.44-3.fc39.x86_64.rpm 21 MB/s | 730 kB 00:00 (25/141): findutils-4.9.0-4.fc39.x86_64.rpm 12 MB/s | 491 kB 00:00 (26/141): bzip2-libs-1.0.8-13.fc38.x86_64.rpm 52 kB/s | 41 kB 00:00 (27/141): fmt-9.1.0-2.fc38.x86_64.rpm 3.1 MB/s | 117 kB 00:00 (28/141): filesystem-3.18-4.fc39.x86_64.rpm 9.2 MB/s | 1.1 MB 00:00 (29/141): gdbm-libs-1.23-3.fc38.x86_64.rpm 680 kB/s | 56 kB 00:00 (30/141): gawk-5.2.2-1.fc39.x86_64.rpm 3.9 MB/s | 1.1 MB 00:00 (31/141): glib2-2.76.3-1.fc39.x86_64.rpm 10 MB/s | 2.8 MB 00:00 (32/141): glibc-minimal-langpack-2.37.9000-14.f 3.0 MB/s | 59 kB 00:00 (33/141): glibc-common-2.37.9000-14.fc39.x86_64 8.0 MB/s | 339 kB 00:00 (34/141): gmp-6.2.1-4.fc38.x86_64.rpm 7.5 MB/s | 313 kB 00:00 (35/141): gnupg2-2.4.2-2.fc39.x86_64.rpm 17 MB/s | 2.6 MB 00:00 (36/141): gnutls-3.8.0-6.fc39.x86_64.rpm 8.6 MB/s | 1.1 MB 00:00 (37/141): gpgme-1.17.1-5.fc39.x86_64.rpm 10 MB/s | 206 kB 00:00 (38/141): ima-evm-utils-1.5-1.fc39.x86_64.rpm 3.4 MB/s | 63 kB 00:00 (39/141): grep-3.11-1.fc39.x86_64.rpm 7.7 MB/s | 298 kB 00:00 (40/141): json-c-0.16-4.fc38.x86_64.rpm 2.4 MB/s | 41 kB 00:00 (41/141): keyutils-libs-1.6.1-6.fc38.x86_64.rpm 1.6 MB/s | 31 kB 00:00 (42/141): libacl-2.3.1-7.fc39.x86_64.rpm 1.0 MB/s | 23 kB 00:00 (43/141): krb5-libs-1.21-1.fc39.x86_64.rpm 24 MB/s | 765 kB 00:00 (44/141): libassuan-2.5.6-1.fc39.x86_64.rpm 3.0 MB/s | 67 kB 00:00 (45/141): libattr-2.5.1-7.fc39.x86_64.rpm 889 kB/s | 18 kB 00:00 (46/141): libarchive-3.6.1-5.fc39.x86_64.rpm 8.0 MB/s | 400 kB 00:00 (47/141): libblkid-2.39-4.fc39.x86_64.rpm 4.8 MB/s | 116 kB 00:00 (48/141): libb2-0.98.1-8.fc38.x86_64.rpm 718 kB/s | 25 kB 00:00 (49/141): libcap-2.48-6.fc38.x86_64.rpm 3.8 MB/s | 67 kB 00:00 (50/141): libcap-ng-0.8.3-5.fc38.x86_64.rpm 1.9 MB/s | 32 kB 00:00 (51/141): libbrotli-1.0.9-11.fc38.x86_64.rpm 6.0 MB/s | 317 kB 00:00 (52/141): libcom_err-1.47.0-1.fc39.x86_64.rpm 1.6 MB/s | 26 kB 00:00 (53/141): libcomps-0.1.19-1.fc39.x86_64.rpm 3.5 MB/s | 77 kB 00:00 (54/141): libcurl-8.1.2-1.fc39.x86_64.rpm 15 MB/s | 323 kB 00:00 (55/141): libdnf5-5.0.14-1.fc39.x86_64.rpm 28 MB/s | 866 kB 00:00 (56/141): libeconf-0.4.0-5.fc38.x86_64.rpm 1.6 MB/s | 27 kB 00:00 (57/141): libevent-2.1.12-8.fc38.x86_64.rpm 11 MB/s | 257 kB 00:00 (58/141): libffi-3.4.4-2.fc38.x86_64.rpm 1.5 MB/s | 38 kB 00:00 (59/141): libdnf-0.70.1-3.fc39.x86_64.rpm 5.8 MB/s | 667 kB 00:00 (60/141): libfsverity-1.4-9.fc38.x86_64.rpm 908 kB/s | 19 kB 00:00 (61/141): libgcc-13.1.1-4.fc39.x86_64.rpm 4.1 MB/s | 107 kB 00:00 (62/141): libgcrypt-1.10.2-1.fc39.x86_64.rpm 22 MB/s | 514 kB 00:00 (63/141): libgpg-error-1.47-1.fc39.x86_64.rpm 12 MB/s | 230 kB 00:00 (64/141): libgomp-13.1.1-4.fc39.x86_64.rpm 7.8 MB/s | 317 kB 00:00 (65/141): libidn2-2.3.4-2.fc38.x86_64.rpm 8.8 MB/s | 160 kB 00:00 (66/141): libksba-1.6.4-1.fc39.x86_64.rpm 5.9 MB/s | 159 kB 00:00 (67/141): libmodulemd-2.15.0-3.fc39.x86_64.rpm 12 MB/s | 232 kB 00:00 (68/141): libnghttp2-1.54.0-1.fc39.x86_64.rpm 4.4 MB/s | 75 kB 00:00 (69/141): libmount-2.39-4.fc39.x86_64.rpm 5.7 MB/s | 155 kB 00:00 (70/141): libpsl-0.21.2-3.fc39.x86_64.rpm 881 kB/s | 63 kB 00:00 (71/141): librepo-1.15.1-2.fc38.x86_64.rpm 4.2 MB/s | 96 kB 00:00 (72/141): libnsl2-2.0.0-5.fc38.x86_64.rpm 291 kB/s | 30 kB 00:00 (73/141): libreport-filesystem-2.17.10-1.fc39.n 861 kB/s | 14 kB 00:00 (74/141): libselinux-3.5-1.fc39.x86_64.rpm 5.0 MB/s | 87 kB 00:00 (75/141): libsepol-3.5-1.fc39.x86_64.rpm 15 MB/s | 324 kB 00:00 (76/141): libsemanage-3.5-2.fc39.x86_64.rpm 4.5 MB/s | 120 kB 00:00 (77/141): libsmartcols-2.39-4.fc39.x86_64.rpm 2.7 MB/s | 67 kB 00:00 (78/141): libsigsegv-2.14-4.fc38.x86_64.rpm 692 kB/s | 27 kB 00:00 (79/141): libssh-0.10.5-1.fc39.x86_64.rpm 11 MB/s | 211 kB 00:00 (80/141): libsolv-0.7.24-4.fc39.x86_64.rpm 9.4 MB/s | 425 kB 00:00 (81/141): libssh-config-0.10.5-1.fc39.noarch.rp 565 kB/s | 9.0 kB 00:00 (82/141): libtasn1-4.19.0-2.fc38.x86_64.rpm 3.8 MB/s | 74 kB 00:00 (83/141): libtirpc-1.3.3-1.rc1.fc39.x86_64.rpm 4.4 MB/s | 93 kB 00:00 (84/141): libunistring-1.1-3.fc38.x86_64.rpm 22 MB/s | 545 kB 00:00 (85/141): libstdc++-13.1.1-4.fc39.x86_64.rpm 10 MB/s | 861 kB 00:00 (86/141): libunistring1.0-1.0-1.fc38.x86_64.rpm 18 MB/s | 539 kB 00:00 (87/141): libuuid-2.39-4.fc39.x86_64.rpm 1.5 MB/s | 28 kB 00:00 (88/141): libverto-0.3.2-5.fc38.x86_64.rpm 909 kB/s | 21 kB 00:00 (89/141): libxcrypt-4.4.35-1.fc39.x86_64.rpm 4.7 MB/s | 119 kB 00:00 (90/141): libyaml-0.2.5-9.fc38.x86_64.rpm 2.1 MB/s | 59 kB 00:00 (91/141): libxml2-2.10.4-1.fc39.x86_64.rpm 14 MB/s | 700 kB 00:00 (92/141): libzstd-1.5.5-1.fc39.x86_64.rpm 8.5 MB/s | 308 kB 00:00 (93/141): lua-libs-5.4.4-9.fc39.x86_64.rpm 7.2 MB/s | 133 kB 00:00 (94/141): lz4-libs-1.9.4-3.fc39.x86_64.rpm 3.9 MB/s | 67 kB 00:00 (95/141): mpdecimal-2.5.1-6.fc38.x86_64.rpm 3.5 MB/s | 89 kB 00:00 (96/141): mpfr-4.1.1-3.fc38.x86_64.rpm 25 MB/s | 600 kB 00:00 (97/141): ncurses-base-6.4-4.20230520.fc39.noar 4.3 MB/s | 86 kB 00:00 (98/141): ncurses-libs-6.4-4.20230520.fc39.x86_ 15 MB/s | 336 kB 00:00 (99/141): glibc-2.37.9000-14.fc39.x86_64.rpm 1.7 MB/s | 2.2 MB 00:01 (100/141): npth-1.6-13.fc39.x86_64.rpm 1.4 MB/s | 24 kB 00:00 (101/141): nettle-3.9.1-1.fc39.x86_64.rpm 11 MB/s | 425 kB 00:00 (102/141): openssl-libs-3.0.8-2.fc39.x86_64.rpm 44 MB/s | 2.1 MB 00:00 (103/141): p11-kit-0.24.1-6.fc38.x86_64.rpm 7.8 MB/s | 359 kB 00:00 (104/141): openldap-2.6.4-2.fc39.x86_64.rpm 3.9 MB/s | 255 kB 00:00 (105/141): p11-kit-trust-0.24.1-6.fc38.x86_64.r 7.5 MB/s | 136 kB 00:00 (106/141): pcre2-10.42-1.fc38.1.x86_64.rpm 7.4 MB/s | 234 kB 00:00 (107/141): popt-1.19-2.fc38.x86_64.rpm 3.9 MB/s | 67 kB 00:00 (108/141): pcre2-syntax-10.42-1.fc38.1.noarch.r 3.7 MB/s | 144 kB 00:00 (109/141): publicsuffix-list-dafsa-20230614-1.f 3.0 MB/s | 57 kB 00:00 (110/141): python-pip-wheel-23.1.2-1.fc39.noarc 39 MB/s | 1.4 MB 00:00 (111/141): python3-3.11.4-1.fc39.x86_64.rpm 1.3 MB/s | 28 kB 00:00 (112/141): python3-dateutil-2.8.2-6.fc39.noarch 13 MB/s | 360 kB 00:00 (113/141): python3-dbus-1.3.2-2.fc38.x86_64.rpm 4.9 MB/s | 157 kB 00:00 (114/141): python3-distro-1.8.0-4.fc39.noarch.r 2.9 MB/s | 49 kB 00:00 (115/141): python3-dnf-plugins-core-4.4.1-3.fc3 15 MB/s | 299 kB 00:00 (116/141): python3-dnf-4.16.1-2.fc39.noarch.rpm 11 MB/s | 604 kB 00:00 (117/141): python3-gpg-1.17.1-5.fc39.x86_64.rpm 13 MB/s | 295 kB 00:00 (118/141): python-setuptools-wheel-67.7.2-2.fc3 5.2 MB/s | 661 kB 00:00 (119/141): python3-libcomps-0.1.19-1.fc39.x86_6 2.0 MB/s | 47 kB 00:00 (120/141): python3-hawkey-0.70.1-3.fc39.x86_64. 3.7 MB/s | 107 kB 00:00 (121/141): python3-rpm-4.18.91-1.fc39.x86_64.rp 820 kB/s | 67 kB 00:00 (122/141): python3-libdnf-0.70.1-3.fc39.x86_64. 3.5 MB/s | 826 kB 00:00 (123/141): python3-six-1.16.0-9.fc38.noarch.rpm 317 kB/s | 42 kB 00:00 (124/141): python3-systemd-235-2.fc38.x86_64.rp 1.5 MB/s | 108 kB 00:00 (125/141): python3-libs-3.11.4-1.fc39.x86_64.rp 32 MB/s | 9.6 MB 00:00 (126/141): readline-8.2-3.fc38.x86_64.rpm 2.1 MB/s | 212 kB 00:00 (127/141): rpm-build-libs-4.18.91-1.fc39.x86_64 3.4 MB/s | 95 kB 00:00 (128/141): rpm-libs-4.18.91-1.fc39.x86_64.rpm 5.2 MB/s | 308 kB 00:00 (129/141): rpm-sequoia-1.4.0-3.fc39.x86_64.rpm 14 MB/s | 848 kB 00:00 (130/141): rpm-4.18.91-1.fc39.x86_64.rpm 4.7 MB/s | 528 kB 00:00 (131/141): rpm-sign-libs-4.18.91-1.fc39.x86_64. 731 kB/s | 26 kB 00:00 (132/141): sed-4.8-12.fc38.x86_64.rpm 5.0 MB/s | 306 kB 00:00 (133/141): sqlite-libs-3.41.2-3.fc39.x86_64.rpm 18 MB/s | 669 kB 00:00 (134/141): setup-2.14.3-3.fc39.noarch.rpm 1.7 MB/s | 152 kB 00:00 (135/141): systemd-libs-253.5-6.fc39.x86_64.rpm 21 MB/s | 652 kB 00:00 (136/141): tzdata-2023c-1.fc39.noarch.rpm 16 MB/s | 718 kB 00:00 (137/141): tpm2-tss-4.0.1-3.fc38.x86_64.rpm 5.1 MB/s | 675 kB 00:00 (138/141): zchunk-libs-1.3.1-1.fc39.x86_64.rpm 2.2 MB/s | 52 kB 00:00 (139/141): zlib-1.2.13-3.fc38.x86_64.rpm 2.9 MB/s | 95 kB 00:00 (140/141): shadow-utils-4.13-7.fc39.x86_64.rpm 4.2 MB/s | 1.3 MB 00:00 (141/141): xz-libs-5.4.3-1.fc39.x86_64.rpm 388 kB/s | 108 kB 00:00 -------------------------------------------------------------------------------- Total 17 MB/s | 59 MB 00:03 fedora 1.6 MB/s | 1.6 kB 00:00 Importing GPG key 0x18B8E74C: Userid : "Fedora (39) " Fingerprint: E8F2 3996 F232 1864 0CB4 4CBE 75CF 5AC4 18B8 E74C From : /usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-39-primary Key imported successfully fedora 1.6 MB/s | 1.6 kB 00:00 GPG key at file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-39-primary (0x18B8E74C) is already installed fedora 1.6 MB/s | 1.6 kB 00:00 Importing GPG key 0xEB10B464: Userid : "Fedora (38) " Fingerprint: 6A51 BBAB BA3D 5467 B617 1221 809A 8D7C EB10 B464 From : /usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-38-primary Key imported successfully Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Running scriptlet: filesystem-3.18-4.fc39.x86_64 1/1 Preparing : 1/1 Installing : libgcc-13.1.1-4.fc39.x86_64 1/141 Running scriptlet: libgcc-13.1.1-4.fc39.x86_64 1/141 Installing : tzdata-2023c-1.fc39.noarch 2/141 Installing : crypto-policies-20230614-1.git5f3458e.fc39.noarc 3/141 Running scriptlet: crypto-policies-20230614-1.git5f3458e.fc39.noarc 3/141 Installing : fedora-release-identity-basic-39-0.14.noarch 4/141 Installing : python-setuptools-wheel-67.7.2-2.fc39.noarch 5/141 Installing : publicsuffix-list-dafsa-20230614-1.fc39.noarch 6/141 Installing : pcre2-syntax-10.42-1.fc38.1.noarch 7/141 Installing : ncurses-base-6.4-4.20230520.fc39.noarch 8/141 Installing : libssh-config-0.10.5-1.fc39.noarch 9/141 Installing : libreport-filesystem-2.17.10-1.fc39.noarch 10/141 Installing : fedora-gpg-keys-39-0.1.noarch 11/141 Installing : fedora-release-39-0.14.noarch 12/141 Installing : fedora-release-common-39-0.14.noarch 13/141 Installing : fedora-repos-rawhide-39-0.1.noarch 14/141 Installing : fedora-repos-39-0.1.noarch 15/141 Installing : setup-2.14.3-3.fc39.noarch 16/141 Running scriptlet: setup-2.14.3-3.fc39.noarch 16/141 Installing : filesystem-3.18-4.fc39.x86_64 17/141 Installing : basesystem-11-17.fc39.noarch 18/141 Installing : glibc-minimal-langpack-2.37.9000-14.fc39.x86_64 19/141 Installing : glibc-common-2.37.9000-14.fc39.x86_64 20/141 Running scriptlet: glibc-2.37.9000-14.fc39.x86_64 21/141 Installing : glibc-2.37.9000-14.fc39.x86_64 21/141 Running scriptlet: glibc-2.37.9000-14.fc39.x86_64 21/141 Installing : ncurses-libs-6.4-4.20230520.fc39.x86_64 22/141 Installing : bash-5.2.15-3.fc38.x86_64 23/141 Running scriptlet: bash-5.2.15-3.fc38.x86_64 23/141 Installing : zlib-1.2.13-3.fc38.x86_64 24/141 Installing : bzip2-libs-1.0.8-13.fc38.x86_64 25/141 Installing : libzstd-1.5.5-1.fc39.x86_64 26/141 Installing : xz-libs-5.4.3-1.fc39.x86_64 27/141 Installing : libxml2-2.10.4-1.fc39.x86_64 28/141 Installing : sqlite-libs-3.41.2-3.fc39.x86_64 29/141 Installing : gmp-1:6.2.1-4.fc38.x86_64 30/141 Installing : libgpg-error-1.47-1.fc39.x86_64 31/141 Installing : libstdc++-13.1.1-4.fc39.x86_64 32/141 Installing : libcap-2.48-6.fc38.x86_64 33/141 Installing : libuuid-2.39-4.fc39.x86_64 34/141 Installing : readline-8.2-3.fc38.x86_64 35/141 Installing : libattr-2.5.1-7.fc39.x86_64 36/141 Installing : libacl-2.3.1-7.fc39.x86_64 37/141 Installing : libffi-3.4.4-2.fc38.x86_64 38/141 Installing : p11-kit-0.24.1-6.fc38.x86_64 39/141 Installing : libxcrypt-4.4.35-1.fc39.x86_64 40/141 Installing : pcre2-10.42-1.fc38.1.x86_64 41/141 Installing : popt-1.19-2.fc38.x86_64 42/141 Installing : libassuan-2.5.6-1.fc39.x86_64 43/141 Installing : elfutils-libelf-0.189-2.fc39.x86_64 44/141 Installing : expat-2.5.0-2.fc38.x86_64 45/141 Installing : gdbm-libs-1:1.23-3.fc38.x86_64 46/141 Installing : json-c-0.16-4.fc38.x86_64 47/141 Installing : keyutils-libs-1.6.1-6.fc38.x86_64 48/141 Installing : libcom_err-1.47.0-1.fc39.x86_64 49/141 Installing : libgomp-13.1.1-4.fc39.x86_64 50/141 Installing : libsepol-3.5-1.fc39.x86_64 51/141 Installing : libselinux-3.5-1.fc39.x86_64 52/141 Installing : sed-4.8-12.fc38.x86_64 53/141 Installing : libsmartcols-2.39-4.fc39.x86_64 54/141 Installing : libtasn1-4.19.0-2.fc38.x86_64 55/141 Installing : libunistring-1.1-3.fc38.x86_64 56/141 Installing : lua-libs-5.4.4-9.fc39.x86_64 57/141 Installing : lz4-libs-1.9.4-3.fc39.x86_64 58/141 Installing : systemd-libs-253.5-6.fc39.x86_64 59/141 Installing : dbus-libs-1:1.14.8-1.fc39.x86_64 60/141 Installing : findutils-1:4.9.0-4.fc39.x86_64 61/141 Installing : libb2-0.98.1-8.fc38.x86_64 62/141 Installing : cyrus-sasl-lib-2.1.28-10.fc39.x86_64 63/141 Installing : libcomps-0.1.19-1.fc39.x86_64 64/141 Installing : grep-3.11-1.fc39.x86_64 65/141 Installing : libblkid-2.39-4.fc39.x86_64 66/141 Installing : libmount-2.39-4.fc39.x86_64 67/141 Installing : fmt-9.1.0-2.fc38.x86_64 68/141 Installing : libgcrypt-1.10.2-1.fc39.x86_64 69/141 Installing : libksba-1.6.4-1.fc39.x86_64 70/141 Installing : mpfr-4.1.1-3.fc38.x86_64 71/141 Installing : nettle-3.9.1-1.fc39.x86_64 72/141 Installing : file-libs-5.44-3.fc39.x86_64 73/141 Installing : elfutils-default-yama-scope-0.189-2.fc39.noarch 74/141 Running scriptlet: elfutils-default-yama-scope-0.189-2.fc39.noarch 74/141 Installing : elfutils-libs-0.189-2.fc39.x86_64 75/141 Installing : alternatives-1.24-1.fc39.x86_64 76/141 Installing : p11-kit-trust-0.24.1-6.fc38.x86_64 77/141 Running scriptlet: p11-kit-trust-0.24.1-6.fc38.x86_64 77/141 Installing : libbrotli-1.0.9-11.fc38.x86_64 78/141 Installing : libcap-ng-0.8.3-5.fc38.x86_64 79/141 Installing : audit-libs-3.1.1-1.fc39.x86_64 80/141 Installing : libsemanage-3.5-2.fc39.x86_64 81/141 Installing : libeconf-0.4.0-5.fc38.x86_64 82/141 Installing : shadow-utils-2:4.13-7.fc39.x86_64 83/141 Installing : libnghttp2-1.54.0-1.fc39.x86_64 84/141 Installing : libsigsegv-2.14-4.fc38.x86_64 85/141 Installing : gawk-5.2.2-1.fc39.x86_64 86/141 Installing : libunistring1.0-1.0-1.fc38.x86_64 87/141 Installing : libidn2-2.3.4-2.fc38.x86_64 88/141 Installing : gnutls-3.8.0-6.fc39.x86_64 89/141 Installing : glib2-2.76.3-1.fc39.x86_64 90/141 Installing : libpsl-0.21.2-3.fc39.x86_64 91/141 Installing : libverto-0.3.2-5.fc38.x86_64 92/141 Installing : libyaml-0.2.5-9.fc38.x86_64 93/141 Installing : mpdecimal-2.5.1-6.fc38.x86_64 94/141 Installing : npth-1.6-13.fc39.x86_64 95/141 Installing : coreutils-common-9.3-1.fc39.x86_64 96/141 Installing : openssl-libs-1:3.0.8-2.fc39.x86_64 97/141 Installing : coreutils-9.3-1.fc39.x86_64 98/141 Running scriptlet: ca-certificates-2023.2.60-2.fc38.noarch 99/141 Installing : ca-certificates-2023.2.60-2.fc38.noarch 99/141 Running scriptlet: ca-certificates-2023.2.60-2.fc38.noarch 99/141 Installing : krb5-libs-1.21-1.fc39.x86_64 100/141 Installing : libtirpc-1.3.3-1.rc1.fc39.x86_64 101/141 Installing : zchunk-libs-1.3.1-1.fc39.x86_64 102/141 Installing : libnsl2-2.0.0-5.fc38.x86_64 103/141 Installing : libssh-0.10.5-1.fc39.x86_64 104/141 Installing : python-pip-wheel-23.1.2-1.fc39.noarch 105/141 Installing : python3-3.11.4-1.fc39.x86_64 106/141 Installing : python3-libs-3.11.4-1.fc39.x86_64 107/141 Installing : python3-libcomps-0.1.19-1.fc39.x86_64 108/141 Installing : python3-dbus-1.3.2-2.fc38.x86_64 109/141 Installing : python3-distro-1.8.0-4.fc39.noarch 110/141 Installing : python3-six-1.16.0-9.fc38.noarch 111/141 Installing : python3-dateutil-1:2.8.2-6.fc39.noarch 112/141 Installing : python3-systemd-235-2.fc38.x86_64 113/141 Installing : libarchive-3.6.1-5.fc39.x86_64 114/141 Installing : libevent-2.1.12-8.fc38.x86_64 115/141 Installing : openldap-2.6.4-2.fc39.x86_64 116/141 Installing : libcurl-8.1.2-1.fc39.x86_64 117/141 Running scriptlet: tpm2-tss-4.0.1-3.fc38.x86_64 118/141 useradd: Warning: missing or non-executable shell '/usr/sbin/nologin' Installing : tpm2-tss-4.0.1-3.fc38.x86_64 118/141 Installing : gnupg2-2.4.2-2.fc39.x86_64 119/141 Installing : gpgme-1.17.1-5.fc39.x86_64 120/141 Installing : librepo-1.15.1-2.fc38.x86_64 121/141 Installing : python3-gpg-1.17.1-5.fc39.x86_64 122/141 Installing : ima-evm-utils-1.5-1.fc39.x86_64 123/141 Installing : curl-8.1.2-1.fc39.x86_64 124/141 Installing : libfsverity-1.4-9.fc38.x86_64 125/141 Installing : rpm-sequoia-1.4.0-3.fc39.x86_64 126/141 Installing : rpm-libs-4.18.91-1.fc39.x86_64 127/141 Installing : libmodulemd-2.15.0-3.fc39.x86_64 128/141 Installing : libsolv-0.7.24-4.fc39.x86_64 129/141 Installing : libdnf-0.70.1-3.fc39.x86_64 130/141 Installing : python3-libdnf-0.70.1-3.fc39.x86_64 131/141 Installing : python3-hawkey-0.70.1-3.fc39.x86_64 132/141 Installing : libdnf5-5.0.14-1.fc39.x86_64 133/141 warning: /etc/dnf/dnf.conf created as /etc/dnf/dnf.conf.rpmnew Installing : dnf-data-4.16.1-2.fc39.noarch 134/141 Installing : rpm-build-libs-4.18.91-1.fc39.x86_64 135/141 Installing : rpm-sign-libs-4.18.91-1.fc39.x86_64 136/141 Installing : python3-rpm-4.18.91-1.fc39.x86_64 137/141 Installing : python3-dnf-4.16.1-2.fc39.noarch 138/141 Installing : python3-dnf-plugins-core-4.4.1-3.fc39.noarch 139/141 Installing : dnf-plugins-core-4.4.1-3.fc39.noarch 140/141 Running scriptlet: rpm-4.18.91-1.fc39.x86_64 141/141 Installing : rpm-4.18.91-1.fc39.x86_64 141/141 Running scriptlet: filesystem-3.18-4.fc39.x86_64 141/141 Running scriptlet: ca-certificates-2023.2.60-2.fc38.noarch 141/141 Running scriptlet: rpm-4.18.91-1.fc39.x86_64 141/141 Verifying : alternatives-1.24-1.fc39.x86_64 1/141 Verifying : audit-libs-3.1.1-1.fc39.x86_64 2/141 Verifying : basesystem-11-17.fc39.noarch 3/141 Verifying : bash-5.2.15-3.fc38.x86_64 4/141 Verifying : bzip2-libs-1.0.8-13.fc38.x86_64 5/141 Verifying : ca-certificates-2023.2.60-2.fc38.noarch 6/141 Verifying : coreutils-9.3-1.fc39.x86_64 7/141 Verifying : coreutils-common-9.3-1.fc39.x86_64 8/141 Verifying : crypto-policies-20230614-1.git5f3458e.fc39.noarc 9/141 Verifying : curl-8.1.2-1.fc39.x86_64 10/141 Verifying : cyrus-sasl-lib-2.1.28-10.fc39.x86_64 11/141 Verifying : dbus-libs-1:1.14.8-1.fc39.x86_64 12/141 Verifying : dnf-data-4.16.1-2.fc39.noarch 13/141 Verifying : dnf-plugins-core-4.4.1-3.fc39.noarch 14/141 Verifying : elfutils-default-yama-scope-0.189-2.fc39.noarch 15/141 Verifying : elfutils-libelf-0.189-2.fc39.x86_64 16/141 Verifying : elfutils-libs-0.189-2.fc39.x86_64 17/141 Verifying : expat-2.5.0-2.fc38.x86_64 18/141 Verifying : fedora-gpg-keys-39-0.1.noarch 19/141 Verifying : fedora-release-39-0.14.noarch 20/141 Verifying : fedora-release-common-39-0.14.noarch 21/141 Verifying : fedora-release-identity-basic-39-0.14.noarch 22/141 Verifying : fedora-repos-39-0.1.noarch 23/141 Verifying : fedora-repos-rawhide-39-0.1.noarch 24/141 Verifying : file-libs-5.44-3.fc39.x86_64 25/141 Verifying : filesystem-3.18-4.fc39.x86_64 26/141 Verifying : findutils-1:4.9.0-4.fc39.x86_64 27/141 Verifying : fmt-9.1.0-2.fc38.x86_64 28/141 Verifying : gawk-5.2.2-1.fc39.x86_64 29/141 Verifying : gdbm-libs-1:1.23-3.fc38.x86_64 30/141 Verifying : glib2-2.76.3-1.fc39.x86_64 31/141 Verifying : glibc-2.37.9000-14.fc39.x86_64 32/141 Verifying : glibc-common-2.37.9000-14.fc39.x86_64 33/141 Verifying : glibc-minimal-langpack-2.37.9000-14.fc39.x86_64 34/141 Verifying : gmp-1:6.2.1-4.fc38.x86_64 35/141 Verifying : gnupg2-2.4.2-2.fc39.x86_64 36/141 Verifying : gnutls-3.8.0-6.fc39.x86_64 37/141 Verifying : gpgme-1.17.1-5.fc39.x86_64 38/141 Verifying : grep-3.11-1.fc39.x86_64 39/141 Verifying : ima-evm-utils-1.5-1.fc39.x86_64 40/141 Verifying : json-c-0.16-4.fc38.x86_64 41/141 Verifying : keyutils-libs-1.6.1-6.fc38.x86_64 42/141 Verifying : krb5-libs-1.21-1.fc39.x86_64 43/141 Verifying : libacl-2.3.1-7.fc39.x86_64 44/141 Verifying : libarchive-3.6.1-5.fc39.x86_64 45/141 Verifying : libassuan-2.5.6-1.fc39.x86_64 46/141 Verifying : libattr-2.5.1-7.fc39.x86_64 47/141 Verifying : libb2-0.98.1-8.fc38.x86_64 48/141 Verifying : libblkid-2.39-4.fc39.x86_64 49/141 Verifying : libbrotli-1.0.9-11.fc38.x86_64 50/141 Verifying : libcap-2.48-6.fc38.x86_64 51/141 Verifying : libcap-ng-0.8.3-5.fc38.x86_64 52/141 Verifying : libcom_err-1.47.0-1.fc39.x86_64 53/141 Verifying : libcomps-0.1.19-1.fc39.x86_64 54/141 Verifying : libcurl-8.1.2-1.fc39.x86_64 55/141 Verifying : libdnf-0.70.1-3.fc39.x86_64 56/141 Verifying : libdnf5-5.0.14-1.fc39.x86_64 57/141 Verifying : libeconf-0.4.0-5.fc38.x86_64 58/141 Verifying : libevent-2.1.12-8.fc38.x86_64 59/141 Verifying : libffi-3.4.4-2.fc38.x86_64 60/141 Verifying : libfsverity-1.4-9.fc38.x86_64 61/141 Verifying : libgcc-13.1.1-4.fc39.x86_64 62/141 Verifying : libgcrypt-1.10.2-1.fc39.x86_64 63/141 Verifying : libgomp-13.1.1-4.fc39.x86_64 64/141 Verifying : libgpg-error-1.47-1.fc39.x86_64 65/141 Verifying : libidn2-2.3.4-2.fc38.x86_64 66/141 Verifying : libksba-1.6.4-1.fc39.x86_64 67/141 Verifying : libmodulemd-2.15.0-3.fc39.x86_64 68/141 Verifying : libmount-2.39-4.fc39.x86_64 69/141 Verifying : libnghttp2-1.54.0-1.fc39.x86_64 70/141 Verifying : libnsl2-2.0.0-5.fc38.x86_64 71/141 Verifying : libpsl-0.21.2-3.fc39.x86_64 72/141 Verifying : librepo-1.15.1-2.fc38.x86_64 73/141 Verifying : libreport-filesystem-2.17.10-1.fc39.noarch 74/141 Verifying : libselinux-3.5-1.fc39.x86_64 75/141 Verifying : libsemanage-3.5-2.fc39.x86_64 76/141 Verifying : libsepol-3.5-1.fc39.x86_64 77/141 Verifying : libsigsegv-2.14-4.fc38.x86_64 78/141 Verifying : libsmartcols-2.39-4.fc39.x86_64 79/141 Verifying : libsolv-0.7.24-4.fc39.x86_64 80/141 Verifying : libssh-0.10.5-1.fc39.x86_64 81/141 Verifying : libssh-config-0.10.5-1.fc39.noarch 82/141 Verifying : libstdc++-13.1.1-4.fc39.x86_64 83/141 Verifying : libtasn1-4.19.0-2.fc38.x86_64 84/141 Verifying : libtirpc-1.3.3-1.rc1.fc39.x86_64 85/141 Verifying : libunistring-1.1-3.fc38.x86_64 86/141 Verifying : libunistring1.0-1.0-1.fc38.x86_64 87/141 Verifying : libuuid-2.39-4.fc39.x86_64 88/141 Verifying : libverto-0.3.2-5.fc38.x86_64 89/141 Verifying : libxcrypt-4.4.35-1.fc39.x86_64 90/141 Verifying : libxml2-2.10.4-1.fc39.x86_64 91/141 Verifying : libyaml-0.2.5-9.fc38.x86_64 92/141 Verifying : libzstd-1.5.5-1.fc39.x86_64 93/141 Verifying : lua-libs-5.4.4-9.fc39.x86_64 94/141 Verifying : lz4-libs-1.9.4-3.fc39.x86_64 95/141 Verifying : mpdecimal-2.5.1-6.fc38.x86_64 96/141 Verifying : mpfr-4.1.1-3.fc38.x86_64 97/141 Verifying : ncurses-base-6.4-4.20230520.fc39.noarch 98/141 Verifying : ncurses-libs-6.4-4.20230520.fc39.x86_64 99/141 Verifying : nettle-3.9.1-1.fc39.x86_64 100/141 Verifying : npth-1.6-13.fc39.x86_64 101/141 Verifying : openldap-2.6.4-2.fc39.x86_64 102/141 Verifying : openssl-libs-1:3.0.8-2.fc39.x86_64 103/141 Verifying : p11-kit-0.24.1-6.fc38.x86_64 104/141 Verifying : p11-kit-trust-0.24.1-6.fc38.x86_64 105/141 Verifying : pcre2-10.42-1.fc38.1.x86_64 106/141 Verifying : pcre2-syntax-10.42-1.fc38.1.noarch 107/141 Verifying : popt-1.19-2.fc38.x86_64 108/141 Verifying : publicsuffix-list-dafsa-20230614-1.fc39.noarch 109/141 Verifying : python-pip-wheel-23.1.2-1.fc39.noarch 110/141 Verifying : python-setuptools-wheel-67.7.2-2.fc39.noarch 111/141 Verifying : python3-3.11.4-1.fc39.x86_64 112/141 Verifying : python3-dateutil-1:2.8.2-6.fc39.noarch 113/141 Verifying : python3-dbus-1.3.2-2.fc38.x86_64 114/141 Verifying : python3-distro-1.8.0-4.fc39.noarch 115/141 Verifying : python3-dnf-4.16.1-2.fc39.noarch 116/141 Verifying : python3-dnf-plugins-core-4.4.1-3.fc39.noarch 117/141 Verifying : python3-gpg-1.17.1-5.fc39.x86_64 118/141 Verifying : python3-hawkey-0.70.1-3.fc39.x86_64 119/141 Verifying : python3-libcomps-0.1.19-1.fc39.x86_64 120/141 Verifying : python3-libdnf-0.70.1-3.fc39.x86_64 121/141 Verifying : python3-libs-3.11.4-1.fc39.x86_64 122/141 Verifying : python3-rpm-4.18.91-1.fc39.x86_64 123/141 Verifying : python3-six-1.16.0-9.fc38.noarch 124/141 Verifying : python3-systemd-235-2.fc38.x86_64 125/141 Verifying : readline-8.2-3.fc38.x86_64 126/141 Verifying : rpm-4.18.91-1.fc39.x86_64 127/141 Verifying : rpm-build-libs-4.18.91-1.fc39.x86_64 128/141 Verifying : rpm-libs-4.18.91-1.fc39.x86_64 129/141 Verifying : rpm-sequoia-1.4.0-3.fc39.x86_64 130/141 Verifying : rpm-sign-libs-4.18.91-1.fc39.x86_64 131/141 Verifying : sed-4.8-12.fc38.x86_64 132/141 Verifying : setup-2.14.3-3.fc39.noarch 133/141 Verifying : shadow-utils-2:4.13-7.fc39.x86_64 134/141 Verifying : sqlite-libs-3.41.2-3.fc39.x86_64 135/141 Verifying : systemd-libs-253.5-6.fc39.x86_64 136/141 Verifying : tpm2-tss-4.0.1-3.fc38.x86_64 137/141 Verifying : tzdata-2023c-1.fc39.noarch 138/141 Verifying : xz-libs-5.4.3-1.fc39.x86_64 139/141 Verifying : zchunk-libs-1.3.1-1.fc39.x86_64 140/141 Verifying : zlib-1.2.13-3.fc38.x86_64 141/141 Installed products updated. Installed: alternatives-1.24-1.fc39.x86_64 audit-libs-3.1.1-1.fc39.x86_64 basesystem-11-17.fc39.noarch bash-5.2.15-3.fc38.x86_64 bzip2-libs-1.0.8-13.fc38.x86_64 ca-certificates-2023.2.60-2.fc38.noarch coreutils-9.3-1.fc39.x86_64 coreutils-common-9.3-1.fc39.x86_64 crypto-policies-20230614-1.git5f3458e.fc39.noarch curl-8.1.2-1.fc39.x86_64 cyrus-sasl-lib-2.1.28-10.fc39.x86_64 dbus-libs-1:1.14.8-1.fc39.x86_64 dnf-data-4.16.1-2.fc39.noarch dnf-plugins-core-4.4.1-3.fc39.noarch elfutils-default-yama-scope-0.189-2.fc39.noarch elfutils-libelf-0.189-2.fc39.x86_64 elfutils-libs-0.189-2.fc39.x86_64 expat-2.5.0-2.fc38.x86_64 fedora-gpg-keys-39-0.1.noarch fedora-release-39-0.14.noarch fedora-release-common-39-0.14.noarch fedora-release-identity-basic-39-0.14.noarch fedora-repos-39-0.1.noarch fedora-repos-rawhide-39-0.1.noarch file-libs-5.44-3.fc39.x86_64 filesystem-3.18-4.fc39.x86_64 findutils-1:4.9.0-4.fc39.x86_64 fmt-9.1.0-2.fc38.x86_64 gawk-5.2.2-1.fc39.x86_64 gdbm-libs-1:1.23-3.fc38.x86_64 glib2-2.76.3-1.fc39.x86_64 glibc-2.37.9000-14.fc39.x86_64 glibc-common-2.37.9000-14.fc39.x86_64 glibc-minimal-langpack-2.37.9000-14.fc39.x86_64 gmp-1:6.2.1-4.fc38.x86_64 gnupg2-2.4.2-2.fc39.x86_64 gnutls-3.8.0-6.fc39.x86_64 gpgme-1.17.1-5.fc39.x86_64 grep-3.11-1.fc39.x86_64 ima-evm-utils-1.5-1.fc39.x86_64 json-c-0.16-4.fc38.x86_64 keyutils-libs-1.6.1-6.fc38.x86_64 krb5-libs-1.21-1.fc39.x86_64 libacl-2.3.1-7.fc39.x86_64 libarchive-3.6.1-5.fc39.x86_64 libassuan-2.5.6-1.fc39.x86_64 libattr-2.5.1-7.fc39.x86_64 libb2-0.98.1-8.fc38.x86_64 libblkid-2.39-4.fc39.x86_64 libbrotli-1.0.9-11.fc38.x86_64 libcap-2.48-6.fc38.x86_64 libcap-ng-0.8.3-5.fc38.x86_64 libcom_err-1.47.0-1.fc39.x86_64 libcomps-0.1.19-1.fc39.x86_64 libcurl-8.1.2-1.fc39.x86_64 libdnf-0.70.1-3.fc39.x86_64 libdnf5-5.0.14-1.fc39.x86_64 libeconf-0.4.0-5.fc38.x86_64 libevent-2.1.12-8.fc38.x86_64 libffi-3.4.4-2.fc38.x86_64 libfsverity-1.4-9.fc38.x86_64 libgcc-13.1.1-4.fc39.x86_64 libgcrypt-1.10.2-1.fc39.x86_64 libgomp-13.1.1-4.fc39.x86_64 libgpg-error-1.47-1.fc39.x86_64 libidn2-2.3.4-2.fc38.x86_64 libksba-1.6.4-1.fc39.x86_64 libmodulemd-2.15.0-3.fc39.x86_64 libmount-2.39-4.fc39.x86_64 libnghttp2-1.54.0-1.fc39.x86_64 libnsl2-2.0.0-5.fc38.x86_64 libpsl-0.21.2-3.fc39.x86_64 librepo-1.15.1-2.fc38.x86_64 libreport-filesystem-2.17.10-1.fc39.noarch libselinux-3.5-1.fc39.x86_64 libsemanage-3.5-2.fc39.x86_64 libsepol-3.5-1.fc39.x86_64 libsigsegv-2.14-4.fc38.x86_64 libsmartcols-2.39-4.fc39.x86_64 libsolv-0.7.24-4.fc39.x86_64 libssh-0.10.5-1.fc39.x86_64 libssh-config-0.10.5-1.fc39.noarch libstdc++-13.1.1-4.fc39.x86_64 libtasn1-4.19.0-2.fc38.x86_64 libtirpc-1.3.3-1.rc1.fc39.x86_64 libunistring-1.1-3.fc38.x86_64 libunistring1.0-1.0-1.fc38.x86_64 libuuid-2.39-4.fc39.x86_64 libverto-0.3.2-5.fc38.x86_64 libxcrypt-4.4.35-1.fc39.x86_64 libxml2-2.10.4-1.fc39.x86_64 libyaml-0.2.5-9.fc38.x86_64 libzstd-1.5.5-1.fc39.x86_64 lua-libs-5.4.4-9.fc39.x86_64 lz4-libs-1.9.4-3.fc39.x86_64 mpdecimal-2.5.1-6.fc38.x86_64 mpfr-4.1.1-3.fc38.x86_64 ncurses-base-6.4-4.20230520.fc39.noarch ncurses-libs-6.4-4.20230520.fc39.x86_64 nettle-3.9.1-1.fc39.x86_64 npth-1.6-13.fc39.x86_64 openldap-2.6.4-2.fc39.x86_64 openssl-libs-1:3.0.8-2.fc39.x86_64 p11-kit-0.24.1-6.fc38.x86_64 p11-kit-trust-0.24.1-6.fc38.x86_64 pcre2-10.42-1.fc38.1.x86_64 pcre2-syntax-10.42-1.fc38.1.noarch popt-1.19-2.fc38.x86_64 publicsuffix-list-dafsa-20230614-1.fc39.noarch python-pip-wheel-23.1.2-1.fc39.noarch python-setuptools-wheel-67.7.2-2.fc39.noarch python3-3.11.4-1.fc39.x86_64 python3-dateutil-1:2.8.2-6.fc39.noarch python3-dbus-1.3.2-2.fc38.x86_64 python3-distro-1.8.0-4.fc39.noarch python3-dnf-4.16.1-2.fc39.noarch python3-dnf-plugins-core-4.4.1-3.fc39.noarch python3-gpg-1.17.1-5.fc39.x86_64 python3-hawkey-0.70.1-3.fc39.x86_64 python3-libcomps-0.1.19-1.fc39.x86_64 python3-libdnf-0.70.1-3.fc39.x86_64 python3-libs-3.11.4-1.fc39.x86_64 python3-rpm-4.18.91-1.fc39.x86_64 python3-six-1.16.0-9.fc38.noarch python3-systemd-235-2.fc38.x86_64 readline-8.2-3.fc38.x86_64 rpm-4.18.91-1.fc39.x86_64 rpm-build-libs-4.18.91-1.fc39.x86_64 rpm-libs-4.18.91-1.fc39.x86_64 rpm-sequoia-1.4.0-3.fc39.x86_64 rpm-sign-libs-4.18.91-1.fc39.x86_64 sed-4.8-12.fc38.x86_64 setup-2.14.3-3.fc39.noarch shadow-utils-2:4.13-7.fc39.x86_64 sqlite-libs-3.41.2-3.fc39.x86_64 systemd-libs-253.5-6.fc39.x86_64 tpm2-tss-4.0.1-3.fc38.x86_64 tzdata-2023c-1.fc39.noarch xz-libs-5.4.3-1.fc39.x86_64 zchunk-libs-1.3.1-1.fc39.x86_64 zlib-1.2.13-3.fc38.x86_64 Complete! Finish(bootstrap): installing dnf tooling Start(bootstrap): creating root cache Finish(bootstrap): creating root cache Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-1687861990.181316/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin Mock Version: 4.1 INFO: Mock Version: 4.1 INFO: Package manager dnf detected and used (direct choice) Start: installing minimal buildroot with dnf No matches found for the following disable plugin patterns: local, spacewalk, versionlock Copr repository 104 kB/s | 14 kB 00:00 fedora 17 MB/s | 71 MB 00:04 Dependencies resolved. ================================================================================ Package Arch Version Repo Size ================================================================================ Installing group/module packages: bash x86_64 5.2.15-3.fc38 fedora 1.8 M bzip2 x86_64 1.0.8-13.fc38 fedora 52 k coreutils x86_64 9.3-1.fc39 fedora 1.1 M cpio x86_64 2.14-2.fc39 fedora 279 k diffutils x86_64 3.9-4.fc39 fedora 397 k fedora-release-common noarch 39-0.14 fedora 17 k findutils x86_64 1:4.9.0-4.fc39 fedora 491 k gawk x86_64 5.2.2-1.fc39 fedora 1.1 M glibc-minimal-langpack x86_64 2.37.9000-14.fc39 fedora 59 k grep x86_64 3.11-1.fc39 fedora 298 k gzip x86_64 1.12-3.fc38 fedora 166 k info x86_64 7.0.3-2.fc39 fedora 182 k patch x86_64 2.7.6-21.fc39 fedora 126 k redhat-rpm-config noarch 255-1.fc39 fedora 83 k rpm-build x86_64 4.18.91-1.fc39 fedora 77 k sed x86_64 4.8-12.fc38 fedora 306 k shadow-utils x86_64 2:4.13-7.fc39 fedora 1.3 M tar x86_64 2:1.34-8.fc39 fedora 888 k unzip x86_64 6.0-60.fc38 fedora 184 k util-linux x86_64 2.39-4.fc39 fedora 1.2 M which x86_64 2.21-39.fc39 fedora 42 k xz x86_64 5.4.3-1.fc39 fedora 555 k Installing dependencies: alternatives x86_64 1.24-1.fc39 fedora 39 k ansible-srpm-macros noarch 1-10.fc39 fedora 21 k audit-libs x86_64 3.1.1-1.fc39 fedora 117 k authselect x86_64 1.4.2-2.fc38 fedora 144 k authselect-libs x86_64 1.4.2-2.fc38 fedora 249 k basesystem noarch 11-17.fc39 fedora 7.0 k binutils x86_64 2.40-9.fc39 fedora 5.6 M binutils-gold x86_64 2.40-9.fc39 fedora 797 k bzip2-libs x86_64 1.0.8-13.fc38 fedora 41 k ca-certificates noarch 2023.2.60-2.fc38 fedora 845 k coreutils-common x86_64 9.3-1.fc39 fedora 2.1 M cracklib x86_64 2.9.7-31.fc38 fedora 92 k crypto-policies noarch 20230614-1.git5f3458e.fc39 fedora 94 k curl x86_64 8.1.2-1.fc39 fedora 345 k cyrus-sasl-lib x86_64 2.1.28-10.fc39 fedora 792 k debugedit x86_64 5.0-7.fc38 fedora 78 k dwz x86_64 0.15-2.fc38 fedora 135 k ed x86_64 1.19-2.fc38 fedora 78 k efi-srpm-macros noarch 5-8.fc39 fedora 22 k elfutils x86_64 0.189-2.fc39 fedora 536 k elfutils-debuginfod-client x86_64 0.189-2.fc39 fedora 39 k elfutils-default-yama-scope noarch 0.189-2.fc39 fedora 15 k elfutils-libelf x86_64 0.189-2.fc39 fedora 196 k elfutils-libs x86_64 0.189-2.fc39 fedora 260 k fedora-gpg-keys noarch 39-0.1 fedora 126 k fedora-release noarch 39-0.14 fedora 6.6 k fedora-release-identity-basic noarch 39-0.14 fedora 7.4 k fedora-repos noarch 39-0.1 fedora 9.4 k fedora-repos-rawhide noarch 39-0.1 fedora 9.0 k file x86_64 5.44-3.fc39 fedora 50 k file-libs x86_64 5.44-3.fc39 fedora 730 k filesystem x86_64 3.18-4.fc39 fedora 1.1 M fonts-srpm-macros noarch 1:2.0.5-11.fc38 fedora 26 k fpc-srpm-macros noarch 1.3-7.fc38 fedora 7.8 k gdb-minimal x86_64 13.1-5.fc39 fedora 4.2 M gdbm-libs x86_64 1:1.23-3.fc38 fedora 56 k ghc-srpm-macros noarch 1.6.1-1.fc38 fedora 8.0 k glibc x86_64 2.37.9000-14.fc39 fedora 2.2 M glibc-common x86_64 2.37.9000-14.fc39 fedora 339 k glibc-gconv-extra x86_64 2.37.9000-14.fc39 fedora 1.6 M gmp x86_64 1:6.2.1-4.fc38 fedora 313 k gnat-srpm-macros noarch 6-2.fc38 fedora 8.8 k go-srpm-macros noarch 3.2.0-3.fc39 fedora 27 k jansson x86_64 2.13.1-6.fc38 fedora 44 k kernel-srpm-macros noarch 1.0-19.fc39 fedora 10 k keyutils-libs x86_64 1.6.1-6.fc38 fedora 31 k krb5-libs x86_64 1.21-1.fc39 fedora 765 k libacl x86_64 2.3.1-7.fc39 fedora 23 k libarchive x86_64 3.6.1-5.fc39 fedora 400 k libattr x86_64 2.5.1-7.fc39 fedora 18 k libblkid x86_64 2.39-4.fc39 fedora 116 k libbrotli x86_64 1.0.9-11.fc38 fedora 317 k libcap x86_64 2.48-6.fc38 fedora 67 k libcap-ng x86_64 0.8.3-5.fc38 fedora 32 k libcom_err x86_64 1.47.0-1.fc39 fedora 26 k libcurl x86_64 8.1.2-1.fc39 fedora 323 k libdb x86_64 5.3.28-55.fc38 fedora 758 k libeconf x86_64 0.4.0-5.fc38 fedora 27 k libevent x86_64 2.1.12-8.fc38 fedora 257 k libfdisk x86_64 2.39-4.fc39 fedora 162 k libffi x86_64 3.4.4-2.fc38 fedora 38 k libgcc x86_64 13.1.1-4.fc39 fedora 107 k libgomp x86_64 13.1.1-4.fc39 fedora 317 k libidn2 x86_64 2.3.4-2.fc38 fedora 160 k libmount x86_64 2.39-4.fc39 fedora 155 k libnghttp2 x86_64 1.54.0-1.fc39 fedora 75 k libnsl2 x86_64 2.0.0-5.fc38 fedora 30 k libpkgconf x86_64 1.9.4-2.fc39 fedora 38 k libpsl x86_64 0.21.2-3.fc39 fedora 63 k libpwquality x86_64 1.4.5-3.fc38 fedora 119 k libselinux x86_64 3.5-1.fc39 fedora 87 k libsemanage x86_64 3.5-2.fc39 fedora 120 k libsepol x86_64 3.5-1.fc39 fedora 324 k libsigsegv x86_64 2.14-4.fc38 fedora 27 k libsmartcols x86_64 2.39-4.fc39 fedora 67 k libssh x86_64 0.10.5-1.fc39 fedora 211 k libssh-config noarch 0.10.5-1.fc39 fedora 9.0 k libstdc++ x86_64 13.1.1-4.fc39 fedora 861 k libtasn1 x86_64 4.19.0-2.fc38 fedora 74 k libtirpc x86_64 1.3.3-1.rc1.fc39 fedora 93 k libunistring x86_64 1.1-3.fc38 fedora 545 k libunistring1.0 x86_64 1.0-1.fc38 fedora 539 k libutempter x86_64 1.2.1-9.fc39 fedora 26 k libuuid x86_64 2.39-4.fc39 fedora 28 k libverto x86_64 0.3.2-5.fc38 fedora 21 k libxcrypt x86_64 4.4.35-1.fc39 fedora 119 k libxml2 x86_64 2.10.4-1.fc39 fedora 700 k libzstd x86_64 1.5.5-1.fc39 fedora 308 k lua-libs x86_64 5.4.4-9.fc39 fedora 133 k lua-srpm-macros noarch 1-8.fc38 fedora 8.6 k lz4-libs x86_64 1.9.4-3.fc39 fedora 67 k mpfr x86_64 4.1.1-3.fc38 fedora 600 k ncurses-base noarch 6.4-4.20230520.fc39 fedora 86 k ncurses-libs x86_64 6.4-4.20230520.fc39 fedora 336 k ocaml-srpm-macros noarch 7-3.fc38 fedora 13 k openblas-srpm-macros noarch 2-13.fc38 fedora 7.5 k openldap x86_64 2.6.4-2.fc39 fedora 255 k openssl-libs x86_64 1:3.0.8-2.fc39 fedora 2.1 M p11-kit x86_64 0.24.1-6.fc38 fedora 359 k p11-kit-trust x86_64 0.24.1-6.fc38 fedora 136 k package-notes-srpm-macros noarch 0.5-8.fc39 fedora 11 k pam x86_64 1.5.3-1.fc39 fedora 547 k pam-libs x86_64 1.5.3-1.fc39 fedora 57 k pcre2 x86_64 10.42-1.fc38.1 fedora 234 k pcre2-syntax noarch 10.42-1.fc38.1 fedora 144 k perl-srpm-macros noarch 1-48.fc38 fedora 8.4 k pkgconf x86_64 1.9.4-2.fc39 fedora 42 k pkgconf-m4 noarch 1.9.4-2.fc39 fedora 14 k pkgconf-pkg-config x86_64 1.9.4-2.fc39 fedora 9.5 k popt x86_64 1.19-2.fc38 fedora 67 k publicsuffix-list-dafsa noarch 20230614-1.fc39 fedora 57 k pyproject-srpm-macros noarch 1.9.0-1.fc39 fedora 15 k python-srpm-macros noarch 3.11-10.fc39 fedora 26 k qt5-srpm-macros noarch 5.15.10-1.fc39 fedora 7.8 k qt6-srpm-macros noarch 6.5.1-1.fc39 fedora 9.2 k readline x86_64 8.2-3.fc38 fedora 212 k rpm x86_64 4.18.91-1.fc39 fedora 528 k rpm-build-libs x86_64 4.18.91-1.fc39 fedora 95 k rpm-libs x86_64 4.18.91-1.fc39 fedora 308 k rpm-sequoia x86_64 1.4.0-3.fc39 fedora 848 k rpmautospec-rpm-macros noarch 0.3.5-2.fc39 fedora 8.9 k rust-srpm-macros noarch 24-2.fc39 fedora 12 k setup noarch 2.14.3-3.fc39 fedora 152 k sqlite-libs x86_64 3.41.2-3.fc39 fedora 669 k systemd-libs x86_64 253.5-6.fc39 fedora 652 k tzdata noarch 2023c-1.fc39 fedora 718 k util-linux-core x86_64 2.39-4.fc39 fedora 492 k xxhash-libs x86_64 0.8.1-5.fc39 fedora 40 k xz-libs x86_64 5.4.3-1.fc39 fedora 108 k zip x86_64 3.0-36.fc38 fedora 265 k zlib x86_64 1.2.13-3.fc38 fedora 95 k zstd x86_64 1.5.5-1.fc39 fedora 482 k Installing Groups: Buildsystem building group Transaction Summary ================================================================================ Install 154 Packages Total download size: 53 M Installed size: 181 M Downloading Packages: (1/154): ansible-srpm-macros-1-10.fc39.noarch.r 89 kB/s | 21 kB 00:00 (2/154): alternatives-1.24-1.fc39.x86_64.rpm 146 kB/s | 39 kB 00:00 (3/154): audit-libs-3.1.1-1.fc39.x86_64.rpm 296 kB/s | 117 kB 00:00 (4/154): basesystem-11-17.fc39.noarch.rpm 93 kB/s | 7.0 kB 00:00 (5/154): authselect-1.4.2-2.fc38.x86_64.rpm 535 kB/s | 144 kB 00:00 (6/154): authselect-libs-1.4.2-2.fc38.x86_64.rp 838 kB/s | 249 kB 00:00 (7/154): bash-5.2.15-3.fc38.x86_64.rpm 3.3 MB/s | 1.8 MB 00:00 (8/154): bzip2-1.0.8-13.fc38.x86_64.rpm 619 kB/s | 52 kB 00:00 (9/154): bzip2-libs-1.0.8-13.fc38.x86_64.rpm 552 kB/s | 41 kB 00:00 (10/154): binutils-2.40-9.fc39.x86_64.rpm 7.4 MB/s | 5.6 MB 00:00 (11/154): ca-certificates-2023.2.60-2.fc38.noar 6.7 MB/s | 845 kB 00:00 (12/154): binutils-gold-2.40-9.fc39.x86_64.rpm 1.0 MB/s | 797 kB 00:00 (13/154): coreutils-common-9.3-1.fc39.x86_64.rp 9.4 MB/s | 2.1 MB 00:00 (14/154): coreutils-9.3-1.fc39.x86_64.rpm 4.1 MB/s | 1.1 MB 00:00 (15/154): cpio-2.14-2.fc39.x86_64.rpm 1.0 MB/s | 279 kB 00:00 (16/154): crypto-policies-20230614-1.git5f3458e 564 kB/s | 94 kB 00:00 (17/154): curl-8.1.2-1.fc39.x86_64.rpm 2.2 MB/s | 345 kB 00:00 (18/154): cracklib-2.9.7-31.fc38.x86_64.rpm 374 kB/s | 92 kB 00:00 (19/154): debugedit-5.0-7.fc38.x86_64.rpm 855 kB/s | 78 kB 00:00 (20/154): diffutils-3.9-4.fc39.x86_64.rpm 4.4 MB/s | 397 kB 00:00 (21/154): cyrus-sasl-lib-2.1.28-10.fc39.x86_64. 4.4 MB/s | 792 kB 00:00 (22/154): ed-1.19-2.fc38.x86_64.rpm 1.0 MB/s | 78 kB 00:00 (23/154): efi-srpm-macros-5-8.fc39.noarch.rpm 299 kB/s | 22 kB 00:00 (24/154): dwz-0.15-2.fc38.x86_64.rpm 1.3 MB/s | 135 kB 00:00 (25/154): elfutils-debuginfod-client-0.189-2.fc 522 kB/s | 39 kB 00:00 (26/154): elfutils-default-yama-scope-0.189-2.f 189 kB/s | 15 kB 00:00 (27/154): elfutils-0.189-2.fc39.x86_64.rpm 5.6 MB/s | 536 kB 00:00 (28/154): elfutils-libelf-0.189-2.fc39.x86_64.r 2.5 MB/s | 196 kB 00:00 (29/154): fedora-gpg-keys-39-0.1.noarch.rpm 1.6 MB/s | 126 kB 00:00 (30/154): elfutils-libs-0.189-2.fc39.x86_64.rpm 2.0 MB/s | 260 kB 00:00 (31/154): fedora-release-39-0.14.noarch.rpm 90 kB/s | 6.6 kB 00:00 (32/154): fedora-release-common-39-0.14.noarch. 226 kB/s | 17 kB 00:00 (33/154): fedora-release-identity-basic-39-0.14 95 kB/s | 7.4 kB 00:00 (34/154): fedora-repos-39-0.1.noarch.rpm 121 kB/s | 9.4 kB 00:00 (35/154): fedora-repos-rawhide-39-0.1.noarch.rp 121 kB/s | 9.0 kB 00:00 (36/154): file-5.44-3.fc39.x86_64.rpm 577 kB/s | 50 kB 00:00 (37/154): file-libs-5.44-3.fc39.x86_64.rpm 7.8 MB/s | 730 kB 00:00 (38/154): filesystem-3.18-4.fc39.x86_64.rpm 9.4 MB/s | 1.1 MB 00:00 (39/154): fonts-srpm-macros-2.0.5-11.fc38.noarc 348 kB/s | 26 kB 00:00 (40/154): fpc-srpm-macros-1.3-7.fc38.noarch.rpm 104 kB/s | 7.8 kB 00:00 (41/154): findutils-4.9.0-4.fc39.x86_64.rpm 2.8 MB/s | 491 kB 00:00 (42/154): gawk-5.2.2-1.fc39.x86_64.rpm 11 MB/s | 1.1 MB 00:00 (43/154): ghc-srpm-macros-1.6.1-1.fc38.noarch.r 92 kB/s | 8.0 kB 00:00 (44/154): gdbm-libs-1.23-3.fc38.x86_64.rpm 221 kB/s | 56 kB 00:00 (45/154): gdb-minimal-13.1-5.fc39.x86_64.rpm 11 MB/s | 4.2 MB 00:00 (46/154): glibc-2.37.9000-14.fc39.x86_64.rpm 7.3 MB/s | 2.2 MB 00:00 (47/154): glibc-common-2.37.9000-14.fc39.x86_64 1.7 MB/s | 339 kB 00:00 (48/154): glibc-minimal-langpack-2.37.9000-14.f 436 kB/s | 59 kB 00:00 (49/154): glibc-gconv-extra-2.37.9000-14.fc39.x 7.2 MB/s | 1.6 MB 00:00 (50/154): gmp-6.2.1-4.fc38.x86_64.rpm 2.3 MB/s | 313 kB 00:00 (51/154): gnat-srpm-macros-6-2.fc38.noarch.rpm 113 kB/s | 8.8 kB 00:00 (52/154): go-srpm-macros-3.2.0-3.fc39.noarch.rp 345 kB/s | 27 kB 00:00 (53/154): grep-3.11-1.fc39.x86_64.rpm 2.1 MB/s | 298 kB 00:00 (54/154): jansson-2.13.1-6.fc38.x86_64.rpm 518 kB/s | 44 kB 00:00 (55/154): gzip-1.12-3.fc38.x86_64.rpm 797 kB/s | 166 kB 00:00 (56/154): info-7.0.3-2.fc39.x86_64.rpm 1.0 MB/s | 182 kB 00:00 (57/154): kernel-srpm-macros-1.0-19.fc39.noarch 117 kB/s | 10 kB 00:00 (58/154): libacl-2.3.1-7.fc39.x86_64.rpm 258 kB/s | 23 kB 00:00 (59/154): keyutils-libs-1.6.1-6.fc38.x86_64.rpm 171 kB/s | 31 kB 00:00 (60/154): krb5-libs-1.21-1.fc39.x86_64.rpm 4.0 MB/s | 765 kB 00:00 (61/154): libblkid-2.39-4.fc39.x86_64.rpm 1.4 MB/s | 116 kB 00:00 (62/154): libattr-2.5.1-7.fc39.x86_64.rpm 196 kB/s | 18 kB 00:00 (63/154): libarchive-3.6.1-5.fc39.x86_64.rpm 1.5 MB/s | 400 kB 00:00 (64/154): libcap-2.48-6.fc38.x86_64.rpm 392 kB/s | 67 kB 00:00 (65/154): libcap-ng-0.8.3-5.fc38.x86_64.rpm 373 kB/s | 32 kB 00:00 (66/154): libbrotli-1.0.9-11.fc38.x86_64.rpm 1.3 MB/s | 317 kB 00:00 (67/154): libcom_err-1.47.0-1.fc39.x86_64.rpm 282 kB/s | 26 kB 00:00 (68/154): libdb-5.3.28-55.fc38.x86_64.rpm 3.2 MB/s | 758 kB 00:00 (69/154): libcurl-8.1.2-1.fc39.x86_64.rpm 1.3 MB/s | 323 kB 00:00 (70/154): libevent-2.1.12-8.fc38.x86_64.rpm 2.3 MB/s | 257 kB 00:00 (71/154): libfdisk-2.39-4.fc39.x86_64.rpm 1.2 MB/s | 162 kB 00:00 (72/154): libffi-3.4.4-2.fc38.x86_64.rpm 486 kB/s | 38 kB 00:00 (73/154): libeconf-0.4.0-5.fc38.x86_64.rpm 65 kB/s | 27 kB 00:00 (74/154): libgcc-13.1.1-4.fc39.x86_64.rpm 973 kB/s | 107 kB 00:00 (75/154): libgomp-13.1.1-4.fc39.x86_64.rpm 2.6 MB/s | 317 kB 00:00 (76/154): libmount-2.39-4.fc39.x86_64.rpm 1.2 MB/s | 155 kB 00:00 (77/154): libidn2-2.3.4-2.fc38.x86_64.rpm 891 kB/s | 160 kB 00:00 (78/154): libnghttp2-1.54.0-1.fc39.x86_64.rpm 895 kB/s | 75 kB 00:00 (79/154): libnsl2-2.0.0-5.fc38.x86_64.rpm 348 kB/s | 30 kB 00:00 (80/154): libpsl-0.21.2-3.fc39.x86_64.rpm 766 kB/s | 63 kB 00:00 (81/154): libselinux-3.5-1.fc39.x86_64.rpm 1.0 MB/s | 87 kB 00:00 (82/154): libpwquality-1.4.5-3.fc38.x86_64.rpm 629 kB/s | 119 kB 00:00 (83/154): libsemanage-3.5-2.fc39.x86_64.rpm 1.3 MB/s | 120 kB 00:00 (84/154): libsigsegv-2.14-4.fc38.x86_64.rpm 327 kB/s | 27 kB 00:00 (85/154): libpkgconf-1.9.4-2.fc39.x86_64.rpm 92 kB/s | 38 kB 00:00 (86/154): libsmartcols-2.39-4.fc39.x86_64.rpm 813 kB/s | 67 kB 00:00 (87/154): libsepol-3.5-1.fc39.x86_64.rpm 1.7 MB/s | 324 kB 00:00 (88/154): libssh-config-0.10.5-1.fc39.noarch.rp 113 kB/s | 9.0 kB 00:00 (89/154): libssh-0.10.5-1.fc39.x86_64.rpm 800 kB/s | 211 kB 00:00 (90/154): libtasn1-4.19.0-2.fc38.x86_64.rpm 451 kB/s | 74 kB 00:00 (91/154): libstdc++-13.1.1-4.fc39.x86_64.rpm 2.4 MB/s | 861 kB 00:00 (92/154): libtirpc-1.3.3-1.rc1.fc39.x86_64.rpm 706 kB/s | 93 kB 00:00 (93/154): libutempter-1.2.1-9.fc39.x86_64.rpm 292 kB/s | 26 kB 00:00 (94/154): libuuid-2.39-4.fc39.x86_64.rpm 297 kB/s | 28 kB 00:00 (95/154): libunistring1.0-1.0-1.fc38.x86_64.rpm 2.3 MB/s | 539 kB 00:00 (96/154): libverto-0.3.2-5.fc38.x86_64.rpm 230 kB/s | 21 kB 00:00 (97/154): libxcrypt-4.4.35-1.fc39.x86_64.rpm 656 kB/s | 119 kB 00:00 (98/154): libzstd-1.5.5-1.fc39.x86_64.rpm 1.8 MB/s | 308 kB 00:00 (99/154): lua-libs-5.4.4-9.fc39.x86_64.rpm 1.1 MB/s | 133 kB 00:00 (100/154): libunistring-1.1-3.fc38.x86_64.rpm 655 kB/s | 545 kB 00:00 (101/154): libxml2-2.10.4-1.fc39.x86_64.rpm 1.4 MB/s | 700 kB 00:00 (102/154): lua-srpm-macros-1-8.fc38.noarch.rpm 99 kB/s | 8.6 kB 00:00 (103/154): lz4-libs-1.9.4-3.fc39.x86_64.rpm 483 kB/s | 67 kB 00:00 (104/154): ncurses-base-6.4-4.20230520.fc39.noa 810 kB/s | 86 kB 00:00 (105/154): ocaml-srpm-macros-7-3.fc38.noarch.rp 70 kB/s | 13 kB 00:00 (106/154): openblas-srpm-macros-2-13.fc38.noarc 96 kB/s | 7.5 kB 00:00 (107/154): mpfr-4.1.1-3.fc38.x86_64.rpm 1.4 MB/s | 600 kB 00:00 (108/154): ncurses-libs-6.4-4.20230520.fc39.x86 895 kB/s | 336 kB 00:00 (109/154): openldap-2.6.4-2.fc39.x86_64.rpm 1.3 MB/s | 255 kB 00:00 (110/154): p11-kit-trust-0.24.1-6.fc38.x86_64.r 961 kB/s | 136 kB 00:00 (111/154): package-notes-srpm-macros-0.5-8.fc39 135 kB/s | 11 kB 00:00 (112/154): p11-kit-0.24.1-6.fc38.x86_64.rpm 961 kB/s | 359 kB 00:00 (113/154): pam-libs-1.5.3-1.fc39.x86_64.rpm 481 kB/s | 57 kB 00:00 (114/154): patch-2.7.6-21.fc39.x86_64.rpm 733 kB/s | 126 kB 00:00 (115/154): pam-1.5.3-1.fc39.x86_64.rpm 1.6 MB/s | 547 kB 00:00 (116/154): openssl-libs-3.0.8-2.fc39.x86_64.rpm 2.6 MB/s | 2.1 MB 00:00 (117/154): pcre2-syntax-10.42-1.fc38.1.noarch.r 1.0 MB/s | 144 kB 00:00 (118/154): perl-srpm-macros-1-48.fc38.noarch.rp 113 kB/s | 8.4 kB 00:00 (119/154): pcre2-10.42-1.fc38.1.x86_64.rpm 992 kB/s | 234 kB 00:00 (120/154): pkgconf-1.9.4-2.fc39.x86_64.rpm 442 kB/s | 42 kB 00:00 (121/154): pkgconf-m4-1.9.4-2.fc39.noarch.rpm 173 kB/s | 14 kB 00:00 (122/154): pkgconf-pkg-config-1.9.4-2.fc39.x86_ 122 kB/s | 9.5 kB 00:00 (123/154): popt-1.19-2.fc38.x86_64.rpm 630 kB/s | 67 kB 00:00 (124/154): publicsuffix-list-dafsa-20230614-1.f 655 kB/s | 57 kB 00:00 (125/154): pyproject-srpm-macros-1.9.0-1.fc39.n 177 kB/s | 15 kB 00:00 (126/154): python-srpm-macros-3.11-10.fc39.noar 273 kB/s | 26 kB 00:00 (127/154): qt5-srpm-macros-5.15.10-1.fc39.noarc 99 kB/s | 7.8 kB 00:00 (128/154): qt6-srpm-macros-6.5.1-1.fc39.noarch. 117 kB/s | 9.2 kB 00:00 (129/154): redhat-rpm-config-255-1.fc39.noarch. 488 kB/s | 83 kB 00:00 (130/154): readline-8.2-3.fc38.x86_64.rpm 1.1 MB/s | 212 kB 00:00 (131/154): rpm-build-4.18.91-1.fc39.x86_64.rpm 861 kB/s | 77 kB 00:00 (132/154): rpm-build-libs-4.18.91-1.fc39.x86_64 747 kB/s | 95 kB 00:00 (133/154): rpm-libs-4.18.91-1.fc39.x86_64.rpm 1.7 MB/s | 308 kB 00:00 (134/154): rpm-4.18.91-1.fc39.x86_64.rpm 1.3 MB/s | 528 kB 00:00 (135/154): rpmautospec-rpm-macros-0.3.5-2.fc39. 104 kB/s | 8.9 kB 00:00 (136/154): rust-srpm-macros-24-2.fc39.noarch.rp 138 kB/s | 12 kB 00:00 (137/154): sed-4.8-12.fc38.x86_64.rpm 2.2 MB/s | 306 kB 00:00 (138/154): setup-2.14.3-3.fc39.noarch.rpm 905 kB/s | 152 kB 00:00 (139/154): rpm-sequoia-1.4.0-3.fc39.x86_64.rpm 1.8 MB/s | 848 kB 00:00 (140/154): shadow-utils-4.13-7.fc39.x86_64.rpm 3.3 MB/s | 1.3 MB 00:00 (141/154): systemd-libs-253.5-6.fc39.x86_64.rpm 1.9 MB/s | 652 kB 00:00 (142/154): sqlite-libs-3.41.2-3.fc39.x86_64.rpm 1.5 MB/s | 669 kB 00:00 (143/154): tar-1.34-8.fc39.x86_64.rpm 3.3 MB/s | 888 kB 00:00 (144/154): unzip-6.0-60.fc38.x86_64.rpm 1.1 MB/s | 184 kB 00:00 (145/154): tzdata-2023c-1.fc39.noarch.rpm 2.0 MB/s | 718 kB 00:00 (146/154): which-2.21-39.fc39.x86_64.rpm 456 kB/s | 42 kB 00:00 (147/154): util-linux-2.39-4.fc39.x86_64.rpm 4.1 MB/s | 1.2 MB 00:00 (148/154): util-linux-core-2.39-4.fc39.x86_64.r 1.7 MB/s | 492 kB 00:00 (149/154): xxhash-libs-0.8.1-5.fc39.x86_64.rpm 437 kB/s | 40 kB 00:00 (150/154): xz-libs-5.4.3-1.fc39.x86_64.rpm 1.2 MB/s | 108 kB 00:00 (151/154): zlib-1.2.13-3.fc38.x86_64.rpm 1.1 MB/s | 95 kB 00:00 (152/154): zip-3.0-36.fc38.x86_64.rpm 1.5 MB/s | 265 kB 00:00 (153/154): xz-5.4.3-1.fc39.x86_64.rpm 2.1 MB/s | 555 kB 00:00 (154/154): zstd-1.5.5-1.fc39.x86_64.rpm 3.2 MB/s | 482 kB 00:00 -------------------------------------------------------------------------------- Total 5.6 MB/s | 53 MB 00:09 fedora 1.6 MB/s | 1.6 kB 00:00 Importing GPG key 0x18B8E74C: Userid : "Fedora (39) " Fingerprint: E8F2 3996 F232 1864 0CB4 4CBE 75CF 5AC4 18B8 E74C From : /usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-39-primary Key imported successfully fedora 1.6 MB/s | 1.6 kB 00:00 GPG key at file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-39-primary (0x18B8E74C) is already installed fedora 1.6 MB/s | 1.6 kB 00:00 Importing GPG key 0xEB10B464: Userid : "Fedora (38) " Fingerprint: 6A51 BBAB BA3D 5467 B617 1221 809A 8D7C EB10 B464 From : /usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-38-primary Key imported successfully Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Running scriptlet: filesystem-3.18-4.fc39.x86_64 1/1 Preparing : 1/1 Installing : libgcc-13.1.1-4.fc39.x86_64 1/154 Running scriptlet: libgcc-13.1.1-4.fc39.x86_64 1/154 Installing : crypto-policies-20230614-1.git5f3458e.fc39.noarc 2/154 Running scriptlet: crypto-policies-20230614-1.git5f3458e.fc39.noarc 2/154 Installing : tzdata-2023c-1.fc39.noarch 3/154 Installing : fedora-release-identity-basic-39-0.14.noarch 4/154 Installing : rust-srpm-macros-24-2.fc39.noarch 5/154 Installing : qt6-srpm-macros-6.5.1-1.fc39.noarch 6/154 Installing : qt5-srpm-macros-5.15.10-1.fc39.noarch 7/154 Installing : pyproject-srpm-macros-1.9.0-1.fc39.noarch 8/154 Installing : publicsuffix-list-dafsa-20230614-1.fc39.noarch 9/154 Installing : pkgconf-m4-1.9.4-2.fc39.noarch 10/154 Installing : perl-srpm-macros-1-48.fc38.noarch 11/154 Installing : pcre2-syntax-10.42-1.fc38.1.noarch 12/154 Installing : package-notes-srpm-macros-0.5-8.fc39.noarch 13/154 Installing : openblas-srpm-macros-2-13.fc38.noarch 14/154 Installing : ocaml-srpm-macros-7-3.fc38.noarch 15/154 Installing : ncurses-base-6.4-4.20230520.fc39.noarch 16/154 Installing : libssh-config-0.10.5-1.fc39.noarch 17/154 Installing : kernel-srpm-macros-1.0-19.fc39.noarch 18/154 Installing : gnat-srpm-macros-6-2.fc38.noarch 19/154 Installing : ghc-srpm-macros-1.6.1-1.fc38.noarch 20/154 Installing : fpc-srpm-macros-1.3-7.fc38.noarch 21/154 Installing : fedora-gpg-keys-39-0.1.noarch 22/154 Installing : fedora-release-39-0.14.noarch 23/154 Installing : fedora-release-common-39-0.14.noarch 24/154 Installing : fedora-repos-rawhide-39-0.1.noarch 25/154 Installing : fedora-repos-39-0.1.noarch 26/154 Installing : setup-2.14.3-3.fc39.noarch 27/154 warning: /etc/hosts created as /etc/hosts.rpmnew Running scriptlet: setup-2.14.3-3.fc39.noarch 27/154 Installing : filesystem-3.18-4.fc39.x86_64 28/154 Installing : basesystem-11-17.fc39.noarch 29/154 Installing : glibc-gconv-extra-2.37.9000-14.fc39.x86_64 30/154 Running scriptlet: glibc-gconv-extra-2.37.9000-14.fc39.x86_64 30/154 Installing : glibc-minimal-langpack-2.37.9000-14.fc39.x86_64 31/154 Installing : glibc-common-2.37.9000-14.fc39.x86_64 32/154 Running scriptlet: glibc-2.37.9000-14.fc39.x86_64 33/154 Installing : glibc-2.37.9000-14.fc39.x86_64 33/154 Running scriptlet: glibc-2.37.9000-14.fc39.x86_64 33/154 Installing : ncurses-libs-6.4-4.20230520.fc39.x86_64 34/154 Installing : bash-5.2.15-3.fc38.x86_64 35/154 Running scriptlet: bash-5.2.15-3.fc38.x86_64 35/154 Installing : zlib-1.2.13-3.fc38.x86_64 36/154 Installing : xz-libs-5.4.3-1.fc39.x86_64 37/154 Installing : bzip2-libs-1.0.8-13.fc38.x86_64 38/154 Installing : libzstd-1.5.5-1.fc39.x86_64 39/154 Installing : elfutils-libelf-0.189-2.fc39.x86_64 40/154 Installing : libstdc++-13.1.1-4.fc39.x86_64 41/154 Installing : libuuid-2.39-4.fc39.x86_64 42/154 Installing : popt-1.19-2.fc38.x86_64 43/154 Installing : libblkid-2.39-4.fc39.x86_64 44/154 Installing : readline-8.2-3.fc38.x86_64 45/154 Installing : gmp-1:6.2.1-4.fc38.x86_64 46/154 Installing : libattr-2.5.1-7.fc39.x86_64 47/154 Installing : libacl-2.3.1-7.fc39.x86_64 48/154 Installing : libcap-2.48-6.fc38.x86_64 49/154 Installing : libxcrypt-4.4.35-1.fc39.x86_64 50/154 Installing : lz4-libs-1.9.4-3.fc39.x86_64 51/154 Installing : systemd-libs-253.5-6.fc39.x86_64 52/154 Installing : mpfr-4.1.1-3.fc38.x86_64 53/154 Installing : dwz-0.15-2.fc38.x86_64 54/154 Installing : unzip-6.0-60.fc38.x86_64 55/154 Installing : file-libs-5.44-3.fc39.x86_64 56/154 Installing : file-5.44-3.fc39.x86_64 57/154 Installing : alternatives-1.24-1.fc39.x86_64 58/154 Installing : jansson-2.13.1-6.fc38.x86_64 59/154 Installing : libcap-ng-0.8.3-5.fc38.x86_64 60/154 Installing : audit-libs-3.1.1-1.fc39.x86_64 61/154 Installing : pam-libs-1.5.3-1.fc39.x86_64 62/154 Installing : libcom_err-1.47.0-1.fc39.x86_64 63/154 Installing : libsepol-3.5-1.fc39.x86_64 64/154 Installing : libsmartcols-2.39-4.fc39.x86_64 65/154 Installing : lua-libs-5.4.4-9.fc39.x86_64 66/154 Installing : pcre2-10.42-1.fc38.1.x86_64 67/154 Installing : libselinux-3.5-1.fc39.x86_64 68/154 Installing : sed-4.8-12.fc38.x86_64 69/154 Installing : grep-3.11-1.fc39.x86_64 70/154 Installing : findutils-1:4.9.0-4.fc39.x86_64 71/154 Installing : xz-5.4.3-1.fc39.x86_64 72/154 Installing : libmount-2.39-4.fc39.x86_64 73/154 Installing : util-linux-core-2.39-4.fc39.x86_64 74/154 Installing : libsemanage-3.5-2.fc39.x86_64 75/154 Installing : tar-2:1.34-8.fc39.x86_64 76/154 Installing : zip-3.0-36.fc38.x86_64 77/154 Installing : zstd-1.5.5-1.fc39.x86_64 78/154 Installing : libfdisk-2.39-4.fc39.x86_64 79/154 Installing : bzip2-1.0.8-13.fc38.x86_64 80/154 Installing : libxml2-2.10.4-1.fc39.x86_64 81/154 Installing : sqlite-libs-3.41.2-3.fc39.x86_64 82/154 Installing : ed-1.19-2.fc38.x86_64 83/154 Installing : patch-2.7.6-21.fc39.x86_64 84/154 Installing : elfutils-default-yama-scope-0.189-2.fc39.noarch 85/154 Running scriptlet: elfutils-default-yama-scope-0.189-2.fc39.noarch 85/154 Installing : cpio-2.14-2.fc39.x86_64 86/154 Installing : diffutils-3.9-4.fc39.x86_64 87/154 Installing : gdbm-libs-1:1.23-3.fc38.x86_64 88/154 Installing : cyrus-sasl-lib-2.1.28-10.fc39.x86_64 89/154 Installing : keyutils-libs-1.6.1-6.fc38.x86_64 90/154 Installing : libbrotli-1.0.9-11.fc38.x86_64 91/154 Installing : libdb-5.3.28-55.fc38.x86_64 92/154 Installing : libeconf-0.4.0-5.fc38.x86_64 93/154 Installing : shadow-utils-2:4.13-7.fc39.x86_64 94/154 Running scriptlet: libutempter-1.2.1-9.fc39.x86_64 95/154 Installing : libutempter-1.2.1-9.fc39.x86_64 95/154 Installing : libffi-3.4.4-2.fc38.x86_64 96/154 Installing : p11-kit-0.24.1-6.fc38.x86_64 97/154 Installing : libgomp-13.1.1-4.fc39.x86_64 98/154 Installing : libnghttp2-1.54.0-1.fc39.x86_64 99/154 Installing : libpkgconf-1.9.4-2.fc39.x86_64 100/154 Installing : pkgconf-1.9.4-2.fc39.x86_64 101/154 Installing : pkgconf-pkg-config-1.9.4-2.fc39.x86_64 102/154 Installing : libsigsegv-2.14-4.fc38.x86_64 103/154 Installing : gawk-5.2.2-1.fc39.x86_64 104/154 Installing : libtasn1-4.19.0-2.fc38.x86_64 105/154 Installing : p11-kit-trust-0.24.1-6.fc38.x86_64 106/154 Running scriptlet: p11-kit-trust-0.24.1-6.fc38.x86_64 106/154 Installing : libunistring-1.1-3.fc38.x86_64 107/154 Installing : libunistring1.0-1.0-1.fc38.x86_64 108/154 Installing : libidn2-2.3.4-2.fc38.x86_64 109/154 Installing : libpsl-0.21.2-3.fc39.x86_64 110/154 Installing : libverto-0.3.2-5.fc38.x86_64 111/154 Installing : xxhash-libs-0.8.1-5.fc39.x86_64 112/154 Installing : coreutils-common-9.3-1.fc39.x86_64 113/154 Installing : openssl-libs-1:3.0.8-2.fc39.x86_64 114/154 Installing : coreutils-9.3-1.fc39.x86_64 115/154 Running scriptlet: ca-certificates-2023.2.60-2.fc38.noarch 116/154 Installing : ca-certificates-2023.2.60-2.fc38.noarch 116/154 Running scriptlet: ca-certificates-2023.2.60-2.fc38.noarch 116/154 Installing : krb5-libs-1.21-1.fc39.x86_64 117/154 Installing : libtirpc-1.3.3-1.rc1.fc39.x86_64 118/154 Running scriptlet: authselect-libs-1.4.2-2.fc38.x86_64 119/154 Installing : authselect-libs-1.4.2-2.fc38.x86_64 119/154 Installing : gzip-1.12-3.fc38.x86_64 120/154 Installing : cracklib-2.9.7-31.fc38.x86_64 121/154 Installing : libpwquality-1.4.5-3.fc38.x86_64 122/154 Installing : authselect-1.4.2-2.fc38.x86_64 123/154 Installing : libnsl2-2.0.0-5.fc38.x86_64 124/154 Installing : pam-1.5.3-1.fc39.x86_64 125/154 Installing : libssh-0.10.5-1.fc39.x86_64 126/154 Installing : libarchive-3.6.1-5.fc39.x86_64 127/154 Installing : libevent-2.1.12-8.fc38.x86_64 128/154 Installing : openldap-2.6.4-2.fc39.x86_64 129/154 Installing : libcurl-8.1.2-1.fc39.x86_64 130/154 Installing : elfutils-libs-0.189-2.fc39.x86_64 131/154 Installing : elfutils-debuginfod-client-0.189-2.fc39.x86_64 132/154 Installing : binutils-gold-2.40-9.fc39.x86_64 133/154 Installing : binutils-2.40-9.fc39.x86_64 134/154 Running scriptlet: binutils-2.40-9.fc39.x86_64 134/154 Installing : elfutils-0.189-2.fc39.x86_64 135/154 Installing : gdb-minimal-13.1-5.fc39.x86_64 136/154 Installing : debugedit-5.0-7.fc38.x86_64 137/154 Installing : curl-8.1.2-1.fc39.x86_64 138/154 Installing : rpm-sequoia-1.4.0-3.fc39.x86_64 139/154 Installing : rpm-libs-4.18.91-1.fc39.x86_64 140/154 Running scriptlet: rpm-4.18.91-1.fc39.x86_64 141/154 Installing : rpm-4.18.91-1.fc39.x86_64 141/154 Installing : efi-srpm-macros-5-8.fc39.noarch 142/154 Installing : lua-srpm-macros-1-8.fc38.noarch 143/154 Installing : rpmautospec-rpm-macros-0.3.5-2.fc39.noarch 144/154 Installing : rpm-build-libs-4.18.91-1.fc39.x86_64 145/154 Installing : ansible-srpm-macros-1-10.fc39.noarch 146/154 Installing : fonts-srpm-macros-1:2.0.5-11.fc38.noarch 147/154 Installing : go-srpm-macros-3.2.0-3.fc39.noarch 148/154 Installing : python-srpm-macros-3.11-10.fc39.noarch 149/154 Installing : redhat-rpm-config-255-1.fc39.noarch 150/154 Installing : rpm-build-4.18.91-1.fc39.x86_64 151/154 Installing : util-linux-2.39-4.fc39.x86_64 152/154 Installing : which-2.21-39.fc39.x86_64 153/154 Installing : info-7.0.3-2.fc39.x86_64 154/154 Running scriptlet: filesystem-3.18-4.fc39.x86_64 154/154 Running scriptlet: ca-certificates-2023.2.60-2.fc38.noarch 154/154 Running scriptlet: authselect-libs-1.4.2-2.fc38.x86_64 154/154 Running scriptlet: rpm-4.18.91-1.fc39.x86_64 154/154 Running scriptlet: info-7.0.3-2.fc39.x86_64 154/154 Verifying : alternatives-1.24-1.fc39.x86_64 1/154 Verifying : ansible-srpm-macros-1-10.fc39.noarch 2/154 Verifying : audit-libs-3.1.1-1.fc39.x86_64 3/154 Verifying : authselect-1.4.2-2.fc38.x86_64 4/154 Verifying : authselect-libs-1.4.2-2.fc38.x86_64 5/154 Verifying : basesystem-11-17.fc39.noarch 6/154 Verifying : bash-5.2.15-3.fc38.x86_64 7/154 Verifying : binutils-2.40-9.fc39.x86_64 8/154 Verifying : binutils-gold-2.40-9.fc39.x86_64 9/154 Verifying : bzip2-1.0.8-13.fc38.x86_64 10/154 Verifying : bzip2-libs-1.0.8-13.fc38.x86_64 11/154 Verifying : ca-certificates-2023.2.60-2.fc38.noarch 12/154 Verifying : coreutils-9.3-1.fc39.x86_64 13/154 Verifying : coreutils-common-9.3-1.fc39.x86_64 14/154 Verifying : cpio-2.14-2.fc39.x86_64 15/154 Verifying : cracklib-2.9.7-31.fc38.x86_64 16/154 Verifying : crypto-policies-20230614-1.git5f3458e.fc39.noarc 17/154 Verifying : curl-8.1.2-1.fc39.x86_64 18/154 Verifying : cyrus-sasl-lib-2.1.28-10.fc39.x86_64 19/154 Verifying : debugedit-5.0-7.fc38.x86_64 20/154 Verifying : diffutils-3.9-4.fc39.x86_64 21/154 Verifying : dwz-0.15-2.fc38.x86_64 22/154 Verifying : ed-1.19-2.fc38.x86_64 23/154 Verifying : efi-srpm-macros-5-8.fc39.noarch 24/154 Verifying : elfutils-0.189-2.fc39.x86_64 25/154 Verifying : elfutils-debuginfod-client-0.189-2.fc39.x86_64 26/154 Verifying : elfutils-default-yama-scope-0.189-2.fc39.noarch 27/154 Verifying : elfutils-libelf-0.189-2.fc39.x86_64 28/154 Verifying : elfutils-libs-0.189-2.fc39.x86_64 29/154 Verifying : fedora-gpg-keys-39-0.1.noarch 30/154 Verifying : fedora-release-39-0.14.noarch 31/154 Verifying : fedora-release-common-39-0.14.noarch 32/154 Verifying : fedora-release-identity-basic-39-0.14.noarch 33/154 Verifying : fedora-repos-39-0.1.noarch 34/154 Verifying : fedora-repos-rawhide-39-0.1.noarch 35/154 Verifying : file-5.44-3.fc39.x86_64 36/154 Verifying : file-libs-5.44-3.fc39.x86_64 37/154 Verifying : filesystem-3.18-4.fc39.x86_64 38/154 Verifying : findutils-1:4.9.0-4.fc39.x86_64 39/154 Verifying : fonts-srpm-macros-1:2.0.5-11.fc38.noarch 40/154 Verifying : fpc-srpm-macros-1.3-7.fc38.noarch 41/154 Verifying : gawk-5.2.2-1.fc39.x86_64 42/154 Verifying : gdb-minimal-13.1-5.fc39.x86_64 43/154 Verifying : gdbm-libs-1:1.23-3.fc38.x86_64 44/154 Verifying : ghc-srpm-macros-1.6.1-1.fc38.noarch 45/154 Verifying : glibc-2.37.9000-14.fc39.x86_64 46/154 Verifying : glibc-common-2.37.9000-14.fc39.x86_64 47/154 Verifying : glibc-gconv-extra-2.37.9000-14.fc39.x86_64 48/154 Verifying : glibc-minimal-langpack-2.37.9000-14.fc39.x86_64 49/154 Verifying : gmp-1:6.2.1-4.fc38.x86_64 50/154 Verifying : gnat-srpm-macros-6-2.fc38.noarch 51/154 Verifying : go-srpm-macros-3.2.0-3.fc39.noarch 52/154 Verifying : grep-3.11-1.fc39.x86_64 53/154 Verifying : gzip-1.12-3.fc38.x86_64 54/154 Verifying : info-7.0.3-2.fc39.x86_64 55/154 Verifying : jansson-2.13.1-6.fc38.x86_64 56/154 Verifying : kernel-srpm-macros-1.0-19.fc39.noarch 57/154 Verifying : keyutils-libs-1.6.1-6.fc38.x86_64 58/154 Verifying : krb5-libs-1.21-1.fc39.x86_64 59/154 Verifying : libacl-2.3.1-7.fc39.x86_64 60/154 Verifying : libarchive-3.6.1-5.fc39.x86_64 61/154 Verifying : libattr-2.5.1-7.fc39.x86_64 62/154 Verifying : libblkid-2.39-4.fc39.x86_64 63/154 Verifying : libbrotli-1.0.9-11.fc38.x86_64 64/154 Verifying : libcap-2.48-6.fc38.x86_64 65/154 Verifying : libcap-ng-0.8.3-5.fc38.x86_64 66/154 Verifying : libcom_err-1.47.0-1.fc39.x86_64 67/154 Verifying : libcurl-8.1.2-1.fc39.x86_64 68/154 Verifying : libdb-5.3.28-55.fc38.x86_64 69/154 Verifying : libeconf-0.4.0-5.fc38.x86_64 70/154 Verifying : libevent-2.1.12-8.fc38.x86_64 71/154 Verifying : libfdisk-2.39-4.fc39.x86_64 72/154 Verifying : libffi-3.4.4-2.fc38.x86_64 73/154 Verifying : libgcc-13.1.1-4.fc39.x86_64 74/154 Verifying : libgomp-13.1.1-4.fc39.x86_64 75/154 Verifying : libidn2-2.3.4-2.fc38.x86_64 76/154 Verifying : libmount-2.39-4.fc39.x86_64 77/154 Verifying : libnghttp2-1.54.0-1.fc39.x86_64 78/154 Verifying : libnsl2-2.0.0-5.fc38.x86_64 79/154 Verifying : libpkgconf-1.9.4-2.fc39.x86_64 80/154 Verifying : libpsl-0.21.2-3.fc39.x86_64 81/154 Verifying : libpwquality-1.4.5-3.fc38.x86_64 82/154 Verifying : libselinux-3.5-1.fc39.x86_64 83/154 Verifying : libsemanage-3.5-2.fc39.x86_64 84/154 Verifying : libsepol-3.5-1.fc39.x86_64 85/154 Verifying : libsigsegv-2.14-4.fc38.x86_64 86/154 Verifying : libsmartcols-2.39-4.fc39.x86_64 87/154 Verifying : libssh-0.10.5-1.fc39.x86_64 88/154 Verifying : libssh-config-0.10.5-1.fc39.noarch 89/154 Verifying : libstdc++-13.1.1-4.fc39.x86_64 90/154 Verifying : libtasn1-4.19.0-2.fc38.x86_64 91/154 Verifying : libtirpc-1.3.3-1.rc1.fc39.x86_64 92/154 Verifying : libunistring-1.1-3.fc38.x86_64 93/154 Verifying : libunistring1.0-1.0-1.fc38.x86_64 94/154 Verifying : libutempter-1.2.1-9.fc39.x86_64 95/154 Verifying : libuuid-2.39-4.fc39.x86_64 96/154 Verifying : libverto-0.3.2-5.fc38.x86_64 97/154 Verifying : libxcrypt-4.4.35-1.fc39.x86_64 98/154 Verifying : libxml2-2.10.4-1.fc39.x86_64 99/154 Verifying : libzstd-1.5.5-1.fc39.x86_64 100/154 Verifying : lua-libs-5.4.4-9.fc39.x86_64 101/154 Verifying : lua-srpm-macros-1-8.fc38.noarch 102/154 Verifying : lz4-libs-1.9.4-3.fc39.x86_64 103/154 Verifying : mpfr-4.1.1-3.fc38.x86_64 104/154 Verifying : ncurses-base-6.4-4.20230520.fc39.noarch 105/154 Verifying : ncurses-libs-6.4-4.20230520.fc39.x86_64 106/154 Verifying : ocaml-srpm-macros-7-3.fc38.noarch 107/154 Verifying : openblas-srpm-macros-2-13.fc38.noarch 108/154 Verifying : openldap-2.6.4-2.fc39.x86_64 109/154 Verifying : openssl-libs-1:3.0.8-2.fc39.x86_64 110/154 Verifying : p11-kit-0.24.1-6.fc38.x86_64 111/154 Verifying : p11-kit-trust-0.24.1-6.fc38.x86_64 112/154 Verifying : package-notes-srpm-macros-0.5-8.fc39.noarch 113/154 Verifying : pam-1.5.3-1.fc39.x86_64 114/154 Verifying : pam-libs-1.5.3-1.fc39.x86_64 115/154 Verifying : patch-2.7.6-21.fc39.x86_64 116/154 Verifying : pcre2-10.42-1.fc38.1.x86_64 117/154 Verifying : pcre2-syntax-10.42-1.fc38.1.noarch 118/154 Verifying : perl-srpm-macros-1-48.fc38.noarch 119/154 Verifying : pkgconf-1.9.4-2.fc39.x86_64 120/154 Verifying : pkgconf-m4-1.9.4-2.fc39.noarch 121/154 Verifying : pkgconf-pkg-config-1.9.4-2.fc39.x86_64 122/154 Verifying : popt-1.19-2.fc38.x86_64 123/154 Verifying : publicsuffix-list-dafsa-20230614-1.fc39.noarch 124/154 Verifying : pyproject-srpm-macros-1.9.0-1.fc39.noarch 125/154 Verifying : python-srpm-macros-3.11-10.fc39.noarch 126/154 Verifying : qt5-srpm-macros-5.15.10-1.fc39.noarch 127/154 Verifying : qt6-srpm-macros-6.5.1-1.fc39.noarch 128/154 Verifying : readline-8.2-3.fc38.x86_64 129/154 Verifying : redhat-rpm-config-255-1.fc39.noarch 130/154 Verifying : rpm-4.18.91-1.fc39.x86_64 131/154 Verifying : rpm-build-4.18.91-1.fc39.x86_64 132/154 Verifying : rpm-build-libs-4.18.91-1.fc39.x86_64 133/154 Verifying : rpm-libs-4.18.91-1.fc39.x86_64 134/154 Verifying : rpm-sequoia-1.4.0-3.fc39.x86_64 135/154 Verifying : rpmautospec-rpm-macros-0.3.5-2.fc39.noarch 136/154 Verifying : rust-srpm-macros-24-2.fc39.noarch 137/154 Verifying : sed-4.8-12.fc38.x86_64 138/154 Verifying : setup-2.14.3-3.fc39.noarch 139/154 Verifying : shadow-utils-2:4.13-7.fc39.x86_64 140/154 Verifying : sqlite-libs-3.41.2-3.fc39.x86_64 141/154 Verifying : systemd-libs-253.5-6.fc39.x86_64 142/154 Verifying : tar-2:1.34-8.fc39.x86_64 143/154 Verifying : tzdata-2023c-1.fc39.noarch 144/154 Verifying : unzip-6.0-60.fc38.x86_64 145/154 Verifying : util-linux-2.39-4.fc39.x86_64 146/154 Verifying : util-linux-core-2.39-4.fc39.x86_64 147/154 Verifying : which-2.21-39.fc39.x86_64 148/154 Verifying : xxhash-libs-0.8.1-5.fc39.x86_64 149/154 Verifying : xz-5.4.3-1.fc39.x86_64 150/154 Verifying : xz-libs-5.4.3-1.fc39.x86_64 151/154 Verifying : zip-3.0-36.fc38.x86_64 152/154 Verifying : zlib-1.2.13-3.fc38.x86_64 153/154 Verifying : zstd-1.5.5-1.fc39.x86_64 154/154 Installed: alternatives-1.24-1.fc39.x86_64 ansible-srpm-macros-1-10.fc39.noarch audit-libs-3.1.1-1.fc39.x86_64 authselect-1.4.2-2.fc38.x86_64 authselect-libs-1.4.2-2.fc38.x86_64 basesystem-11-17.fc39.noarch bash-5.2.15-3.fc38.x86_64 binutils-2.40-9.fc39.x86_64 binutils-gold-2.40-9.fc39.x86_64 bzip2-1.0.8-13.fc38.x86_64 bzip2-libs-1.0.8-13.fc38.x86_64 ca-certificates-2023.2.60-2.fc38.noarch coreutils-9.3-1.fc39.x86_64 coreutils-common-9.3-1.fc39.x86_64 cpio-2.14-2.fc39.x86_64 cracklib-2.9.7-31.fc38.x86_64 crypto-policies-20230614-1.git5f3458e.fc39.noarch curl-8.1.2-1.fc39.x86_64 cyrus-sasl-lib-2.1.28-10.fc39.x86_64 debugedit-5.0-7.fc38.x86_64 diffutils-3.9-4.fc39.x86_64 dwz-0.15-2.fc38.x86_64 ed-1.19-2.fc38.x86_64 efi-srpm-macros-5-8.fc39.noarch elfutils-0.189-2.fc39.x86_64 elfutils-debuginfod-client-0.189-2.fc39.x86_64 elfutils-default-yama-scope-0.189-2.fc39.noarch elfutils-libelf-0.189-2.fc39.x86_64 elfutils-libs-0.189-2.fc39.x86_64 fedora-gpg-keys-39-0.1.noarch fedora-release-39-0.14.noarch fedora-release-common-39-0.14.noarch fedora-release-identity-basic-39-0.14.noarch fedora-repos-39-0.1.noarch fedora-repos-rawhide-39-0.1.noarch file-5.44-3.fc39.x86_64 file-libs-5.44-3.fc39.x86_64 filesystem-3.18-4.fc39.x86_64 findutils-1:4.9.0-4.fc39.x86_64 fonts-srpm-macros-1:2.0.5-11.fc38.noarch fpc-srpm-macros-1.3-7.fc38.noarch gawk-5.2.2-1.fc39.x86_64 gdb-minimal-13.1-5.fc39.x86_64 gdbm-libs-1:1.23-3.fc38.x86_64 ghc-srpm-macros-1.6.1-1.fc38.noarch glibc-2.37.9000-14.fc39.x86_64 glibc-common-2.37.9000-14.fc39.x86_64 glibc-gconv-extra-2.37.9000-14.fc39.x86_64 glibc-minimal-langpack-2.37.9000-14.fc39.x86_64 gmp-1:6.2.1-4.fc38.x86_64 gnat-srpm-macros-6-2.fc38.noarch go-srpm-macros-3.2.0-3.fc39.noarch grep-3.11-1.fc39.x86_64 gzip-1.12-3.fc38.x86_64 info-7.0.3-2.fc39.x86_64 jansson-2.13.1-6.fc38.x86_64 kernel-srpm-macros-1.0-19.fc39.noarch keyutils-libs-1.6.1-6.fc38.x86_64 krb5-libs-1.21-1.fc39.x86_64 libacl-2.3.1-7.fc39.x86_64 libarchive-3.6.1-5.fc39.x86_64 libattr-2.5.1-7.fc39.x86_64 libblkid-2.39-4.fc39.x86_64 libbrotli-1.0.9-11.fc38.x86_64 libcap-2.48-6.fc38.x86_64 libcap-ng-0.8.3-5.fc38.x86_64 libcom_err-1.47.0-1.fc39.x86_64 libcurl-8.1.2-1.fc39.x86_64 libdb-5.3.28-55.fc38.x86_64 libeconf-0.4.0-5.fc38.x86_64 libevent-2.1.12-8.fc38.x86_64 libfdisk-2.39-4.fc39.x86_64 libffi-3.4.4-2.fc38.x86_64 libgcc-13.1.1-4.fc39.x86_64 libgomp-13.1.1-4.fc39.x86_64 libidn2-2.3.4-2.fc38.x86_64 libmount-2.39-4.fc39.x86_64 libnghttp2-1.54.0-1.fc39.x86_64 libnsl2-2.0.0-5.fc38.x86_64 libpkgconf-1.9.4-2.fc39.x86_64 libpsl-0.21.2-3.fc39.x86_64 libpwquality-1.4.5-3.fc38.x86_64 libselinux-3.5-1.fc39.x86_64 libsemanage-3.5-2.fc39.x86_64 libsepol-3.5-1.fc39.x86_64 libsigsegv-2.14-4.fc38.x86_64 libsmartcols-2.39-4.fc39.x86_64 libssh-0.10.5-1.fc39.x86_64 libssh-config-0.10.5-1.fc39.noarch libstdc++-13.1.1-4.fc39.x86_64 libtasn1-4.19.0-2.fc38.x86_64 libtirpc-1.3.3-1.rc1.fc39.x86_64 libunistring-1.1-3.fc38.x86_64 libunistring1.0-1.0-1.fc38.x86_64 libutempter-1.2.1-9.fc39.x86_64 libuuid-2.39-4.fc39.x86_64 libverto-0.3.2-5.fc38.x86_64 libxcrypt-4.4.35-1.fc39.x86_64 libxml2-2.10.4-1.fc39.x86_64 libzstd-1.5.5-1.fc39.x86_64 lua-libs-5.4.4-9.fc39.x86_64 lua-srpm-macros-1-8.fc38.noarch lz4-libs-1.9.4-3.fc39.x86_64 mpfr-4.1.1-3.fc38.x86_64 ncurses-base-6.4-4.20230520.fc39.noarch ncurses-libs-6.4-4.20230520.fc39.x86_64 ocaml-srpm-macros-7-3.fc38.noarch openblas-srpm-macros-2-13.fc38.noarch openldap-2.6.4-2.fc39.x86_64 openssl-libs-1:3.0.8-2.fc39.x86_64 p11-kit-0.24.1-6.fc38.x86_64 p11-kit-trust-0.24.1-6.fc38.x86_64 package-notes-srpm-macros-0.5-8.fc39.noarch pam-1.5.3-1.fc39.x86_64 pam-libs-1.5.3-1.fc39.x86_64 patch-2.7.6-21.fc39.x86_64 pcre2-10.42-1.fc38.1.x86_64 pcre2-syntax-10.42-1.fc38.1.noarch perl-srpm-macros-1-48.fc38.noarch pkgconf-1.9.4-2.fc39.x86_64 pkgconf-m4-1.9.4-2.fc39.noarch pkgconf-pkg-config-1.9.4-2.fc39.x86_64 popt-1.19-2.fc38.x86_64 publicsuffix-list-dafsa-20230614-1.fc39.noarch pyproject-srpm-macros-1.9.0-1.fc39.noarch python-srpm-macros-3.11-10.fc39.noarch qt5-srpm-macros-5.15.10-1.fc39.noarch qt6-srpm-macros-6.5.1-1.fc39.noarch readline-8.2-3.fc38.x86_64 redhat-rpm-config-255-1.fc39.noarch rpm-4.18.91-1.fc39.x86_64 rpm-build-4.18.91-1.fc39.x86_64 rpm-build-libs-4.18.91-1.fc39.x86_64 rpm-libs-4.18.91-1.fc39.x86_64 rpm-sequoia-1.4.0-3.fc39.x86_64 rpmautospec-rpm-macros-0.3.5-2.fc39.noarch rust-srpm-macros-24-2.fc39.noarch sed-4.8-12.fc38.x86_64 setup-2.14.3-3.fc39.noarch shadow-utils-2:4.13-7.fc39.x86_64 sqlite-libs-3.41.2-3.fc39.x86_64 systemd-libs-253.5-6.fc39.x86_64 tar-2:1.34-8.fc39.x86_64 tzdata-2023c-1.fc39.noarch unzip-6.0-60.fc38.x86_64 util-linux-2.39-4.fc39.x86_64 util-linux-core-2.39-4.fc39.x86_64 which-2.21-39.fc39.x86_64 xxhash-libs-0.8.1-5.fc39.x86_64 xz-5.4.3-1.fc39.x86_64 xz-libs-5.4.3-1.fc39.x86_64 zip-3.0-36.fc38.x86_64 zlib-1.2.13-3.fc38.x86_64 zstd-1.5.5-1.fc39.x86_64 Complete! Finish: installing minimal buildroot with dnf Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: package-notes-srpm-macros-0.5-8.fc39.noarch setup-2.14.3-3.fc39.noarch glibc-2.37.9000-14.fc39.x86_64 gmp-6.2.1-4.fc38.x86_64 ed-1.19-2.fc38.x86_64 coreutils-9.3-1.fc39.x86_64 binutils-2.40-9.fc39.x86_64 publicsuffix-list-dafsa-20230614-1.fc39.noarch lz4-libs-1.9.4-3.fc39.x86_64 findutils-4.9.0-4.fc39.x86_64 libunistring1.0-1.0-1.fc38.x86_64 tzdata-2023c-1.fc39.noarch glibc-minimal-langpack-2.37.9000-14.fc39.x86_64 sqlite-libs-3.41.2-3.fc39.x86_64 libcap-ng-0.8.3-5.fc38.x86_64 zip-3.0-36.fc38.x86_64 libcap-2.48-6.fc38.x86_64 gawk-5.2.2-1.fc39.x86_64 libselinux-3.5-1.fc39.x86_64 libsmartcols-2.39-4.fc39.x86_64 tar-1.34-8.fc39.x86_64 libverto-0.3.2-5.fc38.x86_64 libevent-2.1.12-8.fc38.x86_64 rpm-sequoia-1.4.0-3.fc39.x86_64 lua-libs-5.4.4-9.fc39.x86_64 libmount-2.39-4.fc39.x86_64 gzip-1.12-3.fc38.x86_64 ncurses-base-6.4-4.20230520.fc39.noarch perl-srpm-macros-1-48.fc38.noarch rpm-build-4.18.91-1.fc39.x86_64 fonts-srpm-macros-2.0.5-11.fc38.noarch authselect-1.4.2-2.fc38.x86_64 ncurses-libs-6.4-4.20230520.fc39.x86_64 zlib-1.2.13-3.fc38.x86_64 sed-4.8-12.fc38.x86_64 qt5-srpm-macros-5.15.10-1.fc39.noarch glibc-common-2.37.9000-14.fc39.x86_64 rpm-libs-4.18.91-1.fc39.x86_64 diffutils-3.9-4.fc39.x86_64 libstdc++-13.1.1-4.fc39.x86_64 go-srpm-macros-3.2.0-3.fc39.noarch libssh-0.10.5-1.fc39.x86_64 openssl-libs-3.0.8-2.fc39.x86_64 info-7.0.3-2.fc39.x86_64 alternatives-1.24-1.fc39.x86_64 libgcc-13.1.1-4.fc39.x86_64 ghc-srpm-macros-1.6.1-1.fc38.noarch pam-libs-1.5.3-1.fc39.x86_64 util-linux-core-2.39-4.fc39.x86_64 rpm-4.18.91-1.fc39.x86_64 libacl-2.3.1-7.fc39.x86_64 openblas-srpm-macros-2-13.fc38.noarch pam-1.5.3-1.fc39.x86_64 p11-kit-0.24.1-6.fc38.x86_64 file-libs-5.44-3.fc39.x86_64 elfutils-libs-0.189-2.fc39.x86_64 libfdisk-2.39-4.fc39.x86_64 cyrus-sasl-lib-2.1.28-10.fc39.x86_64 libgomp-13.1.1-4.fc39.x86_64 fpc-srpm-macros-1.3-7.fc38.noarch libblkid-2.39-4.fc39.x86_64 libsemanage-3.5-2.fc39.x86_64 libnsl2-2.0.0-5.fc38.x86_64 libattr-2.5.1-7.fc39.x86_64 which-2.21-39.fc39.x86_64 glibc-gconv-extra-2.37.9000-14.fc39.x86_64 python-srpm-macros-3.11-10.fc39.noarch fedora-release-identity-basic-39-0.14.noarch redhat-rpm-config-255-1.fc39.noarch libcom_err-1.47.0-1.fc39.x86_64 pyproject-srpm-macros-1.9.0-1.fc39.noarch rpm-build-libs-4.18.91-1.fc39.x86_64 libtirpc-1.3.3-1.rc1.fc39.x86_64 authselect-libs-1.4.2-2.fc38.x86_64 libpsl-0.21.2-3.fc39.x86_64 fedora-release-39-0.14.noarch efi-srpm-macros-5-8.fc39.noarch kernel-srpm-macros-1.0-19.fc39.noarch filesystem-3.18-4.fc39.x86_64 keyutils-libs-1.6.1-6.fc38.x86_64 libpkgconf-1.9.4-2.fc39.x86_64 libuuid-2.39-4.fc39.x86_64 libeconf-0.4.0-5.fc38.x86_64 elfutils-libelf-0.189-2.fc39.x86_64 readline-8.2-3.fc38.x86_64 ca-certificates-2023.2.60-2.fc38.noarch systemd-libs-253.5-6.fc39.x86_64 patch-2.7.6-21.fc39.x86_64 debugedit-5.0-7.fc38.x86_64 libcurl-8.1.2-1.fc39.x86_64 cpio-2.14-2.fc39.x86_64 xz-5.4.3-1.fc39.x86_64 libidn2-2.3.4-2.fc38.x86_64 libpwquality-1.4.5-3.fc38.x86_64 fedora-gpg-keys-39-0.1.noarch elfutils-0.189-2.fc39.x86_64 ocaml-srpm-macros-7-3.fc38.noarch libsigsegv-2.14-4.fc38.x86_64 fedora-release-common-39-0.14.noarch bash-5.2.15-3.fc38.x86_64 lua-srpm-macros-1-8.fc38.noarch rust-srpm-macros-24-2.fc39.noarch xxhash-libs-0.8.1-5.fc39.x86_64 ansible-srpm-macros-1-10.fc39.noarch xz-libs-5.4.3-1.fc39.x86_64 libzstd-1.5.5-1.fc39.x86_64 zstd-1.5.5-1.fc39.x86_64 pcre2-syntax-10.42-1.fc38.1.noarch elfutils-default-yama-scope-0.189-2.fc39.noarch bzip2-1.0.8-13.fc38.x86_64 pkgconf-pkg-config-1.9.4-2.fc39.x86_64 file-5.44-3.fc39.x86_64 popt-1.19-2.fc38.x86_64 elfutils-debuginfod-client-0.189-2.fc39.x86_64 basesystem-11-17.fc39.noarch unzip-6.0-60.fc38.x86_64 mpfr-4.1.1-3.fc38.x86_64 binutils-gold-2.40-9.fc39.x86_64 pcre2-10.42-1.fc38.1.x86_64 libarchive-3.6.1-5.fc39.x86_64 libbrotli-1.0.9-11.fc38.x86_64 libsepol-3.5-1.fc39.x86_64 krb5-libs-1.21-1.fc39.x86_64 cracklib-2.9.7-31.fc38.x86_64 crypto-policies-20230614-1.git5f3458e.fc39.noarch grep-3.11-1.fc39.x86_64 pkgconf-m4-1.9.4-2.fc39.noarch openldap-2.6.4-2.fc39.x86_64 gdbm-libs-1.23-3.fc38.x86_64 libtasn1-4.19.0-2.fc38.x86_64 fedora-repos-39-0.1.noarch libssh-config-0.10.5-1.fc39.noarch gdb-minimal-13.1-5.fc39.x86_64 libxcrypt-4.4.35-1.fc39.x86_64 dwz-0.15-2.fc38.x86_64 libdb-5.3.28-55.fc38.x86_64 gnat-srpm-macros-6-2.fc38.noarch shadow-utils-4.13-7.fc39.x86_64 jansson-2.13.1-6.fc38.x86_64 util-linux-2.39-4.fc39.x86_64 curl-8.1.2-1.fc39.x86_64 fedora-repos-rawhide-39-0.1.noarch qt6-srpm-macros-6.5.1-1.fc39.noarch libnghttp2-1.54.0-1.fc39.x86_64 p11-kit-trust-0.24.1-6.fc38.x86_64 bzip2-libs-1.0.8-13.fc38.x86_64 coreutils-common-9.3-1.fc39.x86_64 rpmautospec-rpm-macros-0.3.5-2.fc39.noarch gpg-pubkey-18b8e74c-62f2920f libutempter-1.2.1-9.fc39.x86_64 pkgconf-1.9.4-2.fc39.x86_64 gpg-pubkey-eb10b464-6202d9c6 libxml2-2.10.4-1.fc39.x86_64 libunistring-1.1-3.fc38.x86_64 libffi-3.4.4-2.fc38.x86_64 audit-libs-3.1.1-1.fc39.x86_64 Start: buildsrpm Start: rpmbuild -bs Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1676592000 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-1.fc39.src.rpm Finish: rpmbuild -bs INFO: chroot_scan: 3 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-x86_64-1687861990.181316/root/var/log/dnf.rpm.log /var/lib/mock/fedora-rawhide-x86_64-1687861990.181316/root/var/log/dnf.librepo.log /var/lib/mock/fedora-rawhide-x86_64-1687861990.181316/root/var/log/dnf.log Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-a7pz026v/bowtie/bowtie.spec) Config(child) 1 minutes 23 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running (timeout=115200): unbuffer mock --rebuild /var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.fc39.src.rpm --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1687861990.181316 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 4.1 starting (python version = 3.11.3, NVR = mock-4.1-1.fc38)... Start(bootstrap): init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish(bootstrap): init plugins Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.fc39.src.rpm) Config(fedora-rawhide-x86_64) Start: clean chroot Finish: clean chroot Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1687861990.181316/root. INFO: reusing tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1687861990.181316/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata INFO: enabled HW Info plugin Mock Version: 4.1 INFO: Mock Version: 4.1 INFO: Package manager dnf detected and used (fallback) Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-1687861990.181316/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin Mock Version: 4.1 INFO: Mock Version: 4.1 INFO: Package manager dnf detected and used (direct choice) Start: dnf update No matches found for the following disable plugin patterns: local, spacewalk, versionlock Copr repository 33 kB/s | 1.5 kB 00:00 fedora 519 kB/s | 23 kB 00:00 Dependencies resolved. Nothing to do. Complete! Finish: dnf update Finish: chroot init Start: build phase for bowtie-1.3.1-1.fc39.src.rpm Start: build setup for bowtie-1.3.1-1.fc39.src.rpm Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1676592000 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-1.fc39.src.rpm No matches found for the following disable plugin patterns: local, spacewalk, versionlock Copr repository 26 kB/s | 1.5 kB 00:00 fedora 560 kB/s | 23 kB 00:00 Dependencies resolved. ================================================================================ Package Arch Version Repository Size ================================================================================ Installing: gcc-c++ x86_64 13.1.1-4.fc39 fedora 13 M hostname x86_64 3.23-8.fc38 fedora 27 k make x86_64 1:4.4.1-1.fc39 fedora 589 k perl-Clone x86_64 0.46-2.fc38 fedora 22 k perl-Data-Dumper x86_64 2.188-1.fc39 fedora 56 k perl-FindBin noarch 1.53-497.fc39 fedora 15 k perl-Getopt-Long noarch 1:2.54-2.fc38 fedora 60 k perl-Test-Deep noarch 1.204-2.fc38 fedora 120 k perl-interpreter x86_64 4:5.36.1-497.fc39 fedora 73 k perl-lib x86_64 0.65-497.fc39 fedora 16 k python3 x86_64 3.11.4-1.fc39 fedora 28 k tbb-devel x86_64 2021.9.0-1.fc39 copr_base 213 k zlib-devel x86_64 1.2.13-3.fc38 fedora 45 k Installing dependencies: annobin-docs noarch 12.12-1.fc39 fedora 95 k annobin-plugin-gcc x86_64 12.12-1.fc39 fedora 894 k cmake-filesystem x86_64 3.27.0~rc3-1.fc39 fedora 18 k cpp x86_64 13.1.1-4.fc39 fedora 11 M expat x86_64 2.5.0-2.fc38 fedora 110 k gc x86_64 8.2.2-3.fc38 fedora 110 k gcc x86_64 13.1.1-4.fc39 fedora 34 M gcc-plugin-annobin x86_64 13.1.1-4.fc39 fedora 45 k glibc-devel x86_64 2.37.9000-14.fc39 fedora 74 k glibc-headers-x86 noarch 2.37.9000-14.fc39 fedora 556 k groff-base x86_64 1.22.4-11.fc38 fedora 1.1 M guile22 x86_64 2.2.7-8.fc39 fedora 6.5 M hwloc-libs x86_64 2.9.0-6.fc39 fedora 2.2 M kernel-headers x86_64 6.4.0-0.rc7.git0.1.fc39 fedora 1.5 M libb2 x86_64 0.98.1-8.fc38 fedora 25 k libmpc x86_64 1.3.1-2.fc38 fedora 70 k libstdc++-devel x86_64 13.1.1-4.fc39 fedora 2.6 M libtool-ltdl x86_64 2.4.7-6.fc38 fedora 37 k libxcrypt-devel x86_64 4.4.35-1.fc39 fedora 30 k mpdecimal x86_64 2.5.1-6.fc38 fedora 89 k ncurses x86_64 6.4-4.20230520.fc39 fedora 415 k perl-AutoLoader noarch 5.74-497.fc39 fedora 22 k perl-B x86_64 1.83-497.fc39 fedora 182 k perl-Carp noarch 1.54-1.fc39 fedora 29 k perl-Class-Struct noarch 0.66-497.fc39 fedora 23 k perl-DynaLoader x86_64 1.52-497.fc39 fedora 27 k perl-Encode x86_64 4:3.19-493.fc38 fedora 1.7 M perl-Errno x86_64 1.36-497.fc39 fedora 16 k perl-Exporter noarch 5.77-490.fc38 fedora 31 k perl-Fcntl x86_64 1.15-497.fc39 fedora 22 k perl-File-Basename noarch 2.85-497.fc39 fedora 18 k perl-File-Path noarch 2.18-490.fc38 fedora 35 k perl-File-Temp noarch 1:0.231.100-490.fc38 fedora 59 k perl-File-stat noarch 1.12-497.fc39 fedora 18 k perl-Getopt-Std noarch 1.13-497.fc39 fedora 17 k perl-HTTP-Tiny noarch 0.084-1.fc39 fedora 55 k perl-IO x86_64 1.50-497.fc39 fedora 93 k perl-IPC-Open3 noarch 1.22-497.fc39 fedora 24 k perl-Importer noarch 0.026-9.fc38 fedora 39 k perl-JSON-PP noarch 1:4.16-2.fc38 fedora 67 k perl-MIME-Base64 x86_64 3.16-490.fc38 fedora 30 k perl-Math-BigInt noarch 1:1.9998.38-1.fc39 fedora 204 k perl-Math-BigRat noarch 0.2624-3.fc38 fedora 41 k perl-Math-Complex noarch 1.59-497.fc39 fedora 48 k perl-Object-HashBase noarch 0.009-12.fc38 fedora 25 k perl-POSIX x86_64 2.03-497.fc39 fedora 99 k perl-PathTools x86_64 3.89-1.fc39 fedora 87 k perl-Pod-Escapes noarch 1:1.07-490.fc38 fedora 20 k perl-Pod-Perldoc noarch 3.28.01-491.fc38 fedora 86 k perl-Pod-Simple noarch 1:3.45-2.fc39 fedora 219 k perl-Pod-Usage noarch 4:2.03-4.fc38 fedora 40 k perl-Scalar-List-Utils x86_64 5:1.63-491.fc39 fedora 72 k perl-SelectSaver noarch 1.02-497.fc39 fedora 13 k perl-Socket x86_64 4:2.037-1.fc39 fedora 55 k perl-Storable x86_64 1:3.32-1.fc39 fedora 98 k perl-Symbol noarch 1.09-497.fc39 fedora 15 k perl-Term-ANSIColor noarch 5.01-491.fc38 fedora 47 k perl-Term-Cap noarch 1.18-1.fc39 fedora 22 k perl-Term-Table noarch 0.016-6.fc38 fedora 34 k perl-Test-Simple noarch 3:1.302195-2.fc39 fedora 575 k perl-Text-ParseWords noarch 3.31-490.fc38 fedora 16 k perl-Text-Tabs+Wrap noarch 2023.0511-1.fc39 fedora 22 k perl-Time-HiRes x86_64 4:1.9775-1.fc39 fedora 57 k perl-Time-Local noarch 2:1.350-1.fc39 fedora 34 k perl-base noarch 2.27-497.fc39 fedora 17 k perl-constant noarch 1.33-492.fc39 fedora 23 k perl-if noarch 0.61.000-497.fc39 fedora 15 k perl-libs x86_64 4:5.36.1-497.fc39 fedora 2.2 M perl-locale noarch 1.10-497.fc39 fedora 15 k perl-mro x86_64 1.26-497.fc39 fedora 30 k perl-overload noarch 1.35-497.fc39 fedora 47 k perl-overloading noarch 0.02-497.fc39 fedora 14 k perl-parent noarch 1:0.241-1.fc39 fedora 14 k perl-podlators noarch 1:5.01-2.fc38 fedora 125 k perl-vars noarch 1.05-497.fc39 fedora 14 k python-pip-wheel noarch 23.1.2-1.fc39 fedora 1.4 M python-setuptools-wheel noarch 67.7.2-2.fc39 fedora 661 k python3-libs x86_64 3.11.4-1.fc39 fedora 9.6 M tbb x86_64 2021.9.0-1.fc39 copr_base 159 k tbb-bind x86_64 2021.9.0-1.fc39 copr_base 18 k Transaction Summary ================================================================================ Install 93 Packages Total download size: 94 M Installed size: 309 M Downloading Packages: (1/93): tbb-bind-2021.9.0-1.fc39.x86_64.rpm 280 kB/s | 18 kB 00:00 (2/93): tbb-devel-2021.9.0-1.fc39.x86_64.rpm 2.4 MB/s | 213 kB 00:00 (3/93): tbb-2021.9.0-1.fc39.x86_64.rpm 1.0 MB/s | 159 kB 00:00 (4/93): cmake-filesystem-3.27.0~rc3-1.fc39.x86_ 82 kB/s | 18 kB 00:00 (5/93): annobin-docs-12.12-1.fc39.noarch.rpm 182 kB/s | 95 kB 00:00 (6/93): annobin-plugin-gcc-12.12-1.fc39.x86_64. 1.6 MB/s | 894 kB 00:00 (7/93): expat-2.5.0-2.fc38.x86_64.rpm 1.2 MB/s | 110 kB 00:00 (8/93): gc-8.2.2-3.fc38.x86_64.rpm 1.9 MB/s | 110 kB 00:00 (9/93): cpp-13.1.1-4.fc39.x86_64.rpm 12 MB/s | 11 MB 00:00 (10/93): gcc-c++-13.1.1-4.fc39.x86_64.rpm 16 MB/s | 13 MB 00:00 (11/93): gcc-plugin-annobin-13.1.1-4.fc39.x86_6 202 kB/s | 45 kB 00:00 (12/93): glibc-devel-2.37.9000-14.fc39.x86_64.r 1.3 MB/s | 74 kB 00:00 (13/93): glibc-headers-x86-2.37.9000-14.fc39.no 7.4 MB/s | 556 kB 00:00 (14/93): groff-base-1.22.4-11.fc38.x86_64.rpm 8.7 MB/s | 1.1 MB 00:00 (15/93): hostname-3.23-8.fc38.x86_64.rpm 454 kB/s | 27 kB 00:00 (16/93): guile22-2.2.7-8.fc39.x86_64.rpm 21 MB/s | 6.5 MB 00:00 (17/93): hwloc-libs-2.9.0-6.fc39.x86_64.rpm 12 MB/s | 2.2 MB 00:00 (18/93): libb2-0.98.1-8.fc38.x86_64.rpm 495 kB/s | 25 kB 00:00 (19/93): libmpc-1.3.1-2.fc38.x86_64.rpm 1.1 MB/s | 70 kB 00:00 (20/93): kernel-headers-6.4.0-0.rc7.git0.1.fc39 8.2 MB/s | 1.5 MB 00:00 (21/93): libtool-ltdl-2.4.7-6.fc38.x86_64.rpm 685 kB/s | 37 kB 00:00 (22/93): libstdc++-devel-13.1.1-4.fc39.x86_64.r 18 MB/s | 2.6 MB 00:00 (23/93): libxcrypt-devel-4.4.35-1.fc39.x86_64.r 570 kB/s | 30 kB 00:00 (24/93): make-4.4.1-1.fc39.x86_64.rpm 7.9 MB/s | 589 kB 00:00 (25/93): mpdecimal-2.5.1-6.fc38.x86_64.rpm 1.6 MB/s | 89 kB 00:00 (26/93): gcc-13.1.1-4.fc39.x86_64.rpm 21 MB/s | 34 MB 00:01 (27/93): ncurses-6.4-4.20230520.fc39.x86_64.rpm 4.6 MB/s | 415 kB 00:00 (28/93): perl-AutoLoader-5.74-497.fc39.noarch.r 290 kB/s | 22 kB 00:00 (29/93): perl-Class-Struct-0.66-497.fc39.noarch 453 kB/s | 23 kB 00:00 (30/93): perl-Carp-1.54-1.fc39.noarch.rpm 544 kB/s | 29 kB 00:00 (31/93): perl-B-1.83-497.fc39.x86_64.rpm 3.2 MB/s | 182 kB 00:00 (32/93): perl-Clone-0.46-2.fc38.x86_64.rpm 424 kB/s | 22 kB 00:00 (33/93): perl-DynaLoader-1.52-497.fc39.x86_64.r 529 kB/s | 27 kB 00:00 (34/93): perl-Data-Dumper-2.188-1.fc39.x86_64.r 1.0 MB/s | 56 kB 00:00 (35/93): perl-Errno-1.36-497.fc39.x86_64.rpm 310 kB/s | 16 kB 00:00 (36/93): perl-Exporter-5.77-490.fc38.noarch.rpm 582 kB/s | 31 kB 00:00 (37/93): perl-Fcntl-1.15-497.fc39.x86_64.rpm 418 kB/s | 22 kB 00:00 (38/93): perl-File-Basename-2.85-497.fc39.noarc 357 kB/s | 18 kB 00:00 (39/93): perl-Encode-3.19-493.fc38.x86_64.rpm 15 MB/s | 1.7 MB 00:00 (40/93): perl-File-Path-2.18-490.fc38.noarch.rp 672 kB/s | 35 kB 00:00 (41/93): perl-File-Temp-0.231.100-490.fc38.noar 1.1 MB/s | 59 kB 00:00 (42/93): perl-File-stat-1.12-497.fc39.noarch.rp 352 kB/s | 18 kB 00:00 (43/93): perl-FindBin-1.53-497.fc39.noarch.rpm 296 kB/s | 15 kB 00:00 (44/93): perl-Getopt-Std-1.13-497.fc39.noarch.r 328 kB/s | 17 kB 00:00 (45/93): perl-Getopt-Long-2.54-2.fc38.noarch.rp 1.1 MB/s | 60 kB 00:00 (46/93): perl-HTTP-Tiny-0.084-1.fc39.noarch.rpm 1.0 MB/s | 55 kB 00:00 (47/93): perl-IPC-Open3-1.22-497.fc39.noarch.rp 460 kB/s | 24 kB 00:00 (48/93): perl-IO-1.50-497.fc39.x86_64.rpm 1.7 MB/s | 93 kB 00:00 (49/93): perl-Importer-0.026-9.fc38.noarch.rpm 746 kB/s | 39 kB 00:00 (50/93): perl-MIME-Base64-3.16-490.fc38.x86_64. 572 kB/s | 30 kB 00:00 (51/93): perl-JSON-PP-4.16-2.fc38.noarch.rpm 1.2 MB/s | 67 kB 00:00 (52/93): perl-Math-BigRat-0.2624-3.fc38.noarch. 760 kB/s | 41 kB 00:00 (53/93): perl-Math-BigInt-1.9998.38-1.fc39.noar 3.3 MB/s | 204 kB 00:00 (54/93): perl-Math-Complex-1.59-497.fc39.noarch 880 kB/s | 48 kB 00:00 (55/93): perl-Object-HashBase-0.009-12.fc38.noa 489 kB/s | 25 kB 00:00 (56/93): perl-PathTools-3.89-1.fc39.x86_64.rpm 1.6 MB/s | 87 kB 00:00 (57/93): perl-POSIX-2.03-497.fc39.x86_64.rpm 1.7 MB/s | 99 kB 00:00 (58/93): perl-Pod-Escapes-1.07-490.fc38.noarch. 378 kB/s | 20 kB 00:00 (59/93): perl-Pod-Perldoc-3.28.01-491.fc38.noar 1.5 MB/s | 86 kB 00:00 (60/93): perl-Pod-Simple-3.45-2.fc39.noarch.rpm 3.4 MB/s | 219 kB 00:00 (61/93): perl-Pod-Usage-2.03-4.fc38.noarch.rpm 768 kB/s | 40 kB 00:00 (62/93): perl-Scalar-List-Utils-1.63-491.fc39.x 1.3 MB/s | 72 kB 00:00 (63/93): perl-SelectSaver-1.02-497.fc39.noarch. 252 kB/s | 13 kB 00:00 (64/93): perl-Socket-2.037-1.fc39.x86_64.rpm 1.0 MB/s | 55 kB 00:00 (65/93): perl-Term-ANSIColor-5.01-491.fc38.noar 908 kB/s | 47 kB 00:00 (66/93): perl-Term-Cap-1.18-1.fc39.noarch.rpm 341 kB/s | 22 kB 00:00 (67/93): perl-Symbol-1.09-497.fc39.noarch.rpm 99 kB/s | 15 kB 00:00 (68/93): perl-Storable-3.32-1.fc39.x86_64.rpm 593 kB/s | 98 kB 00:00 (69/93): perl-Term-Table-0.016-6.fc38.noarch.rp 641 kB/s | 34 kB 00:00 (70/93): perl-Test-Deep-1.204-2.fc38.noarch.rpm 2.0 MB/s | 120 kB 00:00 (71/93): perl-Test-Simple-1.302195-2.fc39.noarc 7.6 MB/s | 575 kB 00:00 (72/93): perl-Text-ParseWords-3.31-490.fc38.noa 317 kB/s | 16 kB 00:00 (73/93): perl-Text-Tabs+Wrap-2023.0511-1.fc39.n 432 kB/s | 22 kB 00:00 (74/93): perl-Time-HiRes-1.9775-1.fc39.x86_64.r 1.0 MB/s | 57 kB 00:00 (75/93): perl-Time-Local-1.350-1.fc39.noarch.rp 661 kB/s | 34 kB 00:00 (76/93): perl-base-2.27-497.fc39.noarch.rpm 339 kB/s | 17 kB 00:00 (77/93): perl-constant-1.33-492.fc39.noarch.rpm 436 kB/s | 23 kB 00:00 (78/93): perl-if-0.61.000-497.fc39.noarch.rpm 291 kB/s | 15 kB 00:00 (79/93): perl-interpreter-5.36.1-497.fc39.x86_6 1.3 MB/s | 73 kB 00:00 (80/93): perl-lib-0.65-497.fc39.x86_64.rpm 312 kB/s | 16 kB 00:00 (81/93): perl-locale-1.10-497.fc39.noarch.rpm 283 kB/s | 15 kB 00:00 (82/93): perl-mro-1.26-497.fc39.x86_64.rpm 509 kB/s | 30 kB 00:00 (83/93): perl-overloading-0.02-497.fc39.noarch. 231 kB/s | 14 kB 00:00 (84/93): perl-parent-0.241-1.fc39.noarch.rpm 281 kB/s | 14 kB 00:00 (85/93): perl-libs-5.36.1-497.fc39.x86_64.rpm 11 MB/s | 2.2 MB 00:00 (86/93): perl-podlators-5.01-2.fc38.noarch.rpm 2.1 MB/s | 125 kB 00:00 (87/93): perl-vars-1.05-497.fc39.noarch.rpm 251 kB/s | 14 kB 00:00 (88/93): python-pip-wheel-23.1.2-1.fc39.noarch. 7.3 MB/s | 1.4 MB 00:00 (89/93): python-setuptools-wheel-67.7.2-2.fc39. 3.4 MB/s | 661 kB 00:00 (90/93): python3-3.11.4-1.fc39.x86_64.rpm 499 kB/s | 28 kB 00:00 (91/93): perl-overload-1.35-497.fc39.noarch.rpm 103 kB/s | 47 kB 00:00 (92/93): zlib-devel-1.2.13-3.fc38.x86_64.rpm 818 kB/s | 45 kB 00:00 (93/93): python3-libs-3.11.4-1.fc39.x86_64.rpm 23 MB/s | 9.6 MB 00:00 -------------------------------------------------------------------------------- Total 22 MB/s | 94 MB 00:04 Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Preparing : 1/1 Installing : libmpc-1.3.1-2.fc38.x86_64 1/93 Installing : tbb-2021.9.0-1.fc39.x86_64 2/93 Installing : cpp-13.1.1-4.fc39.x86_64 3/93 Installing : python-setuptools-wheel-67.7.2-2.fc39.noarch 4/93 Installing : python-pip-wheel-23.1.2-1.fc39.noarch 5/93 Installing : ncurses-6.4-4.20230520.fc39.x86_64 6/93 Installing : mpdecimal-2.5.1-6.fc38.x86_64 7/93 Installing : libtool-ltdl-2.4.7-6.fc38.x86_64 8/93 Installing : libstdc++-devel-13.1.1-4.fc39.x86_64 9/93 Installing : libb2-0.98.1-8.fc38.x86_64 10/93 Installing : kernel-headers-6.4.0-0.rc7.git0.1.fc39.x86_64 11/93 Installing : hwloc-libs-2.9.0-6.fc39.x86_64 12/93 Installing : tbb-bind-2021.9.0-1.fc39.x86_64 13/93 Running scriptlet: groff-base-1.22.4-11.fc38.x86_64 14/93 Installing : groff-base-1.22.4-11.fc38.x86_64 14/93 Running scriptlet: groff-base-1.22.4-11.fc38.x86_64 14/93 Installing : perl-Text-Tabs+Wrap-2023.0511-1.fc39.noarch 15/93 Installing : perl-if-0.61.000-497.fc39.noarch 16/93 Installing : perl-locale-1.10-497.fc39.noarch 17/93 Installing : perl-Time-Local-2:1.350-1.fc39.noarch 18/93 Installing : perl-File-Path-2.18-490.fc38.noarch 19/93 Installing : perl-Pod-Escapes-1:1.07-490.fc38.noarch 20/93 Installing : perl-Class-Struct-0.66-497.fc39.noarch 21/93 Installing : perl-Term-ANSIColor-5.01-491.fc38.noarch 22/93 Installing : perl-POSIX-2.03-497.fc39.x86_64 23/93 Installing : perl-IPC-Open3-1.22-497.fc39.noarch 24/93 Installing : perl-HTTP-Tiny-0.084-1.fc39.noarch 25/93 Installing : perl-File-Temp-1:0.231.100-490.fc38.noarch 26/93 Installing : perl-Term-Cap-1.18-1.fc39.noarch 27/93 Installing : perl-Pod-Simple-1:3.45-2.fc39.noarch 28/93 Installing : perl-Socket-4:2.037-1.fc39.x86_64 29/93 Installing : perl-SelectSaver-1.02-497.fc39.noarch 30/93 Installing : perl-Symbol-1.09-497.fc39.noarch 31/93 Installing : perl-File-stat-1.12-497.fc39.noarch 32/93 Installing : perl-podlators-1:5.01-2.fc38.noarch 33/93 Installing : perl-Pod-Perldoc-3.28.01-491.fc38.noarch 34/93 Installing : perl-Fcntl-1.15-497.fc39.x86_64 35/93 Installing : perl-Text-ParseWords-3.31-490.fc38.noarch 36/93 Installing : perl-mro-1.26-497.fc39.x86_64 37/93 Installing : perl-IO-1.50-497.fc39.x86_64 38/93 Installing : perl-overloading-0.02-497.fc39.noarch 39/93 Installing : perl-Pod-Usage-4:2.03-4.fc38.noarch 40/93 Installing : perl-Errno-1.36-497.fc39.x86_64 41/93 Installing : perl-File-Basename-2.85-497.fc39.noarch 42/93 Installing : perl-Getopt-Std-1.13-497.fc39.noarch 43/93 Installing : perl-MIME-Base64-3.16-490.fc38.x86_64 44/93 Installing : perl-Scalar-List-Utils-5:1.63-491.fc39.x86_64 45/93 Installing : perl-constant-1.33-492.fc39.noarch 46/93 Installing : perl-Storable-1:3.32-1.fc39.x86_64 47/93 Installing : perl-overload-1.35-497.fc39.noarch 48/93 Installing : perl-parent-1:0.241-1.fc39.noarch 49/93 Installing : perl-vars-1.05-497.fc39.noarch 50/93 Installing : perl-Getopt-Long-1:2.54-2.fc38.noarch 51/93 Installing : perl-Carp-1.54-1.fc39.noarch 52/93 Installing : perl-Exporter-5.77-490.fc38.noarch 53/93 Installing : perl-PathTools-3.89-1.fc39.x86_64 54/93 Installing : perl-DynaLoader-1.52-497.fc39.x86_64 55/93 Installing : perl-Encode-4:3.19-493.fc38.x86_64 56/93 Installing : perl-libs-4:5.36.1-497.fc39.x86_64 57/93 Installing : perl-interpreter-4:5.36.1-497.fc39.x86_64 58/93 Installing : perl-Math-Complex-1.59-497.fc39.noarch 59/93 Installing : perl-Math-BigInt-1:1.9998.38-1.fc39.noarch 60/93 Installing : perl-Math-BigRat-0.2624-3.fc38.noarch 61/93 Installing : perl-base-2.27-497.fc39.noarch 62/93 Installing : perl-AutoLoader-5.74-497.fc39.noarch 63/93 Installing : perl-Data-Dumper-2.188-1.fc39.x86_64 64/93 Installing : perl-B-1.83-497.fc39.x86_64 65/93 Installing : perl-JSON-PP-1:4.16-2.fc38.noarch 66/93 Installing : perl-Importer-0.026-9.fc38.noarch 67/93 Installing : perl-Object-HashBase-0.009-12.fc38.noarch 68/93 Installing : perl-Term-Table-0.016-6.fc38.noarch 69/93 Installing : perl-Time-HiRes-4:1.9775-1.fc39.x86_64 70/93 Installing : perl-Test-Simple-3:1.302195-2.fc39.noarch 71/93 Installing : glibc-headers-x86-2.37.9000-14.fc39.noarch 72/93 Installing : libxcrypt-devel-4.4.35-1.fc39.x86_64 73/93 Installing : glibc-devel-2.37.9000-14.fc39.x86_64 74/93 Installing : gc-8.2.2-3.fc38.x86_64 75/93 Installing : guile22-2.2.7-8.fc39.x86_64 76/93 Installing : make-1:4.4.1-1.fc39.x86_64 77/93 Installing : gcc-13.1.1-4.fc39.x86_64 78/93 Running scriptlet: gcc-13.1.1-4.fc39.x86_64 78/93 Installing : expat-2.5.0-2.fc38.x86_64 79/93 Installing : python3-3.11.4-1.fc39.x86_64 80/93 Installing : python3-libs-3.11.4-1.fc39.x86_64 81/93 Installing : cmake-filesystem-3.27.0~rc3-1.fc39.x86_64 82/93 Installing : annobin-docs-12.12-1.fc39.noarch 83/93 Installing : annobin-plugin-gcc-12.12-1.fc39.x86_64 84/93 Running scriptlet: annobin-plugin-gcc-12.12-1.fc39.x86_64 84/93 Installing : tbb-devel-2021.9.0-1.fc39.x86_64 85/93 Installing : gcc-c++-13.1.1-4.fc39.x86_64 86/93 Installing : gcc-plugin-annobin-13.1.1-4.fc39.x86_64 87/93 Running scriptlet: gcc-plugin-annobin-13.1.1-4.fc39.x86_64 87/93 Installing : perl-Test-Deep-1.204-2.fc38.noarch 88/93 Installing : perl-Clone-0.46-2.fc38.x86_64 89/93 Installing : perl-FindBin-1.53-497.fc39.noarch 90/93 Installing : perl-lib-0.65-497.fc39.x86_64 91/93 Installing : zlib-devel-1.2.13-3.fc38.x86_64 92/93 Installing : hostname-3.23-8.fc38.x86_64 93/93 Running scriptlet: hostname-3.23-8.fc38.x86_64 93/93 Verifying : tbb-2021.9.0-1.fc39.x86_64 1/93 Verifying : tbb-bind-2021.9.0-1.fc39.x86_64 2/93 Verifying : tbb-devel-2021.9.0-1.fc39.x86_64 3/93 Verifying : annobin-docs-12.12-1.fc39.noarch 4/93 Verifying : annobin-plugin-gcc-12.12-1.fc39.x86_64 5/93 Verifying : cmake-filesystem-3.27.0~rc3-1.fc39.x86_64 6/93 Verifying : cpp-13.1.1-4.fc39.x86_64 7/93 Verifying : expat-2.5.0-2.fc38.x86_64 8/93 Verifying : gc-8.2.2-3.fc38.x86_64 9/93 Verifying : gcc-13.1.1-4.fc39.x86_64 10/93 Verifying : gcc-c++-13.1.1-4.fc39.x86_64 11/93 Verifying : gcc-plugin-annobin-13.1.1-4.fc39.x86_64 12/93 Verifying : glibc-devel-2.37.9000-14.fc39.x86_64 13/93 Verifying : glibc-headers-x86-2.37.9000-14.fc39.noarch 14/93 Verifying : groff-base-1.22.4-11.fc38.x86_64 15/93 Verifying : guile22-2.2.7-8.fc39.x86_64 16/93 Verifying : hostname-3.23-8.fc38.x86_64 17/93 Verifying : hwloc-libs-2.9.0-6.fc39.x86_64 18/93 Verifying : kernel-headers-6.4.0-0.rc7.git0.1.fc39.x86_64 19/93 Verifying : libb2-0.98.1-8.fc38.x86_64 20/93 Verifying : libmpc-1.3.1-2.fc38.x86_64 21/93 Verifying : libstdc++-devel-13.1.1-4.fc39.x86_64 22/93 Verifying : libtool-ltdl-2.4.7-6.fc38.x86_64 23/93 Verifying : libxcrypt-devel-4.4.35-1.fc39.x86_64 24/93 Verifying : make-1:4.4.1-1.fc39.x86_64 25/93 Verifying : mpdecimal-2.5.1-6.fc38.x86_64 26/93 Verifying : ncurses-6.4-4.20230520.fc39.x86_64 27/93 Verifying : perl-AutoLoader-5.74-497.fc39.noarch 28/93 Verifying : perl-B-1.83-497.fc39.x86_64 29/93 Verifying : perl-Carp-1.54-1.fc39.noarch 30/93 Verifying : perl-Class-Struct-0.66-497.fc39.noarch 31/93 Verifying : perl-Clone-0.46-2.fc38.x86_64 32/93 Verifying : perl-Data-Dumper-2.188-1.fc39.x86_64 33/93 Verifying : perl-DynaLoader-1.52-497.fc39.x86_64 34/93 Verifying : perl-Encode-4:3.19-493.fc38.x86_64 35/93 Verifying : perl-Errno-1.36-497.fc39.x86_64 36/93 Verifying : perl-Exporter-5.77-490.fc38.noarch 37/93 Verifying : perl-Fcntl-1.15-497.fc39.x86_64 38/93 Verifying : perl-File-Basename-2.85-497.fc39.noarch 39/93 Verifying : perl-File-Path-2.18-490.fc38.noarch 40/93 Verifying : perl-File-Temp-1:0.231.100-490.fc38.noarch 41/93 Verifying : perl-File-stat-1.12-497.fc39.noarch 42/93 Verifying : perl-FindBin-1.53-497.fc39.noarch 43/93 Verifying : perl-Getopt-Long-1:2.54-2.fc38.noarch 44/93 Verifying : perl-Getopt-Std-1.13-497.fc39.noarch 45/93 Verifying : perl-HTTP-Tiny-0.084-1.fc39.noarch 46/93 Verifying : perl-IO-1.50-497.fc39.x86_64 47/93 Verifying : perl-IPC-Open3-1.22-497.fc39.noarch 48/93 Verifying : perl-Importer-0.026-9.fc38.noarch 49/93 Verifying : perl-JSON-PP-1:4.16-2.fc38.noarch 50/93 Verifying : perl-MIME-Base64-3.16-490.fc38.x86_64 51/93 Verifying : perl-Math-BigInt-1:1.9998.38-1.fc39.noarch 52/93 Verifying : perl-Math-BigRat-0.2624-3.fc38.noarch 53/93 Verifying : perl-Math-Complex-1.59-497.fc39.noarch 54/93 Verifying : perl-Object-HashBase-0.009-12.fc38.noarch 55/93 Verifying : perl-POSIX-2.03-497.fc39.x86_64 56/93 Verifying : perl-PathTools-3.89-1.fc39.x86_64 57/93 Verifying : perl-Pod-Escapes-1:1.07-490.fc38.noarch 58/93 Verifying : perl-Pod-Perldoc-3.28.01-491.fc38.noarch 59/93 Verifying : perl-Pod-Simple-1:3.45-2.fc39.noarch 60/93 Verifying : perl-Pod-Usage-4:2.03-4.fc38.noarch 61/93 Verifying : perl-Scalar-List-Utils-5:1.63-491.fc39.x86_64 62/93 Verifying : perl-SelectSaver-1.02-497.fc39.noarch 63/93 Verifying : perl-Socket-4:2.037-1.fc39.x86_64 64/93 Verifying : perl-Storable-1:3.32-1.fc39.x86_64 65/93 Verifying : perl-Symbol-1.09-497.fc39.noarch 66/93 Verifying : perl-Term-ANSIColor-5.01-491.fc38.noarch 67/93 Verifying : perl-Term-Cap-1.18-1.fc39.noarch 68/93 Verifying : perl-Term-Table-0.016-6.fc38.noarch 69/93 Verifying : perl-Test-Deep-1.204-2.fc38.noarch 70/93 Verifying : perl-Test-Simple-3:1.302195-2.fc39.noarch 71/93 Verifying : perl-Text-ParseWords-3.31-490.fc38.noarch 72/93 Verifying : perl-Text-Tabs+Wrap-2023.0511-1.fc39.noarch 73/93 Verifying : perl-Time-HiRes-4:1.9775-1.fc39.x86_64 74/93 Verifying : perl-Time-Local-2:1.350-1.fc39.noarch 75/93 Verifying : perl-base-2.27-497.fc39.noarch 76/93 Verifying : perl-constant-1.33-492.fc39.noarch 77/93 Verifying : perl-if-0.61.000-497.fc39.noarch 78/93 Verifying : perl-interpreter-4:5.36.1-497.fc39.x86_64 79/93 Verifying : perl-lib-0.65-497.fc39.x86_64 80/93 Verifying : perl-libs-4:5.36.1-497.fc39.x86_64 81/93 Verifying : perl-locale-1.10-497.fc39.noarch 82/93 Verifying : perl-mro-1.26-497.fc39.x86_64 83/93 Verifying : perl-overload-1.35-497.fc39.noarch 84/93 Verifying : perl-overloading-0.02-497.fc39.noarch 85/93 Verifying : perl-parent-1:0.241-1.fc39.noarch 86/93 Verifying : perl-podlators-1:5.01-2.fc38.noarch 87/93 Verifying : perl-vars-1.05-497.fc39.noarch 88/93 Verifying : python-pip-wheel-23.1.2-1.fc39.noarch 89/93 Verifying : python-setuptools-wheel-67.7.2-2.fc39.noarch 90/93 Verifying : python3-3.11.4-1.fc39.x86_64 91/93 Verifying : python3-libs-3.11.4-1.fc39.x86_64 92/93 Verifying : zlib-devel-1.2.13-3.fc38.x86_64 93/93 Installed: annobin-docs-12.12-1.fc39.noarch annobin-plugin-gcc-12.12-1.fc39.x86_64 cmake-filesystem-3.27.0~rc3-1.fc39.x86_64 cpp-13.1.1-4.fc39.x86_64 expat-2.5.0-2.fc38.x86_64 gc-8.2.2-3.fc38.x86_64 gcc-13.1.1-4.fc39.x86_64 gcc-c++-13.1.1-4.fc39.x86_64 gcc-plugin-annobin-13.1.1-4.fc39.x86_64 glibc-devel-2.37.9000-14.fc39.x86_64 glibc-headers-x86-2.37.9000-14.fc39.noarch groff-base-1.22.4-11.fc38.x86_64 guile22-2.2.7-8.fc39.x86_64 hostname-3.23-8.fc38.x86_64 hwloc-libs-2.9.0-6.fc39.x86_64 kernel-headers-6.4.0-0.rc7.git0.1.fc39.x86_64 libb2-0.98.1-8.fc38.x86_64 libmpc-1.3.1-2.fc38.x86_64 libstdc++-devel-13.1.1-4.fc39.x86_64 libtool-ltdl-2.4.7-6.fc38.x86_64 libxcrypt-devel-4.4.35-1.fc39.x86_64 make-1:4.4.1-1.fc39.x86_64 mpdecimal-2.5.1-6.fc38.x86_64 ncurses-6.4-4.20230520.fc39.x86_64 perl-AutoLoader-5.74-497.fc39.noarch perl-B-1.83-497.fc39.x86_64 perl-Carp-1.54-1.fc39.noarch perl-Class-Struct-0.66-497.fc39.noarch perl-Clone-0.46-2.fc38.x86_64 perl-Data-Dumper-2.188-1.fc39.x86_64 perl-DynaLoader-1.52-497.fc39.x86_64 perl-Encode-4:3.19-493.fc38.x86_64 perl-Errno-1.36-497.fc39.x86_64 perl-Exporter-5.77-490.fc38.noarch perl-Fcntl-1.15-497.fc39.x86_64 perl-File-Basename-2.85-497.fc39.noarch perl-File-Path-2.18-490.fc38.noarch perl-File-Temp-1:0.231.100-490.fc38.noarch perl-File-stat-1.12-497.fc39.noarch perl-FindBin-1.53-497.fc39.noarch perl-Getopt-Long-1:2.54-2.fc38.noarch perl-Getopt-Std-1.13-497.fc39.noarch perl-HTTP-Tiny-0.084-1.fc39.noarch perl-IO-1.50-497.fc39.x86_64 perl-IPC-Open3-1.22-497.fc39.noarch perl-Importer-0.026-9.fc38.noarch perl-JSON-PP-1:4.16-2.fc38.noarch perl-MIME-Base64-3.16-490.fc38.x86_64 perl-Math-BigInt-1:1.9998.38-1.fc39.noarch perl-Math-BigRat-0.2624-3.fc38.noarch perl-Math-Complex-1.59-497.fc39.noarch perl-Object-HashBase-0.009-12.fc38.noarch perl-POSIX-2.03-497.fc39.x86_64 perl-PathTools-3.89-1.fc39.x86_64 perl-Pod-Escapes-1:1.07-490.fc38.noarch perl-Pod-Perldoc-3.28.01-491.fc38.noarch perl-Pod-Simple-1:3.45-2.fc39.noarch perl-Pod-Usage-4:2.03-4.fc38.noarch perl-Scalar-List-Utils-5:1.63-491.fc39.x86_64 perl-SelectSaver-1.02-497.fc39.noarch perl-Socket-4:2.037-1.fc39.x86_64 perl-Storable-1:3.32-1.fc39.x86_64 perl-Symbol-1.09-497.fc39.noarch perl-Term-ANSIColor-5.01-491.fc38.noarch perl-Term-Cap-1.18-1.fc39.noarch perl-Term-Table-0.016-6.fc38.noarch perl-Test-Deep-1.204-2.fc38.noarch perl-Test-Simple-3:1.302195-2.fc39.noarch perl-Text-ParseWords-3.31-490.fc38.noarch perl-Text-Tabs+Wrap-2023.0511-1.fc39.noarch perl-Time-HiRes-4:1.9775-1.fc39.x86_64 perl-Time-Local-2:1.350-1.fc39.noarch perl-base-2.27-497.fc39.noarch perl-constant-1.33-492.fc39.noarch perl-if-0.61.000-497.fc39.noarch perl-interpreter-4:5.36.1-497.fc39.x86_64 perl-lib-0.65-497.fc39.x86_64 perl-libs-4:5.36.1-497.fc39.x86_64 perl-locale-1.10-497.fc39.noarch perl-mro-1.26-497.fc39.x86_64 perl-overload-1.35-497.fc39.noarch perl-overloading-0.02-497.fc39.noarch perl-parent-1:0.241-1.fc39.noarch perl-podlators-1:5.01-2.fc38.noarch perl-vars-1.05-497.fc39.noarch python-pip-wheel-23.1.2-1.fc39.noarch python-setuptools-wheel-67.7.2-2.fc39.noarch python3-3.11.4-1.fc39.x86_64 python3-libs-3.11.4-1.fc39.x86_64 tbb-2021.9.0-1.fc39.x86_64 tbb-bind-2021.9.0-1.fc39.x86_64 tbb-devel-2021.9.0-1.fc39.x86_64 zlib-devel-1.2.13-3.fc38.x86_64 Complete! Finish: build setup for bowtie-1.3.1-1.fc39.src.rpm Start: rpmbuild bowtie-1.3.1-1.fc39.src.rpm Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1676592000 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.DVBX8Z + umask 022 + cd /builddir/build/BUILD + cd /builddir/build/BUILD + rm -rf bowtie-1.3.1-src + /usr/lib/rpm/rpmuncompress -x /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + /usr/bin/mkdir -p SPECPARTS + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-inspect + RPM_EC=0 ++ jobs -p + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.Ru3o6Y + umask 022 + cd /builddir/build/BUILD + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + /usr/bin/make -O -j2 V=1 VERBOSE=1 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: ebwt_build.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bowtie_build_main.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type 'struct string' itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: 'gEbwt_ext' was previously declared here In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'buildSamples' at blockwise_sa.h:619:17, inlined from 'build' at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function 'build': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'buildSamples' at blockwise_sa.h:619:17, inlined from 'build' at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function 'build': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'bucketSortSufDcU8' at multikey_qsort.h:1034:29, inlined from 'mkeyQSortSufDcU8.constprop.isra' at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'mkeyQSortSufDcU8.constprop.isra': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'push_back' at ds.h:496:29, inlined from 'bucketSortSufDcU8' at multikey_qsort.h:1084:23, inlined from 'mkeyQSortSufDcU8.constprop.isra' at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'mkeyQSortSufDcU8.constprop.isra': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'bucketSortSufDcU8' at multikey_qsort.h:1034:29, inlined from 'mkeyQSortSufDcU8.constprop.isra' at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'mkeyQSortSufDcU8.constprop.isra': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'push_back' at ds.h:496:29, inlined from 'bucketSortSufDcU8' at multikey_qsort.h:1084:23, inlined from 'mkeyQSortSufDcU8.constprop.isra' at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'mkeyQSortSufDcU8.constprop.isra': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: ebwt_build.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bowtie_build_main.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type 'struct string' itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: 'gEbwt_ext' was previously declared here In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'buildSamples' at blockwise_sa.h:619:17, inlined from 'build' at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function 'build': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'buildSamples' at blockwise_sa.h:619:17, inlined from 'build' at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function 'build': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: ebwt_search.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: qual.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: pat.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt_search_util.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_aligner.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: log.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: hit_set.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: sam.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: hit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bowtie_main.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type 'struct string' itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: 'gEbwt_ext' was previously declared here In member function 'alloc', inlined from 'expandNoCopyExact' at ds.h:1003:17, inlined from 'expandNoCopy' at ds.h:992:20, inlined from 'operator=' at ds.h:405:32, inlined from 'operator=' at ds.h:394:15, inlined from '__ct_base ' at pat.h:330:37: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function '__ct_base ': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from '_ZN5EListI5RangeLi128EE15expandCopyExactEm.part.0' at ds.h:967:17: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function '_ZN5EListI5RangeLi128EE15expandCopyExactEm.part.0': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from '__ct ' at pat.cpp:379:15, inlined from 'patsrcFromStrings' at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'patsrcFromStrings': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from '__ct_base .constprop' at hit.h:176:17: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function '__ct_base .constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: ebwt_search.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: qual.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: pat.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt_search_util.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_aligner.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: log.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: hit_set.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: sam.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: hit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bowtie_main.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type 'struct string' itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: 'gEbwt_ext' was previously declared here In member function 'alloc', inlined from 'expandNoCopyExact' at ds.h:1003:17, inlined from 'expandNoCopy' at ds.h:992:20, inlined from 'operator=' at ds.h:405:32, inlined from 'operator=' at ds.h:394:15, inlined from '__ct_base ' at pat.h:330:37: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function '__ct_base ': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from '_ZN5EListI5RangeLi128EE15expandCopyExactEm.part.0' at ds.h:967:17: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function '_ZN5EListI5RangeLi128EE15expandCopyExactEm.part.0': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopyExact' at ds.h:965:7, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from '__ct ' at pat.cpp:379:15, inlined from 'patsrcFromStrings' at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'patsrcFromStrings': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from '__ct_base .constprop' at hit.h:176:17: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function '__ct_base .constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: bowtie_inspect.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type 'struct string' itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: 'gEbwt_ext' was previously declared here g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: bowtie_inspect.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type 'struct string' itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: 'gEbwt_ext' was previously declared here g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: ebwt_build.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bowtie_build_main.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type 'struct string' itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: 'gEbwt_ext' was previously declared here In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'push_back' at ds.h:496:29, inlined from 'mkeyQSortSuf2.constprop' at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'mkeyQSortSuf2.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'push_back' at ds.h:496:29, inlined from 'mkeyQSortSuf2.constprop' at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'mkeyQSortSuf2.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'bucketSortSufDcU8.constprop' at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'bucketSortSufDcU8.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'push_back' at ds.h:496:29, inlined from 'bucketSortSufDcU8.constprop' at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'bucketSortSufDcU8.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'bucketSortSufDcU8.constprop' at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'bucketSortSufDcU8.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'push_back' at ds.h:496:29, inlined from 'bucketSortSufDcU8.constprop' at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'bucketSortSufDcU8.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: ebwt_build.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bowtie_build_main.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type 'struct string' itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: 'gEbwt_ext' was previously declared here In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'bucketSortSufDcU8.constprop' at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'bucketSortSufDcU8.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'push_back' at ds.h:496:29, inlined from 'bucketSortSufDcU8.constprop' at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'bucketSortSufDcU8.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'bucketSortSufDcU8.constprop' at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'bucketSortSufDcU8.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'push_back' at ds.h:496:29, inlined from 'bucketSortSufDcU8.constprop' at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'bucketSortSufDcU8.constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: ebwt_search.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: qual.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: pat.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt_search_util.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_aligner.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: log.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: hit_set.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: sam.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: hit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bowtie_main.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type 'struct string' itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: 'gEbwt_ext' was previously declared here In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from '__ct_base .constprop' at hit.h:176:17: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function '__ct_base .constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from '__ct ' at pat.cpp:379:15, inlined from 'patsrcFromStrings' at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'patsrcFromStrings': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'naiveFind' at ref_aligner.h:251:19, inlined from 'anchor64Find' at ref_aligner.h:291:13: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function 'anchor64Find': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'naiveFind' at ref_aligner.h:587:20, inlined from 'anchor64Find' at ref_aligner.h:632:14: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function 'anchor64Find': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: ebwt_search.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: qual.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: pat.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt_search_util.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_aligner.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: log.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: hit_set.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: sam.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: hit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bowtie_main.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type 'struct string' itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: 'gEbwt_ext' was previously declared here In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from '__ct_base .constprop' at hit.h:176:17: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function '__ct_base .constprop': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from '__ct ' at pat.cpp:379:15, inlined from 'patsrcFromStrings' at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function 'patsrcFromStrings': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'naiveFind' at ref_aligner.h:251:19, inlined from 'anchor64Find' at ref_aligner.h:291:13: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function 'anchor64Find': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function 'alloc', inlined from 'expandCopyExact' at ds.h:967:17, inlined from 'expandCopy' at ds.h:958:18, inlined from 'resize' at ds.h:569:14, inlined from 'resize' at ds.h:562:7, inlined from 'naiveFind' at ref_aligner.h:587:20, inlined from 'anchor64Find' at ref_aligner.h:632:14: ds.h:923:26: warning: argument 1 value '18446744073709551615' exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function 'anchor64Find': /usr/include/c++/13/new:128:26: note: in a call to allocation function 'operator new []' declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: bowtie_inspect.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type 'struct string' itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: 'gEbwt_ext' was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-02-17T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread gcc-annobin: bowtie_inspect.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ccnt_lut.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ref_read.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: alphabet.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: shmem.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: edit.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: ebwt.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: bt2_locks.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined gcc-annobin: tinythread.cpp: Warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: 'gEbwt_ext' violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type 'struct string' itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: 'gEbwt_ext' was previously declared here + RPM_EC=0 ++ jobs -p + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.TxWcsJ + umask 022 + cd /builddir/build/BUILD + '[' /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64 '!=' / ']' + rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64 ++ dirname /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64 + mkdir -p /builddir/build/BUILDROOT + mkdir /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64 + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin ; \ done + mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/share/bowtie + cp -a reads /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64//usr/bin/ + /usr/bin/find-debuginfo -j2 --strict-build-id -m -i --build-id-seed 1.3.1-1.fc39 --unique-debug-suffix -1.3.1-1.fc39.x86_64 --unique-debug-src-base bowtie-1.3.1-1.fc39.x86_64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 110000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-src extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-align-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-align-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-align-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-align-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-build-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-build-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-build-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-build-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-inspect-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-inspect-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-inspect-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/bin/bowtie-inspect-s-debug original debug info size: 39212kB, size after compression: 30424kB /usr/bin/sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. 2935 blocks + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig + /usr/lib/rpm/brp-compress + /usr/lib/rpm/redhat/brp-strip-lto /usr/bin/strip + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/check-rpaths + /usr/lib/rpm/redhat/brp-mangle-shebangs mangling shebang in /usr/share/bowtie/scripts/make_mm8.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg19.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/run-hbb.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/build_test.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg18.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm9.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_c_elegans.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/bowtie-hbb.sh from /bin/bash to #!/usr/bin/bash mangling shebang in /usr/share/bowtie/scripts/make_canFam2.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_a_thaliana_tair.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_m_musculus_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_b_taurus_UMD3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_s_cerevisiae.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_d_melanogaster.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_galGal3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi36.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_e_coli.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_rn4.sh from /bin/sh to #!/usr/bin/sh + /usr/lib/rpm/brp-remove-la-files + env /usr/lib/rpm/redhat/brp-python-bytecompile '' 1 0 -j2 + /usr/lib/rpm/redhat/brp-python-hardlink Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.OUsoDZ + umask 022 + cd /builddir/build/BUILD + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl scripts/test/cs_dec.pl scripts/test/random_bowtie_tests.sh scripts/test/btface.py scripts/test/long_read.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/random_bowtie_tests.pl scripts/test/args.pl scripts/test/DNA.pm scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/cs_trim.pl scripts/test/btdata.py scripts/test/build_big.py scripts/test/large_idx.py scripts/test/all.sh + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: @HD VN:1.0 SO:unsorted 1 (100.00%) No alignments@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 2r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 2 (100.00%) r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 (0.00%) Reported r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 10 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 0@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 2 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 2r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 paired-end alignments r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignmentsr0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 1 (100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 1 (100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 1 (100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: @SQ SN:0 LN:25 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 0 (0.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 (100.00%) No alignments r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 1 (100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 1 (100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:25 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 paired-end alignments r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:24 1 (100.00%) @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00@SQ SN:0 LN:8 %) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 1r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:8 1 (100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2@SQ SN:0 LN:19 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" 1seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 3@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 alignments seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 10 4 * 0 0 * * 0 0 XM:i:0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0@SQ SN:0 LN:19 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:19 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:19 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 1 (100.00%) No alignments r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:19 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 (0.00%) Reported 1 alignments r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 0 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00@SQ SN:0 LN:19 %) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 0 (0.00%) Reported 2 alignments 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 1 (100.00%) @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 1 (100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 paired-end alignments r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 3@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: 0 (0.00%) r0 77 * 0 0 * * 0 0 XM:i:0 # reads that failed to align: 1r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 2 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00%) r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads that failed to align: 0 (r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 (100.00%) r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 %) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (@SQ SN:0 LN:25 100.00%) # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignmentsr0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 %) r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%)r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments PASSED + RPM_EC=0 ++ jobs -p + exit 0 Processing files: bowtie-1.3.1-1.fc39.x86_64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.dUb2v3 + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + export LC_ALL=C + LC_ALL=C + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/MANUAL /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/NEWS /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/VERSION /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/AUTHORS /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/TUTORIAL /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/doc/manual.html /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/doc/style.css /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/doc/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.3NvJUk + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/licenses/bowtie + export LC_ALL=C + LC_ALL=C + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/licenses/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/LICENSE /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64/usr/share/licenses/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Provides: bowtie = 1.3.1-1.fc39 bowtie(x86-64) = 1.3.1-1.fc39 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /usr/bin/bash /usr/bin/perl /usr/bin/python3 /usr/bin/sh glibc >= 2.37.9000-14 libc.so.6()(64bit) libc.so.6(GLIBC_2.14)(64bit) libc.so.6(GLIBC_2.2.5)(64bit) libc.so.6(GLIBC_2.3.4)(64bit) libc.so.6(GLIBC_2.32)(64bit) libc.so.6(GLIBC_2.33)(64bit) libc.so.6(GLIBC_2.34)(64bit) libc.so.6(GLIBC_2.38)(64bit) libc.so.6(GLIBC_2.4)(64bit) libc.so.6(GLIBC_2.7)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.3.1)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.2.5)(64bit) libm.so.6(GLIBC_2.27)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.26)(64bit) libstdc++.so.6(GLIBCXX_3.4.30)(64bit) libstdc++.so.6(GLIBCXX_3.4.32)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-1.fc39.x86_64 Provides: bowtie-debugsource = 1.3.1-1.fc39 bowtie-debugsource(x86-64) = 1.3.1-1.fc39 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-1.fc39.x86_64 Provides: bowtie-debuginfo = 1.3.1-1.fc39 bowtie-debuginfo(x86-64) = 1.3.1-1.fc39 debuginfo(build-id) = 1ea7c0d4cf20863d962433a676bbc45063ccfdaf debuginfo(build-id) = 2413a3800e0f6fb100bef47e965fb732bc269925 debuginfo(build-id) = 2baa9445aeeeda451bf5f3ee7ae806af649e1bfa debuginfo(build-id) = 3fd573fa09bef2dbef1d7cb01b28f2f05522c906 debuginfo(build-id) = 7728de706064002e652b2a09872afdd675f54ec8 debuginfo(build-id) = 7ec6656d0b2db6f220d1e319d5899ea3bfe35903 debuginfo(build-id) = 8fd9f90d49feb3a6dc1e3c954f9b3b30aa5314fb debuginfo(build-id) = 936620ffada958202f8ab9f5bd792793fb3a665c debuginfo(build-id) = 9781f5eb3283e4f60e6399e84f9075d02b753f3b debuginfo(build-id) = 991b1f748122ac253b07debad45fed9b1e40ee04 debuginfo(build-id) = c77fddc1b471624d1ef89712787c829021924133 debuginfo(build-id) = f2b741a1b2967b86a41c1af323c986a6bd5c53a7 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(x86-64) = 1.3.1-1.fc39 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64 Wrote: /builddir/build/RPMS/bowtie-1.3.1-1.fc39.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-1.fc39.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-1.fc39.x86_64.rpm Executing(%clean): /bin/sh -e /var/tmp/rpm-tmp.5qa6EI + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + /usr/bin/rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-1.fc39.x86_64 + RPM_EC=0 ++ jobs -p + exit 0 Executing(rmbuild): /bin/sh -e /var/tmp/rpm-tmp.kINpOu + umask 022 + cd /builddir/build/BUILD + rm -rf bowtie-1.3.1-src bowtie-1.3.1-src.gemspec + RPM_EC=0 ++ jobs -p + exit 0 Finish: rpmbuild bowtie-1.3.1-1.fc39.src.rpm Finish: build phase for bowtie-1.3.1-1.fc39.src.rpm INFO: chroot_scan: 3 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-x86_64-1687861990.181316/root/var/log/dnf.rpm.log /var/lib/mock/fedora-rawhide-x86_64-1687861990.181316/root/var/log/dnf.librepo.log /var/lib/mock/fedora-rawhide-x86_64-1687861990.181316/root/var/log/dnf.log INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.fc39.src.rpm) Config(child) 4 minutes 8 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool