Warning: Permanently added '34.226.201.166' (ED25519) to the list of known hosts. Running: /usr/bin/copr-rpmbuild --verbose --drop-resultdir --build-id 5247830 --chroot epel-8-aarch64 --detached Version: 0.62 PID: 5180 Logging PID: 5181 Task: {'appstream': True, 'background': False, 'bootstrap': 'off', 'build_id': 5247830, 'buildroot_pkgs': ['scl-utils-build'], 'chroot': 'epel-8-aarch64', 'enable_net': False, 'fedora_review': False, 'git_hash': '9c61cd33db4fd4153590f5e201f7ec0e8bbdae09', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/loveshack/livhpc/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-1.fc38', 'project_dirname': 'livhpc', 'project_name': 'livhpc', 'project_owner': 'loveshack', 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/loveshack/livhpc/epel-8-aarch64/', 'id': 'copr_base', 'name': 'Copr repository'}], 'sandbox': 'loveshack/livhpc--loveshack', 'source_json': {}, 'source_type': None, 'submitter': 'loveshack', 'tags': [], 'task_id': '5247830-epel-8-aarch64', 'timeout': 18000, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/loveshack/livhpc/bowtie /var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/loveshack/livhpc/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie'... Running: git checkout 9c61cd33db4fd4153590f5e201f7ec0e8bbdae09 cmd: ['git', 'checkout', '9c61cd33db4fd4153590f5e201f7ec0e8bbdae09'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie rc: 0 stdout: stderr: Note: switching to '9c61cd33db4fd4153590f5e201f7ec0e8bbdae09'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at 9c61cd3 automatic import of bowtie Running: copr-distgit-client sources cmd: ['copr-distgit-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --remote-time --show-error --fail https://copr-dist-git.fedorainfracloud.org/repo/pkgs/loveshack/livhpc/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed /usr/bin/tail: /var/lib/copr-rpmbuild/main.log: file truncated 100 7293k 100 7293k 0 0 41.0M 0 --:--:-- --:--:-- --:--:-- 41.1M INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-tests.tgz --location --remote-time --show-error --fail https://copr-dist-git.fedorainfracloud.org/repo/pkgs/loveshack/livhpc/bowtie/bowtie-1.3.1-tests.tgz/md5/a3db68fc7312a3fd8edb769e8d32e1f0/bowtie-1.3.1-tests.tgz % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 33854 100 33854 0 0 562k 0 --:--:-- --:--:-- --:--:-- 570k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz Running (timeout=18000): unbuffer mock --buildsrpm --spec /var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1674075943.812535 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 3.5 starting (python version = 3.11.0, NVR = mock-3.5-1.fc37)... Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie/bowtie.spec) Config(rhel+epel-8-aarch64) Start: clean chroot Finish: clean chroot Start: chroot init INFO: mounting tmpfs at /var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin Mock Version: 3.5 INFO: Mock Version: 3.5 Start: dnf install No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 994 kB/s | 225 kB 00:00 Red Hat Enterprise Linux - BaseOS 26 MB/s | 44 MB 00:01 Red Hat Enterprise Linux - AppStream 71 MB/s | 43 MB 00:00 Red Hat Enterprise Linux - CodeReady Linux Buil 11 MB/s | 5.1 MB 00:00 Extra Packages for Enterprise Linux 8 - aarch64 58 MB/s | 13 MB 00:00 Dependencies resolved. ============================================================================================ Package Arch Version Repository Size ============================================================================================ Installing: bash aarch64 4.4.20-4.el8_6 rhel-baseos 1.5 M bzip2 aarch64 1.0.6-26.el8 rhel-baseos 60 k coreutils aarch64 8.30-13.el8 rhel-baseos 1.2 M cpio aarch64 2.12-11.el8 rhel-baseos 260 k diffutils aarch64 3.6-6.el8 rhel-baseos 352 k epel-rpm-macros noarch 8-35 epel 24 k findutils aarch64 1:4.6.0-20.el8 rhel-baseos 525 k gawk aarch64 4.2.1-4.el8 rhel-baseos 1.1 M gcc aarch64 8.5.0-16.el8_7 rhel-appstream 19 M gcc-c++ aarch64 8.5.0-16.el8_7 rhel-appstream 11 M grep aarch64 3.1-6.el8 rhel-baseos 268 k gzip aarch64 1.9-13.el8_5 rhel-baseos 165 k info aarch64 6.5-7.el8 rhel-baseos 191 k make aarch64 1:4.2.1-11.el8 rhel-baseos 490 k patch aarch64 2.7.6-11.el8 rhel-baseos 134 k redhat-release aarch64 8.7-0.3.el8 rhel-baseos 44 k redhat-rpm-config noarch 130-1.el8 rhel-appstream 90 k rpm-build aarch64 4.14.3-24.el8_7 rhel-appstream 173 k sed aarch64 4.5-5.el8 rhel-baseos 295 k shadow-utils aarch64 2:4.6-17.el8 rhel-baseos 1.2 M tar aarch64 2:1.30-6.el8 rhel-baseos 830 k unzip aarch64 6.0-46.el8 rhel-baseos 190 k util-linux aarch64 2.32.1-39.el8_7 rhel-baseos 2.5 M which aarch64 2.21-18.el8 rhel-baseos 49 k xz aarch64 5.2.4-4.el8_6 rhel-baseos 153 k Installing dependencies: annobin aarch64 10.67-3.el8 rhel-appstream 954 k ansible-srpm-macros noarch 1-8.1.el8 epel 8.5 k audit-libs aarch64 3.0.7-4.el8 rhel-baseos 118 k basesystem noarch 11-5.el8 rhel-baseos 11 k binutils aarch64 2.30-117.el8 rhel-baseos 6.1 M brotli aarch64 1.0.6-3.el8 rhel-baseos 314 k bzip2-libs aarch64 1.0.6-26.el8 rhel-baseos 48 k ca-certificates noarch 2022.2.54-80.2.el8_6 rhel-baseos 921 k chkconfig aarch64 1.19.1-1.el8 rhel-baseos 197 k coreutils-common aarch64 8.30-13.el8 rhel-baseos 2.0 M cpp aarch64 8.5.0-16.el8_7 rhel-appstream 9.0 M cracklib aarch64 2.9.6-15.el8 rhel-baseos 93 k cracklib-dicts aarch64 2.9.6-15.el8 rhel-baseos 4.0 M crypto-policies noarch 20211116-1.gitae470d6.el8 rhel-baseos 64 k curl aarch64 7.61.1-25.el8_7.1 rhel-baseos 348 k cyrus-sasl-lib aarch64 2.1.27-6.el8_5 rhel-baseos 122 k dwz aarch64 0.12-10.el8 rhel-appstream 103 k efi-srpm-macros noarch 3-3.el8 rhel-appstream 22 k elfutils aarch64 0.187-4.el8 rhel-baseos 529 k elfutils-default-yama-scope noarch 0.187-4.el8 rhel-baseos 52 k elfutils-libelf aarch64 0.187-4.el8 rhel-baseos 230 k elfutils-libs aarch64 0.187-4.el8 rhel-baseos 288 k expat aarch64 2.2.5-10.el8_7.1 rhel-baseos 104 k file aarch64 5.33-21.el8 rhel-baseos 77 k file-libs aarch64 5.33-21.el8 rhel-baseos 541 k filesystem aarch64 3.8-6.el8 rhel-baseos 1.1 M fpc-srpm-macros noarch 1.3-1.el8 epel 8.2 k gc aarch64 7.6.4-3.el8 rhel-appstream 99 k gcc-plugin-annobin aarch64 8.5.0-16.el8_7 rhel-appstream 34 k gdb-headless aarch64 8.2-19.el8 rhel-appstream 3.1 M gdbm aarch64 1:1.18-2.el8 rhel-baseos 128 k gdbm-libs aarch64 1:1.18-2.el8 rhel-baseos 59 k ghc-srpm-macros noarch 1.4.2-7.el8 rhel-appstream 9.4 k glib2 aarch64 2.56.4-159.el8 rhel-baseos 2.4 M glibc aarch64 2.28-211.el8 rhel-baseos 1.8 M glibc-all-langpacks aarch64 2.28-211.el8 rhel-baseos 25 M glibc-common aarch64 2.28-211.el8 rhel-baseos 1.0 M glibc-devel aarch64 2.28-211.el8 rhel-baseos 80 k glibc-gconv-extra aarch64 2.28-211.el8 rhel-baseos 1.8 M glibc-headers aarch64 2.28-211.el8 rhel-baseos 477 k gmp aarch64 1:6.1.2-10.el8 rhel-baseos 270 k gnupg2 aarch64 2.2.20-3.el8_6 rhel-baseos 2.4 M gnutls aarch64 3.6.16-5.el8_6 rhel-baseos 939 k go-srpm-macros noarch 2-17.el8 rhel-appstream 13 k guile aarch64 5:2.0.14-7.el8 rhel-appstream 3.5 M ima-evm-utils aarch64 1.3.2-12.el8 rhel-baseos 63 k isl aarch64 0.16.1-6.el8 rhel-appstream 778 k kernel-headers aarch64 4.18.0-425.10.1.el8_7 rhel-baseos 10 M keyutils-libs aarch64 1.5.10-9.el8 rhel-baseos 34 k krb5-libs aarch64 1.18.2-22.el8_7 rhel-baseos 822 k libacl aarch64 2.2.53-1.el8 rhel-baseos 34 k libarchive aarch64 3.3.3-4.el8 rhel-baseos 340 k libasan aarch64 8.5.0-16.el8_7 rhel-baseos 387 k libassuan aarch64 2.5.1-3.el8 rhel-baseos 81 k libatomic aarch64 8.5.0-16.el8_7 rhel-baseos 25 k libatomic_ops aarch64 7.6.2-3.el8 rhel-appstream 38 k libattr aarch64 2.4.48-3.el8 rhel-baseos 27 k libbabeltrace aarch64 1.5.4-4.el8 rhel-baseos 189 k libblkid aarch64 2.32.1-39.el8_7 rhel-baseos 213 k libcap aarch64 2.48-4.el8 rhel-baseos 73 k libcap-ng aarch64 0.7.11-1.el8 rhel-baseos 33 k libcom_err aarch64 1.45.6-5.el8 rhel-baseos 49 k libcurl aarch64 7.61.1-25.el8_7.1 rhel-baseos 284 k libdb aarch64 5.3.28-42.el8_4 rhel-baseos 687 k libdb-utils aarch64 5.3.28-42.el8_4 rhel-baseos 148 k libfdisk aarch64 2.32.1-39.el8_7 rhel-baseos 243 k libffi aarch64 3.1-23.el8 rhel-baseos 36 k libgcc aarch64 8.5.0-16.el8_7 rhel-baseos 74 k libgcrypt aarch64 1.8.5-7.el8_6 rhel-baseos 391 k libgomp aarch64 8.5.0-16.el8_7 rhel-baseos 200 k libgpg-error aarch64 1.31-1.el8 rhel-baseos 240 k libidn2 aarch64 2.2.0-1.el8 rhel-baseos 93 k libksba aarch64 1.3.5-8.el8_6 rhel-baseos 130 k libmount aarch64 2.32.1-39.el8_7 rhel-baseos 229 k libmpc aarch64 1.1.0-9.1.el8 rhel-appstream 60 k libnghttp2 aarch64 1.33.0-3.el8_2.1 rhel-baseos 75 k libnsl2 aarch64 1.2.0-2.20180605git4a062cf.el8 rhel-baseos 55 k libpkgconf aarch64 1.4.2-1.el8 rhel-baseos 34 k libpsl aarch64 0.20.2-6.el8 rhel-baseos 61 k libpwquality aarch64 1.4.4-5.el8 rhel-baseos 106 k libselinux aarch64 2.9-6.el8 rhel-baseos 162 k libsemanage aarch64 2.9-9.el8_6 rhel-baseos 164 k libsepol aarch64 2.9-3.el8 rhel-baseos 321 k libsigsegv aarch64 2.11-5.el8 rhel-baseos 30 k libsmartcols aarch64 2.32.1-39.el8_7 rhel-baseos 174 k libssh aarch64 0.9.6-3.el8 rhel-baseos 207 k libssh-config noarch 0.9.6-3.el8 rhel-baseos 19 k libstdc++ aarch64 8.5.0-16.el8_7 rhel-baseos 425 k libstdc++-devel aarch64 8.5.0-16.el8_7 rhel-appstream 2.1 M libtasn1 aarch64 4.13-4.el8_7 rhel-baseos 75 k libtirpc aarch64 1.1.4-8.el8 rhel-baseos 109 k libtool-ltdl aarch64 2.4.6-25.el8 rhel-baseos 57 k libubsan aarch64 8.5.0-16.el8_7 rhel-baseos 144 k libunistring aarch64 0.9.9-3.el8 rhel-baseos 411 k libusbx aarch64 1.0.23-4.el8 rhel-baseos 73 k libutempter aarch64 1.1.6-14.el8 rhel-baseos 32 k libuuid aarch64 2.32.1-39.el8_7 rhel-baseos 97 k libverto aarch64 0.3.2-2.el8 rhel-baseos 24 k libxcrypt aarch64 4.1.1-6.el8 rhel-baseos 73 k libxcrypt-devel aarch64 4.1.1-6.el8 rhel-baseos 25 k libxml2 aarch64 2.9.7-15.el8_7.1 rhel-baseos 653 k libzstd aarch64 1.4.4-1.el8 rhel-baseos 240 k lua-libs aarch64 5.3.4-12.el8 rhel-baseos 112 k lua-srpm-macros noarch 1-3.el8 epel 8.1 k lz4-libs aarch64 1.8.3-3.el8_4 rhel-baseos 63 k mpfr aarch64 3.1.6-1.el8 rhel-baseos 214 k ncurses aarch64 6.1-9.20180224.el8 rhel-baseos 383 k ncurses-base noarch 6.1-9.20180224.el8 rhel-baseos 81 k ncurses-libs aarch64 6.1-9.20180224.el8 rhel-baseos 311 k nettle aarch64 3.4.1-7.el8 rhel-baseos 307 k npth aarch64 1.5-4.el8 rhel-baseos 26 k ocaml-srpm-macros noarch 5-4.el8 rhel-appstream 9.5 k openblas-srpm-macros noarch 2-2.el8 rhel-appstream 8.0 k openldap aarch64 2.4.46-18.el8 rhel-baseos 339 k openssl-libs aarch64 1:1.1.1k-7.el8_6 rhel-baseos 1.3 M p11-kit aarch64 0.23.22-1.el8 rhel-baseos 306 k p11-kit-trust aarch64 0.23.22-1.el8 rhel-baseos 134 k pam aarch64 1.3.1-22.el8 rhel-baseos 738 k pcre aarch64 8.42-6.el8 rhel-baseos 187 k pcre2 aarch64 10.32-3.el8_6 rhel-baseos 219 k perl-srpm-macros noarch 1-25.el8 rhel-appstream 11 k pkgconf aarch64 1.4.2-1.el8 rhel-baseos 37 k pkgconf-m4 noarch 1.4.2-1.el8 rhel-baseos 17 k pkgconf-pkg-config aarch64 1.4.2-1.el8 rhel-baseos 15 k platform-python aarch64 3.6.8-48.el8_7 rhel-baseos 86 k platform-python-setuptools noarch 39.2.0-6.el8 rhel-baseos 632 k popt aarch64 1.18-1.el8 rhel-baseos 60 k publicsuffix-list-dafsa noarch 20180723-1.el8 rhel-baseos 56 k python-rpm-macros noarch 3-43.el8 rhel-appstream 16 k python-srpm-macros noarch 3-43.el8 rhel-appstream 15 k python3-libs aarch64 3.6.8-48.el8_7 rhel-baseos 7.7 M python3-pip-wheel noarch 9.0.3-22.el8 rhel-baseos 895 k python3-rpm-macros noarch 3-43.el8 rhel-appstream 15 k python3-setuptools-wheel noarch 39.2.0-6.el8 rhel-baseos 289 k qt5-srpm-macros noarch 5.15.3-1.el8 rhel-appstream 11 k readline aarch64 7.0-10.el8 rhel-baseos 193 k rpm aarch64 4.14.3-24.el8_7 rhel-baseos 543 k rpm-build-libs aarch64 4.14.3-24.el8_7 rhel-baseos 151 k rpm-libs aarch64 4.14.3-24.el8_7 rhel-baseos 329 k rust-srpm-macros noarch 5-2.el8 rhel-appstream 9.3 k setup noarch 2.12.2-7.el8 rhel-baseos 181 k sqlite-libs aarch64 3.26.0-17.el8_7 rhel-baseos 550 k systemd-libs aarch64 239-68.el8_7.2 rhel-baseos 1.0 M tpm2-tss aarch64 2.3.2-4.el8 rhel-baseos 240 k tzdata noarch 2022g-1.el8 rhel-baseos 470 k xz-libs aarch64 5.2.4-4.el8_6 rhel-baseos 91 k zip aarch64 3.0-23.el8 rhel-baseos 265 k zlib aarch64 1.2.11-21.el8_7 rhel-baseos 101 k zstd aarch64 1.4.4-1.el8 rhel-appstream 303 k Transaction Summary ============================================================================================ Install 174 Packages Total download size: 153 M Installed size: 824 M Downloading Packages: (1/174): libsigsegv-2.11-5.el8.aarch64.rpm 205 kB/s | 30 kB 00:00 (2/174): libassuan-2.5.1-3.el8.aarch64.rpm 523 kB/s | 81 kB 00:00 (3/174): bzip2-libs-1.0.6-26.el8.aarch64.rpm 189 kB/s | 48 kB 00:00 (4/174): zip-3.0-23.el8.aarch64.rpm 2.3 MB/s | 265 kB 00:00 (5/174): pkgconf-1.4.2-1.el8.aarch64.rpm 189 kB/s | 37 kB 00:00 (6/174): readline-7.0-10.el8.aarch64.rpm 2.0 MB/s | 193 kB 00:00 (7/174): libutempter-1.1.6-14.el8.aarch64.rpm 168 kB/s | 32 kB 00:00 (8/174): libnsl2-1.2.0-2.20180605git4a062cf.el8 616 kB/s | 55 kB 00:00 (9/174): libtool-ltdl-2.4.6-25.el8.aarch64.rpm 448 kB/s | 57 kB 00:00 (10/174): libattr-2.4.48-3.el8.aarch64.rpm 299 kB/s | 27 kB 00:00 (11/174): libpkgconf-1.4.2-1.el8.aarch64.rpm 368 kB/s | 34 kB 00:00 (12/174): bzip2-1.0.6-26.el8.aarch64.rpm 571 kB/s | 60 kB 00:00 (13/174): libunistring-0.9.9-3.el8.aarch64.rpm 3.2 MB/s | 411 kB 00:00 (14/174): cracklib-dicts-2.9.6-15.el8.aarch64.r 30 MB/s | 4.0 MB 00:00 (15/174): grep-3.1-6.el8.aarch64.rpm 2.5 MB/s | 268 kB 00:00 (16/174): findutils-4.6.0-20.el8.aarch64.rpm 5.2 MB/s | 525 kB 00:00 (17/174): libacl-2.2.53-1.el8.aarch64.rpm 334 kB/s | 34 kB 00:00 (18/174): libgpg-error-1.31-1.el8.aarch64.rpm 1.7 MB/s | 240 kB 00:00 (19/174): mpfr-3.1.6-1.el8.aarch64.rpm 2.3 MB/s | 214 kB 00:00 (20/174): pkgconf-pkg-config-1.4.2-1.el8.aarch6 179 kB/s | 15 kB 00:00 (21/174): cracklib-2.9.6-15.el8.aarch64.rpm 1.0 MB/s | 93 kB 00:00 (22/174): npth-1.5-4.el8.aarch64.rpm 296 kB/s | 26 kB 00:00 (23/174): publicsuffix-list-dafsa-20180723-1.el 575 kB/s | 56 kB 00:00 (24/174): pkgconf-m4-1.4.2-1.el8.noarch.rpm 149 kB/s | 17 kB 00:00 (25/174): basesystem-11-5.el8.noarch.rpm 103 kB/s | 11 kB 00:00 (26/174): libidn2-2.2.0-1.el8.aarch64.rpm 853 kB/s | 93 kB 00:00 (27/174): gmp-6.1.2-10.el8.aarch64.rpm 2.4 MB/s | 270 kB 00:00 (28/174): diffutils-3.6-6.el8.aarch64.rpm 3.7 MB/s | 352 kB 00:00 (29/174): patch-2.7.6-11.el8.aarch64.rpm 1.3 MB/s | 134 kB 00:00 (30/174): libnghttp2-1.33.0-3.el8_2.1.aarch64.r 850 kB/s | 75 kB 00:00 (31/174): libusbx-1.0.23-4.el8.aarch64.rpm 793 kB/s | 73 kB 00:00 (32/174): platform-python-setuptools-39.2.0-6.e 6.1 MB/s | 632 kB 00:00 (33/174): libpsl-0.20.2-6.el8.aarch64.rpm 600 kB/s | 61 kB 00:00 (34/174): python3-setuptools-wheel-39.2.0-6.el8 2.5 MB/s | 289 kB 00:00 (35/174): libzstd-1.4.4-1.el8.aarch64.rpm 2.4 MB/s | 240 kB 00:00 (36/174): popt-1.18-1.el8.aarch64.rpm 705 kB/s | 60 kB 00:00 (37/174): p11-kit-trust-0.23.22-1.el8.aarch64.r 1.4 MB/s | 134 kB 00:00 (38/174): ima-evm-utils-1.3.2-12.el8.aarch64.rp 698 kB/s | 63 kB 00:00 (39/174): libsepol-2.9-3.el8.aarch64.rpm 3.4 MB/s | 321 kB 00:00 (40/174): brotli-1.0.6-3.el8.aarch64.rpm 3.0 MB/s | 314 kB 00:00 (41/174): ncurses-libs-6.1-9.20180224.el8.aarch 3.4 MB/s | 311 kB 00:00 (42/174): libdb-utils-5.3.28-42.el8_4.aarch64.r 1.6 MB/s | 148 kB 00:00 (43/174): chkconfig-1.19.1-1.el8.aarch64.rpm 1.8 MB/s | 197 kB 00:00 (44/174): openldap-2.4.46-18.el8.aarch64.rpm 3.8 MB/s | 339 kB 00:00 (45/174): p11-kit-0.23.22-1.el8.aarch64.rpm 3.3 MB/s | 306 kB 00:00 (46/174): nettle-3.4.1-7.el8.aarch64.rpm 3.3 MB/s | 307 kB 00:00 (47/174): libdb-5.3.28-42.el8_4.aarch64.rpm 4.6 MB/s | 687 kB 00:00 (48/174): lz4-libs-1.8.3-3.el8_4.aarch64.rpm 716 kB/s | 63 kB 00:00 (49/174): pcre-8.42-6.el8.aarch64.rpm 1.9 MB/s | 187 kB 00:00 (50/174): tpm2-tss-2.3.2-4.el8.aarch64.rpm 1.0 MB/s | 240 kB 00:00 (51/174): ncurses-6.1-9.20180224.el8.aarch64.rp 1.8 MB/s | 383 kB 00:00 (52/174): make-4.2.1-11.el8.aarch64.rpm 3.0 MB/s | 490 kB 00:00 (53/174): keyutils-libs-1.5.10-9.el8.aarch64.rp 383 kB/s | 34 kB 00:00 (54/174): ncurses-base-6.1-9.20180224.el8.noarc 896 kB/s | 81 kB 00:00 (55/174): cyrus-sasl-lib-2.1.27-6.el8_5.aarch64 947 kB/s | 122 kB 00:00 (56/174): libxcrypt-devel-4.1.1-6.el8.aarch64.r 268 kB/s | 25 kB 00:00 (57/174): libcap-ng-0.7.11-1.el8.aarch64.rpm 313 kB/s | 33 kB 00:00 (58/174): filesystem-3.8-6.el8.aarch64.rpm 11 MB/s | 1.1 MB 00:00 (59/174): libxcrypt-4.1.1-6.el8.aarch64.rpm 469 kB/s | 73 kB 00:00 (60/174): gzip-1.9-13.el8_5.aarch64.rpm 1.8 MB/s | 165 kB 00:00 (61/174): libffi-3.1-23.el8.aarch64.rpm 335 kB/s | 36 kB 00:00 (62/174): lua-libs-5.3.4-12.el8.aarch64.rpm 504 kB/s | 112 kB 00:00 (63/174): xz-5.2.4-4.el8_6.aarch64.rpm 1.6 MB/s | 153 kB 00:00 (64/174): unzip-6.0-46.el8.aarch64.rpm 2.1 MB/s | 190 kB 00:00 (65/174): xz-libs-5.2.4-4.el8_6.aarch64.rpm 989 kB/s | 91 kB 00:00 (66/174): cpio-2.12-11.el8.aarch64.rpm 2.8 MB/s | 260 kB 00:00 (67/174): python3-pip-wheel-9.0.3-22.el8.noarch 8.9 MB/s | 895 kB 00:00 (68/174): info-6.5-7.el8.aarch64.rpm 728 kB/s | 191 kB 00:00 (69/174): sed-4.5-5.el8.aarch64.rpm 2.6 MB/s | 295 kB 00:00 (70/174): crypto-policies-20211116-1.gitae470d6 730 kB/s | 64 kB 00:00 (71/174): gawk-4.2.1-4.el8.aarch64.rpm 11 MB/s | 1.1 MB 00:00 (72/174): libssh-0.9.6-3.el8.aarch64.rpm 2.1 MB/s | 207 kB 00:00 (73/174): libssh-config-0.9.6-3.el8.noarch.rpm 222 kB/s | 19 kB 00:00 (74/174): libverto-0.3.2-2.el8.aarch64.rpm 267 kB/s | 24 kB 00:00 (75/174): redhat-release-8.7-0.3.el8.aarch64.rp 521 kB/s | 44 kB 00:00 (76/174): libpwquality-1.4.4-5.el8.aarch64.rpm 1.1 MB/s | 106 kB 00:00 (77/174): libcap-2.48-4.el8.aarch64.rpm 819 kB/s | 73 kB 00:00 (78/174): elfutils-libs-0.187-4.el8.aarch64.rpm 2.8 MB/s | 288 kB 00:00 (79/174): glibc-headers-2.28-211.el8.aarch64.rp 5.2 MB/s | 477 kB 00:00 (80/174): which-2.21-18.el8.aarch64.rpm 517 kB/s | 49 kB 00:00 (81/174): libtirpc-1.1.4-8.el8.aarch64.rpm 1.1 MB/s | 109 kB 00:00 (82/174): openssl-libs-1.1.1k-7.el8_6.aarch64.r 14 MB/s | 1.3 MB 00:00 (83/174): glibc-common-2.28-211.el8.aarch64.rpm 10 MB/s | 1.0 MB 00:00 (84/174): gdbm-1.18-2.el8.aarch64.rpm 1.0 MB/s | 128 kB 00:00 (85/174): glib2-2.56.4-159.el8.aarch64.rpm 22 MB/s | 2.4 MB 00:00 (86/174): libgcrypt-1.8.5-7.el8_6.aarch64.rpm 3.8 MB/s | 391 kB 00:00 (87/174): pam-1.3.1-22.el8.aarch64.rpm 7.3 MB/s | 738 kB 00:00 (88/174): elfutils-libelf-0.187-4.el8.aarch64.r 1.1 MB/s | 230 kB 00:00 (89/174): shadow-utils-4.6-17.el8.aarch64.rpm 6.6 MB/s | 1.2 MB 00:00 (90/174): tar-1.30-6.el8.aarch64.rpm 8.5 MB/s | 830 kB 00:00 (91/174): file-5.33-21.el8.aarch64.rpm 837 kB/s | 77 kB 00:00 (92/174): gnutls-3.6.16-5.el8_6.aarch64.rpm 9.5 MB/s | 939 kB 00:00 (93/174): glibc-gconv-extra-2.28-211.el8.aarch6 13 MB/s | 1.8 MB 00:00 (94/174): gnupg2-2.2.20-3.el8_6.aarch64.rpm 23 MB/s | 2.4 MB 00:00 (95/174): elfutils-0.187-4.el8.aarch64.rpm 4.3 MB/s | 529 kB 00:00 (96/174): libsemanage-2.9-9.el8_6.aarch64.rpm 1.8 MB/s | 164 kB 00:00 (97/174): glibc-all-langpacks-2.28-211.el8.aarc 94 MB/s | 25 MB 00:00 (98/174): setup-2.12.2-7.el8.noarch.rpm 1.3 MB/s | 181 kB 00:00 (99/174): ca-certificates-2022.2.54-80.2.el8_6. 9.1 MB/s | 921 kB 00:00 (100/174): coreutils-common-8.30-13.el8.aarch64 19 MB/s | 2.0 MB 00:00 (101/174): pcre2-10.32-3.el8_6.aarch64.rpm 2.4 MB/s | 219 kB 00:00 (102/174): libarchive-3.3.3-4.el8.aarch64.rpm 2.6 MB/s | 340 kB 00:00 (103/174): libbabeltrace-1.5.4-4.el8.aarch64.rp 2.1 MB/s | 189 kB 00:00 (104/174): glibc-devel-2.28-211.el8.aarch64.rpm 799 kB/s | 80 kB 00:00 (105/174): coreutils-8.30-13.el8.aarch64.rpm 12 MB/s | 1.2 MB 00:00 (106/174): libcom_err-1.45.6-5.el8.aarch64.rpm 590 kB/s | 49 kB 00:00 (107/174): libselinux-2.9-6.el8.aarch64.rpm 1.7 MB/s | 162 kB 00:00 (108/174): bash-4.4.20-4.el8_6.aarch64.rpm 14 MB/s | 1.5 MB 00:00 (109/174): gdbm-libs-1.18-2.el8.aarch64.rpm 493 kB/s | 59 kB 00:00 (110/174): elfutils-default-yama-scope-0.187-4. 492 kB/s | 52 kB 00:00 (111/174): libksba-1.3.5-8.el8_6.aarch64.rpm 1.2 MB/s | 130 kB 00:00 (112/174): binutils-2.30-117.el8.aarch64.rpm 42 MB/s | 6.1 MB 00:00 (113/174): file-libs-5.33-21.el8.aarch64.rpm 5.9 MB/s | 541 kB 00:00 (114/174): glibc-2.28-211.el8.aarch64.rpm 18 MB/s | 1.8 MB 00:00 (115/174): audit-libs-3.0.7-4.el8.aarch64.rpm 1.1 MB/s | 118 kB 00:00 (116/174): platform-python-3.6.8-48.el8_7.aarch 808 kB/s | 86 kB 00:00 (117/174): rpm-libs-4.14.3-24.el8_7.aarch64.rpm 3.3 MB/s | 329 kB 00:00 (118/174): rpm-build-libs-4.14.3-24.el8_7.aarch 1.7 MB/s | 151 kB 00:00 (119/174): rpm-4.14.3-24.el8_7.aarch64.rpm 5.3 MB/s | 543 kB 00:00 (120/174): krb5-libs-1.18.2-22.el8_7.aarch64.rp 8.6 MB/s | 822 kB 00:00 (121/174): python3-libs-3.6.8-48.el8_7.aarch64. 54 MB/s | 7.7 MB 00:00 (122/174): tzdata-2022g-1.el8.noarch.rpm 5.1 MB/s | 470 kB 00:00 (123/174): libgcc-8.5.0-16.el8_7.aarch64.rpm 757 kB/s | 74 kB 00:00 (124/174): libasan-8.5.0-16.el8_7.aarch64.rpm 4.1 MB/s | 387 kB 00:00 (125/174): libatomic-8.5.0-16.el8_7.aarch64.rpm 300 kB/s | 25 kB 00:00 (126/174): libtasn1-4.13-4.el8_7.aarch64.rpm 825 kB/s | 75 kB 00:00 (127/174): libsmartcols-2.32.1-39.el8_7.aarch64 1.9 MB/s | 174 kB 00:00 (128/174): libubsan-8.5.0-16.el8_7.aarch64.rpm 1.6 MB/s | 144 kB 00:00 (129/174): zlib-1.2.11-21.el8_7.aarch64.rpm 1.1 MB/s | 101 kB 00:00 (130/174): systemd-libs-239-68.el8_7.2.aarch64. 10 MB/s | 1.0 MB 00:00 (131/174): libblkid-2.32.1-39.el8_7.aarch64.rpm 1.7 MB/s | 213 kB 00:00 (132/174): util-linux-2.32.1-39.el8_7.aarch64.r 19 MB/s | 2.5 MB 00:00 (133/174): sqlite-libs-3.26.0-17.el8_7.aarch64. 5.7 MB/s | 550 kB 00:00 (134/174): kernel-headers-4.18.0-425.10.1.el8_7 52 MB/s | 10 MB 00:00 (135/174): libgomp-8.5.0-16.el8_7.aarch64.rpm 1.8 MB/s | 200 kB 00:00 (136/174): libcurl-7.61.1-25.el8_7.1.aarch64.rp 1.9 MB/s | 284 kB 00:00 (137/174): libuuid-2.32.1-39.el8_7.aarch64.rpm 1.1 MB/s | 97 kB 00:00 (138/174): libfdisk-2.32.1-39.el8_7.aarch64.rpm 2.5 MB/s | 243 kB 00:00 (139/174): expat-2.2.5-10.el8_7.1.aarch64.rpm 857 kB/s | 104 kB 00:00 (140/174): curl-7.61.1-25.el8_7.1.aarch64.rpm 3.4 MB/s | 348 kB 00:00 (141/174): libstdc++-8.5.0-16.el8_7.aarch64.rpm 3.4 MB/s | 425 kB 00:00 (142/174): libmount-2.32.1-39.el8_7.aarch64.rpm 2.3 MB/s | 229 kB 00:00 (143/174): libxml2-2.9.7-15.el8_7.1.aarch64.rpm 6.6 MB/s | 653 kB 00:00 (144/174): isl-0.16.1-6.el8.aarch64.rpm 8.1 MB/s | 778 kB 00:00 (145/174): guile-2.0.14-7.el8.aarch64.rpm 24 MB/s | 3.5 MB 00:00 (146/174): libatomic_ops-7.6.2-3.el8.aarch64.rp 411 kB/s | 38 kB 00:00 (147/174): gc-7.6.4-3.el8.aarch64.rpm 1.1 MB/s | 99 kB 00:00 (148/174): rust-srpm-macros-5-2.el8.noarch.rpm 104 kB/s | 9.3 kB 00:00 (149/174): ocaml-srpm-macros-5-4.el8.noarch.rpm 107 kB/s | 9.5 kB 00:00 (150/174): ghc-srpm-macros-1.4.2-7.el8.noarch.r 108 kB/s | 9.4 kB 00:00 (151/174): openblas-srpm-macros-2-2.el8.noarch. 73 kB/s | 8.0 kB 00:00 (152/174): perl-srpm-macros-1-25.el8.noarch.rpm 112 kB/s | 11 kB 00:00 (153/174): efi-srpm-macros-3-3.el8.noarch.rpm 251 kB/s | 22 kB 00:00 (154/174): zstd-1.4.4-1.el8.aarch64.rpm 1.9 MB/s | 303 kB 00:00 (155/174): libmpc-1.1.0-9.1.el8.aarch64.rpm 690 kB/s | 60 kB 00:00 (156/174): go-srpm-macros-2-17.el8.noarch.rpm 121 kB/s | 13 kB 00:00 (157/174): gdb-headless-8.2-19.el8.aarch64.rpm 27 MB/s | 3.1 MB 00:00 (158/174): qt5-srpm-macros-5.15.3-1.el8.noarch. 123 kB/s | 11 kB 00:00 (159/174): redhat-rpm-config-130-1.el8.noarch.r 989 kB/s | 90 kB 00:00 (160/174): dwz-0.12-10.el8.aarch64.rpm 370 kB/s | 103 kB 00:00 (161/174): python3-rpm-macros-3-43.el8.noarch.r 86 kB/s | 15 kB 00:00 (162/174): python-srpm-macros-3-43.el8.noarch.r 128 kB/s | 15 kB 00:00 (163/174): rpm-build-4.14.3-24.el8_7.aarch64.rp 1.8 MB/s | 173 kB 00:00 (164/174): annobin-10.67-3.el8.aarch64.rpm 3.9 MB/s | 954 kB 00:00 (165/174): python-rpm-macros-3-43.el8.noarch.rp 55 kB/s | 16 kB 00:00 (166/174): gcc-plugin-annobin-8.5.0-16.el8_7.aa 355 kB/s | 34 kB 00:00 (167/174): libstdc++-devel-8.5.0-16.el8_7.aarch 20 MB/s | 2.1 MB 00:00 (168/174): cpp-8.5.0-16.el8_7.aarch64.rpm 57 MB/s | 9.0 MB 00:00 (169/174): ansible-srpm-macros-1-8.1.el8.noarch 266 kB/s | 8.5 kB 00:00 (170/174): epel-rpm-macros-8-35.noarch.rpm 7.1 MB/s | 24 kB 00:00 (171/174): fpc-srpm-macros-1.3-1.el8.noarch.rpm 2.8 MB/s | 8.2 kB 00:00 (172/174): lua-srpm-macros-1-3.el8.noarch.rpm 1.3 MB/s | 8.1 kB 00:00 (173/174): gcc-c++-8.5.0-16.el8_7.aarch64.rpm 25 MB/s | 11 MB 00:00 (174/174): gcc-8.5.0-16.el8_7.aarch64.rpm 19 MB/s | 19 MB 00:00 -------------------------------------------------------------------------------- Total 21 MB/s | 153 MB 00:07 Red Hat Enterprise Linux - BaseOS 3.1 MB/s | 3.1 kB 00:00 Importing GPG key 0xFD431D51: Userid : "Red Hat, Inc. (release key 2) " Fingerprint: 567E 347A D004 4ADE 55BA 8A5F 199E 2F91 FD43 1D51 From : /usr/share/distribution-gpg-keys/redhat/RPM-GPG-KEY-redhat8-release Key imported successfully Importing GPG key 0x2FA658E0: Userid : "Red Hat, Inc. (auxiliary key) " Fingerprint: 43A6 E49C 4A38 F4BE 9ABF 2A53 4568 9C88 2FA6 58E0 From : /usr/share/distribution-gpg-keys/redhat/RPM-GPG-KEY-redhat8-release Key imported successfully Extra Packages for Enterprise Linux 8 - aarch64 1.6 MB/s | 1.6 kB 00:00 Importing GPG key 0x2F86D6A1: Userid : "Fedora EPEL (8) " Fingerprint: 94E2 79EB 8D8F 25B2 1810 ADF1 21EA 45AB 2F86 D6A1 From : /usr/share/distribution-gpg-keys/epel/RPM-GPG-KEY-EPEL-8 Key imported successfully Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Running scriptlet: filesystem-3.8-6.el8.aarch64 1/1 Preparing : 1/1 Installing : libgcc-8.5.0-16.el8_7.aarch64 1/174 Running scriptlet: libgcc-8.5.0-16.el8_7.aarch64 1/174 Installing : python-srpm-macros-3-43.el8.noarch 2/174 Installing : crypto-policies-20211116-1.gitae470d6.el8.noarch 3/174 Running scriptlet: crypto-policies-20211116-1.gitae470d6.el8.noarch 3/174 Installing : python-rpm-macros-3-43.el8.noarch 4/174 Installing : redhat-release-8.7-0.3.el8.aarch64 5/174 Installing : setup-2.12.2-7.el8.noarch 6/174 warning: /etc/hosts created as /etc/hosts.rpmnew Running scriptlet: setup-2.12.2-7.el8.noarch 6/174 Installing : filesystem-3.8-6.el8.aarch64 7/174 Installing : python3-pip-wheel-9.0.3-22.el8.noarch 8/174 Installing : python3-setuptools-wheel-39.2.0-6.el8.noarch 9/174 Installing : basesystem-11-5.el8.noarch 10/174 Installing : python3-rpm-macros-3-43.el8.noarch 11/174 Installing : fpc-srpm-macros-1.3-1.el8.noarch 12/174 Installing : ansible-srpm-macros-1-8.1.el8.noarch 13/174 Installing : qt5-srpm-macros-5.15.3-1.el8.noarch 14/174 Installing : go-srpm-macros-2-17.el8.noarch 15/174 Installing : perl-srpm-macros-1-25.el8.noarch 16/174 Installing : openblas-srpm-macros-2-2.el8.noarch 17/174 Installing : ghc-srpm-macros-1.4.2-7.el8.noarch 18/174 Installing : ocaml-srpm-macros-5-4.el8.noarch 19/174 Installing : rust-srpm-macros-5-2.el8.noarch 20/174 Installing : kernel-headers-4.18.0-425.10.1.el8_7.aarch64 21/174 Installing : tzdata-2022g-1.el8.noarch 22/174 Installing : libssh-config-0.9.6-3.el8.noarch 23/174 Installing : ncurses-base-6.1-9.20180224.el8.noarch 24/174 Installing : pcre2-10.32-3.el8_6.aarch64 25/174 Installing : libselinux-2.9-6.el8.aarch64 26/174 Installing : ncurses-libs-6.1-9.20180224.el8.aarch64 27/174 Installing : glibc-gconv-extra-2.28-211.el8.aarch64 28/174 Running scriptlet: glibc-gconv-extra-2.28-211.el8.aarch64 28/174 Installing : glibc-all-langpacks-2.28-211.el8.aarch64 29/174 Installing : glibc-common-2.28-211.el8.aarch64 30/174 Running scriptlet: glibc-2.28-211.el8.aarch64 31/174 Installing : glibc-2.28-211.el8.aarch64 31/174 Running scriptlet: glibc-2.28-211.el8.aarch64 31/174 Installing : bash-4.4.20-4.el8_6.aarch64 32/174 Running scriptlet: bash-4.4.20-4.el8_6.aarch64 32/174 Installing : libsepol-2.9-3.el8.aarch64 33/174 Running scriptlet: libsepol-2.9-3.el8.aarch64 33/174 Installing : zlib-1.2.11-21.el8_7.aarch64 34/174 Installing : info-6.5-7.el8.aarch64 35/174 Installing : bzip2-libs-1.0.6-26.el8.aarch64 36/174 Installing : gmp-1:6.1.2-10.el8.aarch64 37/174 Running scriptlet: gmp-1:6.1.2-10.el8.aarch64 37/174 Installing : xz-libs-5.2.4-4.el8_6.aarch64 38/174 Installing : libstdc++-8.5.0-16.el8_7.aarch64 39/174 Running scriptlet: libstdc++-8.5.0-16.el8_7.aarch64 39/174 Installing : elfutils-libelf-0.187-4.el8.aarch64 40/174 Installing : libxcrypt-4.1.1-6.el8.aarch64 41/174 Installing : mpfr-3.1.6-1.el8.aarch64 42/174 Running scriptlet: mpfr-3.1.6-1.el8.aarch64 42/174 Installing : readline-7.0-10.el8.aarch64 43/174 Running scriptlet: readline-7.0-10.el8.aarch64 43/174 Installing : sqlite-libs-3.26.0-17.el8_7.aarch64 44/174 Installing : libzstd-1.4.4-1.el8.aarch64 45/174 Installing : popt-1.18-1.el8.aarch64 46/174 Installing : libcap-2.48-4.el8.aarch64 47/174 Installing : libcom_err-1.45.6-5.el8.aarch64 48/174 Running scriptlet: libcom_err-1.45.6-5.el8.aarch64 48/174 Installing : libuuid-2.32.1-39.el8_7.aarch64 49/174 Running scriptlet: libuuid-2.32.1-39.el8_7.aarch64 49/174 Installing : chkconfig-1.19.1-1.el8.aarch64 50/174 Installing : libunistring-0.9.9-3.el8.aarch64 51/174 Installing : libattr-2.4.48-3.el8.aarch64 52/174 Installing : libacl-2.2.53-1.el8.aarch64 53/174 Installing : sed-4.5-5.el8.aarch64 54/174 Running scriptlet: sed-4.5-5.el8.aarch64 54/174 Installing : libgpg-error-1.31-1.el8.aarch64 55/174 Installing : lua-libs-5.3.4-12.el8.aarch64 56/174 Installing : libffi-3.1-23.el8.aarch64 57/174 Installing : p11-kit-0.23.22-1.el8.aarch64 58/174 Installing : libidn2-2.2.0-1.el8.aarch64 59/174 Installing : libmpc-1.1.0-9.1.el8.aarch64 60/174 Installing : file-libs-5.33-21.el8.aarch64 61/174 Installing : file-5.33-21.el8.aarch64 62/174 Installing : libgcrypt-1.8.5-7.el8_6.aarch64 63/174 Running scriptlet: libgcrypt-1.8.5-7.el8_6.aarch64 63/174 Installing : unzip-6.0-46.el8.aarch64 64/174 Installing : findutils-1:4.6.0-20.el8.aarch64 65/174 Running scriptlet: findutils-1:4.6.0-20.el8.aarch64 65/174 Running scriptlet: glibc-headers-2.28-211.el8.aarch64 66/174 Installing : glibc-headers-2.28-211.el8.aarch64 66/174 Installing : elfutils-default-yama-scope-0.187-4.el8.noarch 67/174 Running scriptlet: elfutils-default-yama-scope-0.187-4.el8.noarch 67/174 Installing : elfutils-libs-0.187-4.el8.aarch64 68/174 Installing : lz4-libs-1.8.3-3.el8_4.aarch64 69/174 Installing : pcre-8.42-6.el8.aarch64 70/174 Installing : grep-3.1-6.el8.aarch64 71/174 Running scriptlet: grep-3.1-6.el8.aarch64 71/174 Installing : keyutils-libs-1.5.10-9.el8.aarch64 72/174 Installing : libcap-ng-0.7.11-1.el8.aarch64 73/174 Installing : audit-libs-3.0.7-4.el8.aarch64 74/174 Installing : gdbm-libs-1:1.18-2.el8.aarch64 75/174 Installing : libtasn1-4.13-4.el8_7.aarch64 76/174 Running scriptlet: libtasn1-4.13-4.el8_7.aarch64 76/174 Installing : p11-kit-trust-0.23.22-1.el8.aarch64 77/174 Running scriptlet: p11-kit-trust-0.23.22-1.el8.aarch64 77/174 Installing : expat-2.2.5-10.el8_7.1.aarch64 78/174 Installing : gdbm-1:1.18-2.el8.aarch64 79/174 Installing : libsemanage-2.9-9.el8_6.aarch64 80/174 Installing : xz-5.2.4-4.el8_6.aarch64 81/174 Installing : elfutils-0.187-4.el8.aarch64 82/174 Installing : zip-3.0-23.el8.aarch64 83/174 Installing : cpp-8.5.0-16.el8_7.aarch64 84/174 Running scriptlet: cpp-8.5.0-16.el8_7.aarch64 84/174 Installing : libassuan-2.5.1-3.el8.aarch64 85/174 Installing : libksba-1.3.5-8.el8_6.aarch64 86/174 Installing : tar-2:1.30-6.el8.aarch64 87/174 Running scriptlet: tar-2:1.30-6.el8.aarch64 87/174 Installing : patch-2.7.6-11.el8.aarch64 88/174 Installing : dwz-0.12-10.el8.aarch64 89/174 Installing : libasan-8.5.0-16.el8_7.aarch64 90/174 Running scriptlet: libasan-8.5.0-16.el8_7.aarch64 90/174 Installing : libubsan-8.5.0-16.el8_7.aarch64 91/174 Running scriptlet: libubsan-8.5.0-16.el8_7.aarch64 91/174 Installing : libstdc++-devel-8.5.0-16.el8_7.aarch64 92/174 Installing : libxml2-2.9.7-15.el8_7.1.aarch64 93/174 Installing : nettle-3.4.1-7.el8.aarch64 94/174 Running scriptlet: nettle-3.4.1-7.el8.aarch64 94/174 Installing : gnutls-3.6.16-5.el8_6.aarch64 95/174 Installing : isl-0.16.1-6.el8.aarch64 96/174 Running scriptlet: isl-0.16.1-6.el8.aarch64 96/174 Installing : bzip2-1.0.6-26.el8.aarch64 97/174 Installing : diffutils-3.6-6.el8.aarch64 98/174 Running scriptlet: diffutils-3.6-6.el8.aarch64 98/174 Installing : coreutils-common-8.30-13.el8.aarch64 99/174 Running scriptlet: coreutils-common-8.30-13.el8.aarch64 99/174 Installing : libatomic-8.5.0-16.el8_7.aarch64 100/174 Running scriptlet: libatomic-8.5.0-16.el8_7.aarch64 100/174 Installing : libgomp-8.5.0-16.el8_7.aarch64 101/174 Running scriptlet: libgomp-8.5.0-16.el8_7.aarch64 101/174 Installing : zstd-1.4.4-1.el8.aarch64 102/174 Installing : libsigsegv-2.11-5.el8.aarch64 103/174 Installing : gawk-4.2.1-4.el8.aarch64 104/174 Installing : libtool-ltdl-2.4.6-25.el8.aarch64 105/174 Running scriptlet: libtool-ltdl-2.4.6-25.el8.aarch64 105/174 Installing : libpkgconf-1.4.2-1.el8.aarch64 106/174 Installing : pkgconf-1.4.2-1.el8.aarch64 107/174 Installing : npth-1.5-4.el8.aarch64 108/174 Installing : libnghttp2-1.33.0-3.el8_2.1.aarch64 109/174 Installing : brotli-1.0.6-3.el8.aarch64 110/174 Installing : ncurses-6.1-9.20180224.el8.aarch64 111/174 Installing : openssl-libs-1:1.1.1k-7.el8_6.aarch64 112/174 Running scriptlet: openssl-libs-1:1.1.1k-7.el8_6.aarch64 112/174 Installing : coreutils-8.30-13.el8.aarch64 113/174 Running scriptlet: ca-certificates-2022.2.54-80.2.el8_6.noarch 114/174 Installing : ca-certificates-2022.2.54-80.2.el8_6.noarch 114/174 Running scriptlet: ca-certificates-2022.2.54-80.2.el8_6.noarch 114/174 Installing : libdb-5.3.28-42.el8_4.aarch64 115/174 Running scriptlet: libdb-5.3.28-42.el8_4.aarch64 115/174 Installing : libblkid-2.32.1-39.el8_7.aarch64 116/174 Running scriptlet: libblkid-2.32.1-39.el8_7.aarch64 116/174 Installing : libmount-2.32.1-39.el8_7.aarch64 117/174 Running scriptlet: libmount-2.32.1-39.el8_7.aarch64 117/174 Installing : systemd-libs-239-68.el8_7.2.aarch64 118/174 Running scriptlet: systemd-libs-239-68.el8_7.2.aarch64 118/174 Installing : gzip-1.9-13.el8_5.aarch64 119/174 Running scriptlet: gzip-1.9-13.el8_5.aarch64 119/174 Installing : cracklib-2.9.6-15.el8.aarch64 120/174 Installing : cracklib-dicts-2.9.6-15.el8.aarch64 121/174 Installing : shadow-utils-2:4.6-17.el8.aarch64 122/174 Installing : binutils-2.30-117.el8.aarch64 123/174 Running scriptlet: binutils-2.30-117.el8.aarch64 123/174 Running scriptlet: libutempter-1.1.6-14.el8.aarch64 124/174 Installing : libutempter-1.1.6-14.el8.aarch64 124/174 Running scriptlet: tpm2-tss-2.3.2-4.el8.aarch64 125/174 Installing : tpm2-tss-2.3.2-4.el8.aarch64 125/174 Running scriptlet: tpm2-tss-2.3.2-4.el8.aarch64 125/174 Installing : ima-evm-utils-1.3.2-12.el8.aarch64 126/174 Installing : libusbx-1.0.23-4.el8.aarch64 127/174 Installing : glib2-2.56.4-159.el8.aarch64 128/174 Installing : libbabeltrace-1.5.4-4.el8.aarch64 129/174 Running scriptlet: libbabeltrace-1.5.4-4.el8.aarch64 129/174 Installing : libfdisk-2.32.1-39.el8_7.aarch64 130/174 Running scriptlet: libfdisk-2.32.1-39.el8_7.aarch64 130/174 Installing : libdb-utils-5.3.28-42.el8_4.aarch64 131/174 Installing : libarchive-3.3.3-4.el8.aarch64 132/174 Installing : cpio-2.12-11.el8.aarch64 133/174 Installing : libverto-0.3.2-2.el8.aarch64 134/174 Installing : krb5-libs-1.18.2-22.el8_7.aarch64 135/174 Installing : libtirpc-1.1.4-8.el8.aarch64 136/174 Running scriptlet: libtirpc-1.1.4-8.el8.aarch64 136/174 Installing : libnsl2-1.2.0-2.20180605git4a062cf.el8.aarch64 137/174 Running scriptlet: libnsl2-1.2.0-2.20180605git4a062cf.el8.aarch64 137/174 Installing : libpwquality-1.4.4-5.el8.aarch64 138/174 Installing : pam-1.3.1-22.el8.aarch64 139/174 Running scriptlet: pam-1.3.1-22.el8.aarch64 139/174 Installing : platform-python-setuptools-39.2.0-6.el8.noarch 140/174 Installing : platform-python-3.6.8-48.el8_7.aarch64 141/174 Running scriptlet: platform-python-3.6.8-48.el8_7.aarch64 141/174 Installing : python3-libs-3.6.8-48.el8_7.aarch64 142/174 Installing : cyrus-sasl-lib-2.1.27-6.el8_5.aarch64 143/174 Running scriptlet: cyrus-sasl-lib-2.1.27-6.el8_5.aarch64 143/174 Installing : openldap-2.4.46-18.el8.aarch64 144/174 Installing : gnupg2-2.2.20-3.el8_6.aarch64 145/174 Installing : libssh-0.9.6-3.el8.aarch64 146/174 Installing : libsmartcols-2.32.1-39.el8_7.aarch64 147/174 Running scriptlet: libsmartcols-2.32.1-39.el8_7.aarch64 147/174 Installing : libatomic_ops-7.6.2-3.el8.aarch64 148/174 Installing : gc-7.6.4-3.el8.aarch64 149/174 Installing : guile-5:2.0.14-7.el8.aarch64 150/174 Running scriptlet: guile-5:2.0.14-7.el8.aarch64 150/174 Installing : pkgconf-m4-1.4.2-1.el8.noarch 151/174 Installing : pkgconf-pkg-config-1.4.2-1.el8.aarch64 152/174 Installing : glibc-devel-2.28-211.el8.aarch64 153/174 Running scriptlet: glibc-devel-2.28-211.el8.aarch64 153/174 Installing : libxcrypt-devel-4.1.1-6.el8.aarch64 154/174 Installing : gcc-8.5.0-16.el8_7.aarch64 155/174 Running scriptlet: gcc-8.5.0-16.el8_7.aarch64 155/174 Installing : annobin-10.67-3.el8.aarch64 156/174 Installing : gcc-plugin-annobin-8.5.0-16.el8_7.aarch64 157/174 Installing : publicsuffix-list-dafsa-20180723-1.el8.noarch 158/174 Installing : libpsl-0.20.2-6.el8.aarch64 159/174 Installing : libcurl-7.61.1-25.el8_7.1.aarch64 160/174 Installing : curl-7.61.1-25.el8_7.1.aarch64 161/174 Installing : rpm-libs-4.14.3-24.el8_7.aarch64 162/174 Running scriptlet: rpm-libs-4.14.3-24.el8_7.aarch64 162/174 Installing : rpm-4.14.3-24.el8_7.aarch64 163/174 Installing : efi-srpm-macros-3-3.el8.noarch 164/174 Installing : redhat-rpm-config-130-1.el8.noarch 165/174 Running scriptlet: redhat-rpm-config-130-1.el8.noarch 165/174 Installing : lua-srpm-macros-1-3.el8.noarch 166/174 Installing : rpm-build-libs-4.14.3-24.el8_7.aarch64 167/174 Running scriptlet: rpm-build-libs-4.14.3-24.el8_7.aarch64 167/174 Installing : gdb-headless-8.2-19.el8.aarch64 168/174 Installing : rpm-build-4.14.3-24.el8_7.aarch64 169/174 Installing : epel-rpm-macros-8-35.noarch 170/174 Installing : gcc-c++-8.5.0-16.el8_7.aarch64 171/174 Installing : util-linux-2.32.1-39.el8_7.aarch64 172/174 Running scriptlet: util-linux-2.32.1-39.el8_7.aarch64 172/174 Installing : which-2.21-18.el8.aarch64 173/174 Installing : make-1:4.2.1-11.el8.aarch64 174/174 Running scriptlet: make-1:4.2.1-11.el8.aarch64 174/174 Running scriptlet: filesystem-3.8-6.el8.aarch64 174/174 Running scriptlet: glibc-all-langpacks-2.28-211.el8.aarch64 174/174 Running scriptlet: ca-certificates-2022.2.54-80.2.el8_6.noarch 174/174 Running scriptlet: guile-5:2.0.14-7.el8.aarch64 174/174 Running scriptlet: make-1:4.2.1-11.el8.aarch64 174/174 Verifying : bzip2-libs-1.0.6-26.el8.aarch64 1/174 Verifying : libsigsegv-2.11-5.el8.aarch64 2/174 Verifying : libassuan-2.5.1-3.el8.aarch64 3/174 Verifying : pkgconf-1.4.2-1.el8.aarch64 4/174 Verifying : zip-3.0-23.el8.aarch64 5/174 Verifying : libutempter-1.1.6-14.el8.aarch64 6/174 Verifying : readline-7.0-10.el8.aarch64 7/174 Verifying : libtool-ltdl-2.4.6-25.el8.aarch64 8/174 Verifying : libnsl2-1.2.0-2.20180605git4a062cf.el8.aarch64 9/174 Verifying : libattr-2.4.48-3.el8.aarch64 10/174 Verifying : libpkgconf-1.4.2-1.el8.aarch64 11/174 Verifying : bzip2-1.0.6-26.el8.aarch64 12/174 Verifying : libunistring-0.9.9-3.el8.aarch64 13/174 Verifying : cracklib-dicts-2.9.6-15.el8.aarch64 14/174 Verifying : grep-3.1-6.el8.aarch64 15/174 Verifying : findutils-1:4.6.0-20.el8.aarch64 16/174 Verifying : libgpg-error-1.31-1.el8.aarch64 17/174 Verifying : libacl-2.2.53-1.el8.aarch64 18/174 Verifying : mpfr-3.1.6-1.el8.aarch64 19/174 Verifying : pkgconf-pkg-config-1.4.2-1.el8.aarch64 20/174 Verifying : cracklib-2.9.6-15.el8.aarch64 21/174 Verifying : npth-1.5-4.el8.aarch64 22/174 Verifying : publicsuffix-list-dafsa-20180723-1.el8.noarch 23/174 Verifying : pkgconf-m4-1.4.2-1.el8.noarch 24/174 Verifying : basesystem-11-5.el8.noarch 25/174 Verifying : libidn2-2.2.0-1.el8.aarch64 26/174 Verifying : gmp-1:6.1.2-10.el8.aarch64 27/174 Verifying : diffutils-3.6-6.el8.aarch64 28/174 Verifying : patch-2.7.6-11.el8.aarch64 29/174 Verifying : libnghttp2-1.33.0-3.el8_2.1.aarch64 30/174 Verifying : libusbx-1.0.23-4.el8.aarch64 31/174 Verifying : platform-python-setuptools-39.2.0-6.el8.noarch 32/174 Verifying : python3-setuptools-wheel-39.2.0-6.el8.noarch 33/174 Verifying : libpsl-0.20.2-6.el8.aarch64 34/174 Verifying : libzstd-1.4.4-1.el8.aarch64 35/174 Verifying : popt-1.18-1.el8.aarch64 36/174 Verifying : p11-kit-trust-0.23.22-1.el8.aarch64 37/174 Verifying : ima-evm-utils-1.3.2-12.el8.aarch64 38/174 Verifying : brotli-1.0.6-3.el8.aarch64 39/174 Verifying : libsepol-2.9-3.el8.aarch64 40/174 Verifying : ncurses-libs-6.1-9.20180224.el8.aarch64 41/174 Verifying : chkconfig-1.19.1-1.el8.aarch64 42/174 Verifying : libdb-utils-5.3.28-42.el8_4.aarch64 43/174 Verifying : openldap-2.4.46-18.el8.aarch64 44/174 Verifying : p11-kit-0.23.22-1.el8.aarch64 45/174 Verifying : libdb-5.3.28-42.el8_4.aarch64 46/174 Verifying : nettle-3.4.1-7.el8.aarch64 47/174 Verifying : lz4-libs-1.8.3-3.el8_4.aarch64 48/174 Verifying : pcre-8.42-6.el8.aarch64 49/174 Verifying : tpm2-tss-2.3.2-4.el8.aarch64 50/174 Verifying : ncurses-6.1-9.20180224.el8.aarch64 51/174 Verifying : make-1:4.2.1-11.el8.aarch64 52/174 Verifying : ncurses-base-6.1-9.20180224.el8.noarch 53/174 Verifying : keyutils-libs-1.5.10-9.el8.aarch64 54/174 Verifying : cyrus-sasl-lib-2.1.27-6.el8_5.aarch64 55/174 Verifying : libcap-ng-0.7.11-1.el8.aarch64 56/174 Verifying : libxcrypt-devel-4.1.1-6.el8.aarch64 57/174 Verifying : libxcrypt-4.1.1-6.el8.aarch64 58/174 Verifying : filesystem-3.8-6.el8.aarch64 59/174 Verifying : lua-libs-5.3.4-12.el8.aarch64 60/174 Verifying : gzip-1.9-13.el8_5.aarch64 61/174 Verifying : libffi-3.1-23.el8.aarch64 62/174 Verifying : xz-5.2.4-4.el8_6.aarch64 63/174 Verifying : unzip-6.0-46.el8.aarch64 64/174 Verifying : info-6.5-7.el8.aarch64 65/174 Verifying : xz-libs-5.2.4-4.el8_6.aarch64 66/174 Verifying : cpio-2.12-11.el8.aarch64 67/174 Verifying : python3-pip-wheel-9.0.3-22.el8.noarch 68/174 Verifying : sed-4.5-5.el8.aarch64 69/174 Verifying : crypto-policies-20211116-1.gitae470d6.el8.noarch 70/174 Verifying : gawk-4.2.1-4.el8.aarch64 71/174 Verifying : libssh-0.9.6-3.el8.aarch64 72/174 Verifying : libssh-config-0.9.6-3.el8.noarch 73/174 Verifying : libverto-0.3.2-2.el8.aarch64 74/174 Verifying : redhat-release-8.7-0.3.el8.aarch64 75/174 Verifying : libpwquality-1.4.4-5.el8.aarch64 76/174 Verifying : libcap-2.48-4.el8.aarch64 77/174 Verifying : elfutils-libs-0.187-4.el8.aarch64 78/174 Verifying : glibc-headers-2.28-211.el8.aarch64 79/174 Verifying : which-2.21-18.el8.aarch64 80/174 Verifying : libtirpc-1.1.4-8.el8.aarch64 81/174 Verifying : openssl-libs-1:1.1.1k-7.el8_6.aarch64 82/174 Verifying : glibc-common-2.28-211.el8.aarch64 83/174 Verifying : gdbm-1:1.18-2.el8.aarch64 84/174 Verifying : glib2-2.56.4-159.el8.aarch64 85/174 Verifying : libgcrypt-1.8.5-7.el8_6.aarch64 86/174 Verifying : elfutils-libelf-0.187-4.el8.aarch64 87/174 Verifying : shadow-utils-2:4.6-17.el8.aarch64 88/174 Verifying : pam-1.3.1-22.el8.aarch64 89/174 Verifying : tar-2:1.30-6.el8.aarch64 90/174 Verifying : file-5.33-21.el8.aarch64 91/174 Verifying : glibc-gconv-extra-2.28-211.el8.aarch64 92/174 Verifying : gnutls-3.6.16-5.el8_6.aarch64 93/174 Verifying : glibc-all-langpacks-2.28-211.el8.aarch64 94/174 Verifying : gnupg2-2.2.20-3.el8_6.aarch64 95/174 Verifying : elfutils-0.187-4.el8.aarch64 96/174 Verifying : libsemanage-2.9-9.el8_6.aarch64 97/174 Verifying : setup-2.12.2-7.el8.noarch 98/174 Verifying : ca-certificates-2022.2.54-80.2.el8_6.noarch 99/174 Verifying : coreutils-common-8.30-13.el8.aarch64 100/174 Verifying : libarchive-3.3.3-4.el8.aarch64 101/174 Verifying : pcre2-10.32-3.el8_6.aarch64 102/174 Verifying : libbabeltrace-1.5.4-4.el8.aarch64 103/174 Verifying : glibc-devel-2.28-211.el8.aarch64 104/174 Verifying : coreutils-8.30-13.el8.aarch64 105/174 Verifying : libcom_err-1.45.6-5.el8.aarch64 106/174 Verifying : bash-4.4.20-4.el8_6.aarch64 107/174 Verifying : gdbm-libs-1:1.18-2.el8.aarch64 108/174 Verifying : libselinux-2.9-6.el8.aarch64 109/174 Verifying : binutils-2.30-117.el8.aarch64 110/174 Verifying : elfutils-default-yama-scope-0.187-4.el8.noarch 111/174 Verifying : libksba-1.3.5-8.el8_6.aarch64 112/174 Verifying : file-libs-5.33-21.el8.aarch64 113/174 Verifying : glibc-2.28-211.el8.aarch64 114/174 Verifying : audit-libs-3.0.7-4.el8.aarch64 115/174 Verifying : platform-python-3.6.8-48.el8_7.aarch64 116/174 Verifying : rpm-libs-4.14.3-24.el8_7.aarch64 117/174 Verifying : rpm-build-libs-4.14.3-24.el8_7.aarch64 118/174 Verifying : rpm-4.14.3-24.el8_7.aarch64 119/174 Verifying : python3-libs-3.6.8-48.el8_7.aarch64 120/174 Verifying : krb5-libs-1.18.2-22.el8_7.aarch64 121/174 Verifying : tzdata-2022g-1.el8.noarch 122/174 Verifying : libgcc-8.5.0-16.el8_7.aarch64 123/174 Verifying : libasan-8.5.0-16.el8_7.aarch64 124/174 Verifying : libatomic-8.5.0-16.el8_7.aarch64 125/174 Verifying : libtasn1-4.13-4.el8_7.aarch64 126/174 Verifying : libsmartcols-2.32.1-39.el8_7.aarch64 127/174 Verifying : libubsan-8.5.0-16.el8_7.aarch64 128/174 Verifying : zlib-1.2.11-21.el8_7.aarch64 129/174 Verifying : libblkid-2.32.1-39.el8_7.aarch64 130/174 Verifying : systemd-libs-239-68.el8_7.2.aarch64 131/174 Verifying : util-linux-2.32.1-39.el8_7.aarch64 132/174 Verifying : sqlite-libs-3.26.0-17.el8_7.aarch64 133/174 Verifying : kernel-headers-4.18.0-425.10.1.el8_7.aarch64 134/174 Verifying : libcurl-7.61.1-25.el8_7.1.aarch64 135/174 Verifying : libgomp-8.5.0-16.el8_7.aarch64 136/174 Verifying : libfdisk-2.32.1-39.el8_7.aarch64 137/174 Verifying : libuuid-2.32.1-39.el8_7.aarch64 138/174 Verifying : expat-2.2.5-10.el8_7.1.aarch64 139/174 Verifying : libstdc++-8.5.0-16.el8_7.aarch64 140/174 Verifying : curl-7.61.1-25.el8_7.1.aarch64 141/174 Verifying : libmount-2.32.1-39.el8_7.aarch64 142/174 Verifying : libxml2-2.9.7-15.el8_7.1.aarch64 143/174 Verifying : guile-5:2.0.14-7.el8.aarch64 144/174 Verifying : isl-0.16.1-6.el8.aarch64 145/174 Verifying : libatomic_ops-7.6.2-3.el8.aarch64 146/174 Verifying : gc-7.6.4-3.el8.aarch64 147/174 Verifying : rust-srpm-macros-5-2.el8.noarch 148/174 Verifying : ocaml-srpm-macros-5-4.el8.noarch 149/174 Verifying : ghc-srpm-macros-1.4.2-7.el8.noarch 150/174 Verifying : openblas-srpm-macros-2-2.el8.noarch 151/174 Verifying : perl-srpm-macros-1-25.el8.noarch 152/174 Verifying : zstd-1.4.4-1.el8.aarch64 153/174 Verifying : efi-srpm-macros-3-3.el8.noarch 154/174 Verifying : libmpc-1.1.0-9.1.el8.aarch64 155/174 Verifying : go-srpm-macros-2-17.el8.noarch 156/174 Verifying : dwz-0.12-10.el8.aarch64 157/174 Verifying : gdb-headless-8.2-19.el8.aarch64 158/174 Verifying : qt5-srpm-macros-5.15.3-1.el8.noarch 159/174 Verifying : python3-rpm-macros-3-43.el8.noarch 160/174 Verifying : redhat-rpm-config-130-1.el8.noarch 161/174 Verifying : annobin-10.67-3.el8.aarch64 162/174 Verifying : python-rpm-macros-3-43.el8.noarch 163/174 Verifying : python-srpm-macros-3-43.el8.noarch 164/174 Verifying : rpm-build-4.14.3-24.el8_7.aarch64 165/174 Verifying : gcc-plugin-annobin-8.5.0-16.el8_7.aarch64 166/174 Verifying : gcc-8.5.0-16.el8_7.aarch64 167/174 Verifying : gcc-c++-8.5.0-16.el8_7.aarch64 168/174 Verifying : libstdc++-devel-8.5.0-16.el8_7.aarch64 169/174 Verifying : cpp-8.5.0-16.el8_7.aarch64 170/174 Verifying : ansible-srpm-macros-1-8.1.el8.noarch 171/174 Verifying : epel-rpm-macros-8-35.noarch 172/174 Verifying : fpc-srpm-macros-1.3-1.el8.noarch 173/174 Verifying : lua-srpm-macros-1-3.el8.noarch 174/174 Installed products updated. Installed: annobin-10.67-3.el8.aarch64 ansible-srpm-macros-1-8.1.el8.noarch audit-libs-3.0.7-4.el8.aarch64 basesystem-11-5.el8.noarch bash-4.4.20-4.el8_6.aarch64 binutils-2.30-117.el8.aarch64 brotli-1.0.6-3.el8.aarch64 bzip2-1.0.6-26.el8.aarch64 bzip2-libs-1.0.6-26.el8.aarch64 ca-certificates-2022.2.54-80.2.el8_6.noarch chkconfig-1.19.1-1.el8.aarch64 coreutils-8.30-13.el8.aarch64 coreutils-common-8.30-13.el8.aarch64 cpio-2.12-11.el8.aarch64 cpp-8.5.0-16.el8_7.aarch64 cracklib-2.9.6-15.el8.aarch64 cracklib-dicts-2.9.6-15.el8.aarch64 crypto-policies-20211116-1.gitae470d6.el8.noarch curl-7.61.1-25.el8_7.1.aarch64 cyrus-sasl-lib-2.1.27-6.el8_5.aarch64 diffutils-3.6-6.el8.aarch64 dwz-0.12-10.el8.aarch64 efi-srpm-macros-3-3.el8.noarch elfutils-0.187-4.el8.aarch64 elfutils-default-yama-scope-0.187-4.el8.noarch elfutils-libelf-0.187-4.el8.aarch64 elfutils-libs-0.187-4.el8.aarch64 epel-rpm-macros-8-35.noarch expat-2.2.5-10.el8_7.1.aarch64 file-5.33-21.el8.aarch64 file-libs-5.33-21.el8.aarch64 filesystem-3.8-6.el8.aarch64 findutils-1:4.6.0-20.el8.aarch64 fpc-srpm-macros-1.3-1.el8.noarch gawk-4.2.1-4.el8.aarch64 gc-7.6.4-3.el8.aarch64 gcc-8.5.0-16.el8_7.aarch64 gcc-c++-8.5.0-16.el8_7.aarch64 gcc-plugin-annobin-8.5.0-16.el8_7.aarch64 gdb-headless-8.2-19.el8.aarch64 gdbm-1:1.18-2.el8.aarch64 gdbm-libs-1:1.18-2.el8.aarch64 ghc-srpm-macros-1.4.2-7.el8.noarch glib2-2.56.4-159.el8.aarch64 glibc-2.28-211.el8.aarch64 glibc-all-langpacks-2.28-211.el8.aarch64 glibc-common-2.28-211.el8.aarch64 glibc-devel-2.28-211.el8.aarch64 glibc-gconv-extra-2.28-211.el8.aarch64 glibc-headers-2.28-211.el8.aarch64 gmp-1:6.1.2-10.el8.aarch64 gnupg2-2.2.20-3.el8_6.aarch64 gnutls-3.6.16-5.el8_6.aarch64 go-srpm-macros-2-17.el8.noarch grep-3.1-6.el8.aarch64 guile-5:2.0.14-7.el8.aarch64 gzip-1.9-13.el8_5.aarch64 ima-evm-utils-1.3.2-12.el8.aarch64 info-6.5-7.el8.aarch64 isl-0.16.1-6.el8.aarch64 kernel-headers-4.18.0-425.10.1.el8_7.aarch64 keyutils-libs-1.5.10-9.el8.aarch64 krb5-libs-1.18.2-22.el8_7.aarch64 libacl-2.2.53-1.el8.aarch64 libarchive-3.3.3-4.el8.aarch64 libasan-8.5.0-16.el8_7.aarch64 libassuan-2.5.1-3.el8.aarch64 libatomic-8.5.0-16.el8_7.aarch64 libatomic_ops-7.6.2-3.el8.aarch64 libattr-2.4.48-3.el8.aarch64 libbabeltrace-1.5.4-4.el8.aarch64 libblkid-2.32.1-39.el8_7.aarch64 libcap-2.48-4.el8.aarch64 libcap-ng-0.7.11-1.el8.aarch64 libcom_err-1.45.6-5.el8.aarch64 libcurl-7.61.1-25.el8_7.1.aarch64 libdb-5.3.28-42.el8_4.aarch64 libdb-utils-5.3.28-42.el8_4.aarch64 libfdisk-2.32.1-39.el8_7.aarch64 libffi-3.1-23.el8.aarch64 libgcc-8.5.0-16.el8_7.aarch64 libgcrypt-1.8.5-7.el8_6.aarch64 libgomp-8.5.0-16.el8_7.aarch64 libgpg-error-1.31-1.el8.aarch64 libidn2-2.2.0-1.el8.aarch64 libksba-1.3.5-8.el8_6.aarch64 libmount-2.32.1-39.el8_7.aarch64 libmpc-1.1.0-9.1.el8.aarch64 libnghttp2-1.33.0-3.el8_2.1.aarch64 libnsl2-1.2.0-2.20180605git4a062cf.el8.aarch64 libpkgconf-1.4.2-1.el8.aarch64 libpsl-0.20.2-6.el8.aarch64 libpwquality-1.4.4-5.el8.aarch64 libselinux-2.9-6.el8.aarch64 libsemanage-2.9-9.el8_6.aarch64 libsepol-2.9-3.el8.aarch64 libsigsegv-2.11-5.el8.aarch64 libsmartcols-2.32.1-39.el8_7.aarch64 libssh-0.9.6-3.el8.aarch64 libssh-config-0.9.6-3.el8.noarch libstdc++-8.5.0-16.el8_7.aarch64 libstdc++-devel-8.5.0-16.el8_7.aarch64 libtasn1-4.13-4.el8_7.aarch64 libtirpc-1.1.4-8.el8.aarch64 libtool-ltdl-2.4.6-25.el8.aarch64 libubsan-8.5.0-16.el8_7.aarch64 libunistring-0.9.9-3.el8.aarch64 libusbx-1.0.23-4.el8.aarch64 libutempter-1.1.6-14.el8.aarch64 libuuid-2.32.1-39.el8_7.aarch64 libverto-0.3.2-2.el8.aarch64 libxcrypt-4.1.1-6.el8.aarch64 libxcrypt-devel-4.1.1-6.el8.aarch64 libxml2-2.9.7-15.el8_7.1.aarch64 libzstd-1.4.4-1.el8.aarch64 lua-libs-5.3.4-12.el8.aarch64 lua-srpm-macros-1-3.el8.noarch lz4-libs-1.8.3-3.el8_4.aarch64 make-1:4.2.1-11.el8.aarch64 mpfr-3.1.6-1.el8.aarch64 ncurses-6.1-9.20180224.el8.aarch64 ncurses-base-6.1-9.20180224.el8.noarch ncurses-libs-6.1-9.20180224.el8.aarch64 nettle-3.4.1-7.el8.aarch64 npth-1.5-4.el8.aarch64 ocaml-srpm-macros-5-4.el8.noarch openblas-srpm-macros-2-2.el8.noarch openldap-2.4.46-18.el8.aarch64 openssl-libs-1:1.1.1k-7.el8_6.aarch64 p11-kit-0.23.22-1.el8.aarch64 p11-kit-trust-0.23.22-1.el8.aarch64 pam-1.3.1-22.el8.aarch64 patch-2.7.6-11.el8.aarch64 pcre-8.42-6.el8.aarch64 pcre2-10.32-3.el8_6.aarch64 perl-srpm-macros-1-25.el8.noarch pkgconf-1.4.2-1.el8.aarch64 pkgconf-m4-1.4.2-1.el8.noarch pkgconf-pkg-config-1.4.2-1.el8.aarch64 platform-python-3.6.8-48.el8_7.aarch64 platform-python-setuptools-39.2.0-6.el8.noarch popt-1.18-1.el8.aarch64 publicsuffix-list-dafsa-20180723-1.el8.noarch python-rpm-macros-3-43.el8.noarch python-srpm-macros-3-43.el8.noarch python3-libs-3.6.8-48.el8_7.aarch64 python3-pip-wheel-9.0.3-22.el8.noarch python3-rpm-macros-3-43.el8.noarch python3-setuptools-wheel-39.2.0-6.el8.noarch qt5-srpm-macros-5.15.3-1.el8.noarch readline-7.0-10.el8.aarch64 redhat-release-8.7-0.3.el8.aarch64 redhat-rpm-config-130-1.el8.noarch rpm-4.14.3-24.el8_7.aarch64 rpm-build-4.14.3-24.el8_7.aarch64 rpm-build-libs-4.14.3-24.el8_7.aarch64 rpm-libs-4.14.3-24.el8_7.aarch64 rust-srpm-macros-5-2.el8.noarch sed-4.5-5.el8.aarch64 setup-2.12.2-7.el8.noarch shadow-utils-2:4.6-17.el8.aarch64 sqlite-libs-3.26.0-17.el8_7.aarch64 systemd-libs-239-68.el8_7.2.aarch64 tar-2:1.30-6.el8.aarch64 tpm2-tss-2.3.2-4.el8.aarch64 tzdata-2022g-1.el8.noarch unzip-6.0-46.el8.aarch64 util-linux-2.32.1-39.el8_7.aarch64 which-2.21-18.el8.aarch64 xz-5.2.4-4.el8_6.aarch64 xz-libs-5.2.4-4.el8_6.aarch64 zip-3.0-23.el8.aarch64 zlib-1.2.11-21.el8_7.aarch64 zstd-1.4.4-1.el8.aarch64 Complete! No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 90 kB/s | 3.6 kB 00:00 Red Hat Enterprise Linux - BaseOS 35 kB/s | 4.1 kB 00:00 Red Hat Enterprise Linux - AppStream 45 kB/s | 4.5 kB 00:00 Red Hat Enterprise Linux - CodeReady Linux Buil 46 kB/s | 4.5 kB 00:00 Extra Packages for Enterprise Linux 8 - aarch64 66 kB/s | 21 kB 00:00 Dependencies resolved. ================================================================================ Package Arch Version Repository Size ================================================================================ Installing: scl-utils-build aarch64 1:2.0.2-15.el8 rhel-appstream 26 k Installing dependencies: iso-codes noarch 3.79-2.el8 rhel-appstream 3.4 M xml-common noarch 0.6.3-50.el8 rhel-baseos 39 k Transaction Summary ================================================================================ Install 3 Packages Total download size: 3.5 M Installed size: 17 M Downloading Packages: (1/3): xml-common-0.6.3-50.el8.noarch.rpm 276 kB/s | 39 kB 00:00 (2/3): iso-codes-3.79-2.el8.noarch.rpm 18 MB/s | 3.4 MB 00:00 (3/3): scl-utils-build-2.0.2-15.el8.aarch64.rpm 122 kB/s | 26 kB 00:00 -------------------------------------------------------------------------------- Total 16 MB/s | 3.5 MB 00:00 Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Preparing : 1/1 Running scriptlet: xml-common-0.6.3-50.el8.noarch 1/3 Installing : xml-common-0.6.3-50.el8.noarch 1/3 Installing : iso-codes-3.79-2.el8.noarch 2/3 Installing : scl-utils-build-1:2.0.2-15.el8.aarch64 3/3 Running scriptlet: scl-utils-build-1:2.0.2-15.el8.aarch64 3/3 Verifying : xml-common-0.6.3-50.el8.noarch 1/3 Verifying : iso-codes-3.79-2.el8.noarch 2/3 Verifying : scl-utils-build-1:2.0.2-15.el8.aarch64 3/3 Installed products updated. Installed: iso-codes-3.79-2.el8.noarch scl-utils-build-1:2.0.2-15.el8.aarch64 xml-common-0.6.3-50.el8.noarch Complete! Finish: dnf install Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: libassuan-2.5.1-3.el8.aarch64 libtool-ltdl-2.4.6-25.el8.aarch64 gzip-1.9-13.el8_5.aarch64 libgcc-8.5.0-16.el8_7.aarch64 libnsl2-1.2.0-2.20180605git4a062cf.el8.aarch64 libcap-2.48-4.el8.aarch64 libgomp-8.5.0-16.el8_7.aarch64 python3-libs-3.6.8-48.el8_7.aarch64 libatomic_ops-7.6.2-3.el8.aarch64 libacl-2.2.53-1.el8.aarch64 publicsuffix-list-dafsa-20180723-1.el8.noarch keyutils-libs-1.5.10-9.el8.aarch64 readline-7.0-10.el8.aarch64 ansible-srpm-macros-1-8.1.el8.noarch coreutils-8.30-13.el8.aarch64 libutempter-1.1.6-14.el8.aarch64 elfutils-0.187-4.el8.aarch64 lz4-libs-1.8.3-3.el8_4.aarch64 libstdc++-8.5.0-16.el8_7.aarch64 libssh-config-0.9.6-3.el8.noarch scl-utils-build-2.0.2-15.el8.aarch64 ncurses-base-6.1-9.20180224.el8.noarch tar-1.30-6.el8.aarch64 libgpg-error-1.31-1.el8.aarch64 libpsl-0.20.2-6.el8.aarch64 libsigsegv-2.11-5.el8.aarch64 qt5-srpm-macros-5.15.3-1.el8.noarch python3-rpm-macros-3-43.el8.noarch epel-rpm-macros-8-35.noarch libdb-utils-5.3.28-42.el8_4.aarch64 go-srpm-macros-2-17.el8.noarch guile-2.0.14-7.el8.aarch64 ima-evm-utils-1.3.2-12.el8.aarch64 libksba-1.3.5-8.el8_6.aarch64 bzip2-libs-1.0.6-26.el8.aarch64 chkconfig-1.19.1-1.el8.aarch64 rpm-build-4.14.3-24.el8_7.aarch64 tpm2-tss-2.3.2-4.el8.aarch64 gcc-c++-8.5.0-16.el8_7.aarch64 libstdc++-devel-8.5.0-16.el8_7.aarch64 cpio-2.12-11.el8.aarch64 npth-1.5-4.el8.aarch64 glibc-devel-2.28-211.el8.aarch64 popt-1.18-1.el8.aarch64 bash-4.4.20-4.el8_6.aarch64 expat-2.2.5-10.el8_7.1.aarch64 gpg-pubkey-2fa658e0-45700c69 glibc-common-2.28-211.el8.aarch64 make-4.2.1-11.el8.aarch64 libssh-0.9.6-3.el8.aarch64 ghc-srpm-macros-1.4.2-7.el8.noarch libzstd-1.4.4-1.el8.aarch64 ncurses-libs-6.1-9.20180224.el8.aarch64 libidn2-2.2.0-1.el8.aarch64 libcurl-7.61.1-25.el8_7.1.aarch64 pkgconf-1.4.2-1.el8.aarch64 gdb-headless-8.2-19.el8.aarch64 openblas-srpm-macros-2-2.el8.noarch libuuid-2.32.1-39.el8_7.aarch64 libbabeltrace-1.5.4-4.el8.aarch64 findutils-4.6.0-20.el8.aarch64 fpc-srpm-macros-1.3-1.el8.noarch xz-libs-5.2.4-4.el8_6.aarch64 libnghttp2-1.33.0-3.el8_2.1.aarch64 pam-1.3.1-22.el8.aarch64 gc-7.6.4-3.el8.aarch64 efi-srpm-macros-3-3.el8.noarch libcom_err-1.45.6-5.el8.aarch64 zip-3.0-23.el8.aarch64 p11-kit-0.23.22-1.el8.aarch64 zstd-1.4.4-1.el8.aarch64 libxcrypt-devel-4.1.1-6.el8.aarch64 annobin-10.67-3.el8.aarch64 cracklib-2.9.6-15.el8.aarch64 libxml2-2.9.7-15.el8_7.1.aarch64 libgcrypt-1.8.5-7.el8_6.aarch64 info-6.5-7.el8.aarch64 coreutils-common-8.30-13.el8.aarch64 gpg-pubkey-2f86d6a1-5cf7cefb kernel-headers-4.18.0-425.10.1.el8_7.aarch64 glib2-2.56.4-159.el8.aarch64 libdb-5.3.28-42.el8_4.aarch64 libatomic-8.5.0-16.el8_7.aarch64 patch-2.7.6-11.el8.aarch64 bzip2-1.0.6-26.el8.aarch64 brotli-1.0.6-3.el8.aarch64 libsmartcols-2.32.1-39.el8_7.aarch64 rpm-libs-4.14.3-24.el8_7.aarch64 perl-srpm-macros-1-25.el8.noarch file-libs-5.33-21.el8.aarch64 libubsan-8.5.0-16.el8_7.aarch64 libarchive-3.3.3-4.el8.aarch64 pcre2-10.32-3.el8_6.aarch64 platform-python-setuptools-39.2.0-6.el8.noarch ncurses-6.1-9.20180224.el8.aarch64 iso-codes-3.79-2.el8.noarch binutils-2.30-117.el8.aarch64 libunistring-0.9.9-3.el8.aarch64 tzdata-2022g-1.el8.noarch gdbm-1.18-2.el8.aarch64 gnupg2-2.2.20-3.el8_6.aarch64 glibc-all-langpacks-2.28-211.el8.aarch64 systemd-libs-239-68.el8_7.2.aarch64 platform-python-3.6.8-48.el8_7.aarch64 mpfr-3.1.6-1.el8.aarch64 nettle-3.4.1-7.el8.aarch64 rpm-4.14.3-24.el8_7.aarch64 rpm-build-libs-4.14.3-24.el8_7.aarch64 filesystem-3.8-6.el8.aarch64 p11-kit-trust-0.23.22-1.el8.aarch64 xz-5.2.4-4.el8_6.aarch64 redhat-release-8.7-0.3.el8.aarch64 libusbx-1.0.23-4.el8.aarch64 pkgconf-m4-1.4.2-1.el8.noarch libcap-ng-0.7.11-1.el8.aarch64 unzip-6.0-46.el8.aarch64 libpwquality-1.4.4-5.el8.aarch64 sqlite-libs-3.26.0-17.el8_7.aarch64 libmount-2.32.1-39.el8_7.aarch64 grep-3.1-6.el8.aarch64 python-rpm-macros-3-43.el8.noarch python3-setuptools-wheel-39.2.0-6.el8.noarch python-srpm-macros-3-43.el8.noarch libasan-8.5.0-16.el8_7.aarch64 gawk-4.2.1-4.el8.aarch64 audit-libs-3.0.7-4.el8.aarch64 libsepol-2.9-3.el8.aarch64 dwz-0.12-10.el8.aarch64 ca-certificates-2022.2.54-80.2.el8_6.noarch rust-srpm-macros-5-2.el8.noarch glibc-gconv-extra-2.28-211.el8.aarch64 gnutls-3.6.16-5.el8_6.aarch64 zlib-1.2.11-21.el8_7.aarch64 ocaml-srpm-macros-5-4.el8.noarch which-2.21-18.el8.aarch64 lua-libs-5.3.4-12.el8.aarch64 gcc-plugin-annobin-8.5.0-16.el8_7.aarch64 redhat-rpm-config-130-1.el8.noarch gcc-8.5.0-16.el8_7.aarch64 gpg-pubkey-fd431d51-4ae0493b pkgconf-pkg-config-1.4.2-1.el8.aarch64 libsemanage-2.9-9.el8_6.aarch64 libfdisk-2.32.1-39.el8_7.aarch64 libpkgconf-1.4.2-1.el8.aarch64 python3-pip-wheel-9.0.3-22.el8.noarch util-linux-2.32.1-39.el8_7.aarch64 krb5-libs-1.18.2-22.el8_7.aarch64 crypto-policies-20211116-1.gitae470d6.el8.noarch gmp-6.1.2-10.el8.aarch64 elfutils-default-yama-scope-0.187-4.el8.noarch gdbm-libs-1.18-2.el8.aarch64 xml-common-0.6.3-50.el8.noarch libtasn1-4.13-4.el8_7.aarch64 diffutils-3.6-6.el8.aarch64 setup-2.12.2-7.el8.noarch lua-srpm-macros-1-3.el8.noarch cyrus-sasl-lib-2.1.27-6.el8_5.aarch64 elfutils-libs-0.187-4.el8.aarch64 sed-4.5-5.el8.aarch64 libxcrypt-4.1.1-6.el8.aarch64 shadow-utils-4.6-17.el8.aarch64 elfutils-libelf-0.187-4.el8.aarch64 libselinux-2.9-6.el8.aarch64 libtirpc-1.1.4-8.el8.aarch64 libattr-2.4.48-3.el8.aarch64 file-5.33-21.el8.aarch64 glibc-2.28-211.el8.aarch64 libblkid-2.32.1-39.el8_7.aarch64 curl-7.61.1-25.el8_7.1.aarch64 libmpc-1.1.0-9.1.el8.aarch64 isl-0.16.1-6.el8.aarch64 libffi-3.1-23.el8.aarch64 openldap-2.4.46-18.el8.aarch64 openssl-libs-1.1.1k-7.el8_6.aarch64 pcre-8.42-6.el8.aarch64 libverto-0.3.2-2.el8.aarch64 basesystem-11-5.el8.noarch glibc-headers-2.28-211.el8.aarch64 cpp-8.5.0-16.el8_7.aarch64 cracklib-dicts-2.9.6-15.el8.aarch64 Start: buildsrpm Start: rpmbuild -bs Building target platforms: aarch64 Building for target aarch64 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-1.el8.src.rpm Finish: rpmbuild -bs cp: ‘var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root/var/log’: No such file or directory INFO: chroot_scan: 3 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root/var/log/dnf.rpm.log /var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root/var/log/dnf.librepo.log /var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root/var/log/dnf.log Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-h9vcoh26/bowtie/bowtie.spec) Config(child) 1 minutes 9 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running (timeout=18000): unbuffer mock --rebuild /var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.el8.src.rpm --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1674075943.812535 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 3.5 starting (python version = 3.11.0, NVR = mock-3.5-1.fc37)... Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.el8.src.rpm) Config(rhel+epel-8-aarch64) Start: clean chroot Finish: clean chroot Start: chroot init INFO: mounting tmpfs at /var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin Mock Version: 3.5 INFO: Mock Version: 3.5 Start: dnf update No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 105 kB/s | 3.6 kB 00:00 Red Hat Enterprise Linux - BaseOS 21 kB/s | 4.1 kB 00:00 Red Hat Enterprise Linux - AppStream 47 kB/s | 4.5 kB 00:00 Red Hat Enterprise Linux - CodeReady Linux Buil 32 kB/s | 4.5 kB 00:00 Extra Packages for Enterprise Linux 8 - aarch64 137 kB/s | 21 kB 00:00 Dependencies resolved. Nothing to do. Complete! Finish: dnf update Finish: chroot init Start: build phase for bowtie-1.3.1-1.el8.src.rpm Start: build setup for bowtie-1.3.1-1.el8.src.rpm Building target platforms: aarch64 Building for target aarch64 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-1.el8.src.rpm No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 53 kB/s | 3.6 kB 00:00 Red Hat Enterprise Linux - BaseOS 42 kB/s | 4.1 kB 00:00 Red Hat Enterprise Linux - AppStream 47 kB/s | 4.5 kB 00:00 Red Hat Enterprise Linux - CodeReady Linux Buil 32 kB/s | 4.5 kB 00:00 Extra Packages for Enterprise Linux 8 - aarch64 253 kB/s | 21 kB 00:00 Package gcc-c++-8.5.0-16.el8_7.aarch64 is already installed. Package make-1:4.2.1-11.el8.aarch64 is already installed. Dependencies resolved. ================================================================================================== Package Arch Version Repository Size ================================================================================================== Installing: hostname aarch64 3.20-6.el8 rhel-baseos 32 k perl-Clone aarch64 0.39-5.el8 codeready-builder 24 k perl-Data-Dumper aarch64 2.167-399.el8 rhel-baseos 57 k perl-Getopt-Long noarch 1:2.50-4.el8 rhel-baseos 63 k perl-Test-Deep noarch 1.127-4.el8 codeready-builder 69 k perl-interpreter aarch64 4:5.26.3-421.el8 rhel-baseos 6.3 M python36 aarch64 3.6.8-38.module+el8.5.0+12207+5c5719bc rhel-appstream 19 k tbb-devel aarch64 2018.2-9.el8 rhel-appstream 324 k zlib-devel aarch64 1.2.11-21.el8_7 rhel-baseos 58 k Installing dependencies: groff-base aarch64 1.22.3-18.el8 rhel-baseos 994 k perl-Carp noarch 1.42-396.el8 rhel-baseos 30 k perl-Encode aarch64 4:2.97-3.el8 rhel-baseos 1.5 M perl-Errno aarch64 1.28-421.el8 rhel-baseos 76 k perl-Exporter noarch 5.72-396.el8 rhel-baseos 34 k perl-File-Path noarch 2.15-2.el8 rhel-baseos 38 k perl-File-Temp noarch 0.230.600-1.el8 rhel-baseos 63 k perl-HTTP-Tiny noarch 0.074-1.el8 rhel-baseos 58 k perl-IO aarch64 1.38-421.el8 rhel-baseos 142 k perl-MIME-Base64 aarch64 3.15-396.el8 rhel-baseos 31 k perl-PathTools aarch64 3.74-1.el8 rhel-baseos 90 k perl-Pod-Escapes noarch 1:1.07-395.el8 rhel-baseos 20 k perl-Pod-Perldoc noarch 3.28-396.el8 rhel-baseos 88 k perl-Pod-Simple noarch 1:3.35-395.el8 rhel-baseos 213 k perl-Pod-Usage noarch 4:1.69-395.el8 rhel-baseos 34 k perl-Scalar-List-Utils aarch64 3:1.49-2.el8 rhel-baseos 67 k perl-Socket aarch64 4:2.027-3.el8 rhel-baseos 59 k perl-Storable aarch64 1:3.11-3.el8 rhel-baseos 95 k perl-Term-ANSIColor noarch 4.06-396.el8 rhel-baseos 46 k perl-Term-Cap noarch 1.17-395.el8 rhel-baseos 23 k perl-Test-Simple noarch 1:1.302135-1.el8 rhel-appstream 516 k perl-Text-ParseWords noarch 3.30-395.el8 rhel-baseos 18 k perl-Text-Tabs+Wrap noarch 2013.0523-395.el8 rhel-baseos 24 k perl-Time-Local noarch 1:1.280-1.el8 rhel-baseos 34 k perl-Unicode-Normalize aarch64 1.25-396.el8 rhel-baseos 78 k perl-constant noarch 1.33-396.el8 rhel-baseos 25 k perl-libs aarch64 4:5.26.3-421.el8 rhel-baseos 1.5 M perl-macros aarch64 4:5.26.3-421.el8 rhel-baseos 72 k perl-parent noarch 1:0.237-1.el8 rhel-baseos 20 k perl-podlators noarch 4.11-1.el8 rhel-baseos 118 k perl-threads aarch64 1:2.21-2.el8 rhel-baseos 60 k perl-threads-shared aarch64 1.58-2.el8 rhel-baseos 47 k platform-python-pip noarch 9.0.3-22.el8 rhel-baseos 1.6 M python3-pip noarch 9.0.3-22.el8 rhel-appstream 20 k python3-setuptools noarch 39.2.0-6.el8 rhel-baseos 163 k tbb aarch64 2018.2-9.el8 rhel-appstream 140 k Enabling module streams: python36 3.6 Transaction Summary ================================================================================================== Install 45 Packages Total download size: 15 M Installed size: 50 M Downloading Packages: (1/45): perl-MIME-Base64-3.15-396.el8.aarch64.r 275 kB/s | 31 kB 00:00 (2/45): perl-Scalar-List-Utils-1.49-2.el8.aarch 433 kB/s | 67 kB 00:00 (3/45): groff-base-1.22.3-18.el8.aarch64.rpm 5.4 MB/s | 994 kB 00:00 (4/45): perl-PathTools-3.74-1.el8.aarch64.rpm 639 kB/s | 90 kB 00:00 (5/45): perl-Data-Dumper-2.167-399.el8.aarch64. 722 kB/s | 57 kB 00:00 (6/45): perl-Storable-3.11-3.el8.aarch64.rpm 857 kB/s | 95 kB 00:00 (7/45): perl-Unicode-Normalize-1.25-396.el8.aar 1.0 MB/s | 78 kB 00:00 (8/45): perl-threads-2.21-2.el8.aarch64.rpm 448 kB/s | 60 kB 00:00 (9/45): hostname-3.20-6.el8.aarch64.rpm 297 kB/s | 32 kB 00:00 (10/45): perl-Encode-2.97-3.el8.aarch64.rpm 8.0 MB/s | 1.5 MB 00:00 (11/45): perl-threads-shared-1.58-2.el8.aarch64 665 kB/s | 47 kB 00:00 (12/45): perl-Pod-Simple-3.35-395.el8.noarch.rp 3.1 MB/s | 213 kB 00:00 (13/45): perl-HTTP-Tiny-0.074-1.el8.noarch.rpm 934 kB/s | 58 kB 00:00 (14/45): perl-Term-ANSIColor-4.06-396.el8.noarc 310 kB/s | 46 kB 00:00 (15/45): perl-Pod-Escapes-1.07-395.el8.noarch.r 224 kB/s | 20 kB 00:00 (16/45): perl-File-Path-2.15-2.el8.noarch.rpm 702 kB/s | 38 kB 00:00 (17/45): perl-Socket-2.027-3.el8.aarch64.rpm 201 kB/s | 59 kB 00:00 (18/45): perl-parent-0.237-1.el8.noarch.rpm 141 kB/s | 20 kB 00:00 (19/45): perl-Pod-Perldoc-3.28-396.el8.noarch.r 371 kB/s | 88 kB 00:00 (20/45): perl-podlators-4.11-1.el8.noarch.rpm 951 kB/s | 118 kB 00:00 (21/45): perl-Getopt-Long-2.50-4.el8.noarch.rpm 480 kB/s | 63 kB 00:00 (22/45): perl-Text-Tabs+Wrap-2013.0523-395.el8. 154 kB/s | 24 kB 00:00 (23/45): perl-Carp-1.42-396.el8.noarch.rpm 569 kB/s | 30 kB 00:00 (24/45): perl-Time-Local-1.280-1.el8.noarch.rpm 454 kB/s | 34 kB 00:00 (25/45): perl-Text-ParseWords-3.30-395.el8.noar 279 kB/s | 18 kB 00:00 (26/45): perl-File-Temp-0.230.600-1.el8.noarch. 912 kB/s | 63 kB 00:00 (27/45): perl-Exporter-5.72-396.el8.noarch.rpm 194 kB/s | 34 kB 00:00 (28/45): perl-Pod-Usage-1.69-395.el8.noarch.rpm 662 kB/s | 34 kB 00:00 (29/45): perl-constant-1.33-396.el8.noarch.rpm 169 kB/s | 25 kB 00:00 (30/45): perl-Term-Cap-1.17-395.el8.noarch.rpm 163 kB/s | 23 kB 00:00 (31/45): python3-setuptools-39.2.0-6.el8.noarch 3.0 MB/s | 163 kB 00:00 (32/45): perl-IO-1.38-421.el8.aarch64.rpm 2.1 MB/s | 142 kB 00:00 (33/45): platform-python-pip-9.0.3-22.el8.noarc 22 MB/s | 1.6 MB 00:00 (34/45): perl-macros-5.26.3-421.el8.aarch64.rpm 838 kB/s | 72 kB 00:00 (35/45): perl-libs-5.26.3-421.el8.aarch64.rpm 19 MB/s | 1.5 MB 00:00 (36/45): perl-Errno-1.28-421.el8.aarch64.rpm 720 kB/s | 76 kB 00:00 (37/45): zlib-devel-1.2.11-21.el8_7.aarch64.rpm 1.1 MB/s | 58 kB 00:00 (38/45): perl-interpreter-5.26.3-421.el8.aarch6 34 MB/s | 6.3 MB 00:00 (39/45): tbb-2018.2-9.el8.aarch64.rpm 2.2 MB/s | 140 kB 00:00 (40/45): python36-3.6.8-38.module+el8.5.0+12207 369 kB/s | 19 kB 00:00 (41/45): perl-Test-Simple-1.302135-1.el8.noarch 7.8 MB/s | 516 kB 00:00 (42/45): python3-pip-9.0.3-22.el8.noarch.rpm 339 kB/s | 20 kB 00:00 (43/45): perl-Test-Deep-1.127-4.el8.noarch.rpm 108 kB/s | 69 kB 00:00 (44/45): tbb-devel-2018.2-9.el8.aarch64.rpm 378 kB/s | 324 kB 00:00 (45/45): perl-Clone-0.39-5.el8.aarch64.rpm 27 kB/s | 24 kB 00:00 -------------------------------------------------------------------------------- Total 6.0 MB/s | 15 MB 00:02 Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Preparing : 1/1 Installing : tbb-2018.2-9.el8.aarch64 1/45 Running scriptlet: tbb-2018.2-9.el8.aarch64 1/45 Installing : platform-python-pip-9.0.3-22.el8.noarch 2/45 Installing : python3-setuptools-39.2.0-6.el8.noarch 3/45 Installing : python3-pip-9.0.3-22.el8.noarch 4/45 Installing : python36-3.6.8-38.module+el8.5.0+12207+5c5719bc.aa 5/45 Running scriptlet: python36-3.6.8-38.module+el8.5.0+12207+5c5719bc.aa 5/45 Installing : groff-base-1.22.3-18.el8.aarch64 6/45 Installing : perl-Pod-Escapes-1:1.07-395.el8.noarch 7/45 Installing : perl-Time-Local-1:1.280-1.el8.noarch 8/45 Installing : perl-Term-ANSIColor-4.06-396.el8.noarch 9/45 Installing : perl-File-Temp-0.230.600-1.el8.noarch 10/45 Installing : perl-Term-Cap-1.17-395.el8.noarch 11/45 Installing : perl-Pod-Simple-1:3.35-395.el8.noarch 12/45 Installing : perl-HTTP-Tiny-0.074-1.el8.noarch 13/45 Installing : perl-podlators-4.11-1.el8.noarch 14/45 Installing : perl-Pod-Perldoc-3.28-396.el8.noarch 15/45 Installing : perl-Text-ParseWords-3.30-395.el8.noarch 16/45 Installing : perl-Pod-Usage-4:1.69-395.el8.noarch 17/45 Installing : perl-Storable-1:3.11-3.el8.aarch64 18/45 Installing : perl-Getopt-Long-1:2.50-4.el8.noarch 19/45 Installing : perl-MIME-Base64-3.15-396.el8.aarch64 20/45 Installing : perl-Socket-4:2.027-3.el8.aarch64 21/45 Installing : perl-Errno-1.28-421.el8.aarch64 22/45 Installing : perl-Encode-4:2.97-3.el8.aarch64 23/45 Installing : perl-parent-1:0.237-1.el8.noarch 24/45 Installing : perl-Scalar-List-Utils-3:1.49-2.el8.aarch64 25/45 Installing : perl-Carp-1.42-396.el8.noarch 26/45 Installing : perl-Exporter-5.72-396.el8.noarch 27/45 Installing : perl-libs-4:5.26.3-421.el8.aarch64 28/45 Installing : perl-macros-4:5.26.3-421.el8.aarch64 29/45 Installing : perl-Unicode-Normalize-1.25-396.el8.aarch64 30/45 Installing : perl-threads-shared-1.58-2.el8.aarch64 31/45 Installing : perl-threads-1:2.21-2.el8.aarch64 32/45 Installing : perl-Text-Tabs+Wrap-2013.0523-395.el8.noarch 33/45 Installing : perl-File-Path-2.15-2.el8.noarch 34/45 Installing : perl-PathTools-3.74-1.el8.aarch64 35/45 Installing : perl-constant-1.33-396.el8.noarch 36/45 Installing : perl-IO-1.38-421.el8.aarch64 37/45 Installing : perl-interpreter-4:5.26.3-421.el8.aarch64 38/45 Installing : perl-Data-Dumper-2.167-399.el8.aarch64 39/45 Installing : perl-Test-Simple-1:1.302135-1.el8.noarch 40/45 Installing : perl-Test-Deep-1.127-4.el8.noarch 41/45 Installing : perl-Clone-0.39-5.el8.aarch64 42/45 Installing : tbb-devel-2018.2-9.el8.aarch64 43/45 Installing : zlib-devel-1.2.11-21.el8_7.aarch64 44/45 Installing : hostname-3.20-6.el8.aarch64 45/45 Running scriptlet: hostname-3.20-6.el8.aarch64 45/45 Verifying : perl-MIME-Base64-3.15-396.el8.aarch64 1/45 Verifying : perl-Scalar-List-Utils-3:1.49-2.el8.aarch64 2/45 Verifying : groff-base-1.22.3-18.el8.aarch64 3/45 Verifying : perl-PathTools-3.74-1.el8.aarch64 4/45 Verifying : perl-Storable-1:3.11-3.el8.aarch64 5/45 Verifying : perl-Data-Dumper-2.167-399.el8.aarch64 6/45 Verifying : perl-Unicode-Normalize-1.25-396.el8.aarch64 7/45 Verifying : perl-Encode-4:2.97-3.el8.aarch64 8/45 Verifying : perl-threads-1:2.21-2.el8.aarch64 9/45 Verifying : hostname-3.20-6.el8.aarch64 10/45 Verifying : perl-threads-shared-1.58-2.el8.aarch64 11/45 Verifying : perl-Pod-Simple-1:3.35-395.el8.noarch 12/45 Verifying : perl-Term-ANSIColor-4.06-396.el8.noarch 13/45 Verifying : perl-HTTP-Tiny-0.074-1.el8.noarch 14/45 Verifying : perl-Socket-4:2.027-3.el8.aarch64 15/45 Verifying : perl-Pod-Escapes-1:1.07-395.el8.noarch 16/45 Verifying : perl-Pod-Perldoc-3.28-396.el8.noarch 17/45 Verifying : perl-File-Path-2.15-2.el8.noarch 18/45 Verifying : perl-parent-1:0.237-1.el8.noarch 19/45 Verifying : perl-Text-Tabs+Wrap-2013.0523-395.el8.noarch 20/45 Verifying : perl-Getopt-Long-1:2.50-4.el8.noarch 21/45 Verifying : perl-podlators-4.11-1.el8.noarch 22/45 Verifying : perl-Time-Local-1:1.280-1.el8.noarch 23/45 Verifying : perl-Carp-1.42-396.el8.noarch 24/45 Verifying : perl-Exporter-5.72-396.el8.noarch 25/45 Verifying : perl-Text-ParseWords-3.30-395.el8.noarch 26/45 Verifying : perl-File-Temp-0.230.600-1.el8.noarch 27/45 Verifying : perl-constant-1.33-396.el8.noarch 28/45 Verifying : perl-Term-Cap-1.17-395.el8.noarch 29/45 Verifying : perl-Pod-Usage-4:1.69-395.el8.noarch 30/45 Verifying : python3-setuptools-39.2.0-6.el8.noarch 31/45 Verifying : perl-IO-1.38-421.el8.aarch64 32/45 Verifying : platform-python-pip-9.0.3-22.el8.noarch 33/45 Verifying : perl-macros-4:5.26.3-421.el8.aarch64 34/45 Verifying : perl-interpreter-4:5.26.3-421.el8.aarch64 35/45 Verifying : perl-Errno-1.28-421.el8.aarch64 36/45 Verifying : perl-libs-4:5.26.3-421.el8.aarch64 37/45 Verifying : zlib-devel-1.2.11-21.el8_7.aarch64 38/45 Verifying : tbb-2018.2-9.el8.aarch64 39/45 Verifying : tbb-devel-2018.2-9.el8.aarch64 40/45 Verifying : perl-Test-Simple-1:1.302135-1.el8.noarch 41/45 Verifying : python36-3.6.8-38.module+el8.5.0+12207+5c5719bc.aa 42/45 Verifying : python3-pip-9.0.3-22.el8.noarch 43/45 Verifying : perl-Test-Deep-1.127-4.el8.noarch 44/45 Verifying : perl-Clone-0.39-5.el8.aarch64 45/45 Installed products updated. Installed: groff-base-1.22.3-18.el8.aarch64 hostname-3.20-6.el8.aarch64 perl-Carp-1.42-396.el8.noarch perl-Clone-0.39-5.el8.aarch64 perl-Data-Dumper-2.167-399.el8.aarch64 perl-Encode-4:2.97-3.el8.aarch64 perl-Errno-1.28-421.el8.aarch64 perl-Exporter-5.72-396.el8.noarch perl-File-Path-2.15-2.el8.noarch perl-File-Temp-0.230.600-1.el8.noarch perl-Getopt-Long-1:2.50-4.el8.noarch perl-HTTP-Tiny-0.074-1.el8.noarch perl-IO-1.38-421.el8.aarch64 perl-MIME-Base64-3.15-396.el8.aarch64 perl-PathTools-3.74-1.el8.aarch64 perl-Pod-Escapes-1:1.07-395.el8.noarch perl-Pod-Perldoc-3.28-396.el8.noarch perl-Pod-Simple-1:3.35-395.el8.noarch perl-Pod-Usage-4:1.69-395.el8.noarch perl-Scalar-List-Utils-3:1.49-2.el8.aarch64 perl-Socket-4:2.027-3.el8.aarch64 perl-Storable-1:3.11-3.el8.aarch64 perl-Term-ANSIColor-4.06-396.el8.noarch perl-Term-Cap-1.17-395.el8.noarch perl-Test-Deep-1.127-4.el8.noarch perl-Test-Simple-1:1.302135-1.el8.noarch perl-Text-ParseWords-3.30-395.el8.noarch perl-Text-Tabs+Wrap-2013.0523-395.el8.noarch perl-Time-Local-1:1.280-1.el8.noarch perl-Unicode-Normalize-1.25-396.el8.aarch64 perl-constant-1.33-396.el8.noarch perl-interpreter-4:5.26.3-421.el8.aarch64 perl-libs-4:5.26.3-421.el8.aarch64 perl-macros-4:5.26.3-421.el8.aarch64 perl-parent-1:0.237-1.el8.noarch perl-podlators-4.11-1.el8.noarch perl-threads-1:2.21-2.el8.aarch64 perl-threads-shared-1.58-2.el8.aarch64 platform-python-pip-9.0.3-22.el8.noarch python3-pip-9.0.3-22.el8.noarch python3-setuptools-39.2.0-6.el8.noarch python36-3.6.8-38.module+el8.5.0+12207+5c5719bc.aarch64 tbb-2018.2-9.el8.aarch64 tbb-devel-2018.2-9.el8.aarch64 zlib-devel-1.2.11-21.el8_7.aarch64 Complete! Finish: build setup for bowtie-1.3.1-1.el8.src.rpm Start: rpmbuild bowtie-1.3.1-1.el8.src.rpm Building target platforms: aarch64 Building for target aarch64 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.kVzQyF + umask 022 + cd /builddir/build/BUILD + cd /builddir/build/BUILD + rm -rf bowtie-1.3.1-src + /usr/bin/unzip -qq /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie-inspect + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.6zGdED + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + export POPCNT_CAPABILITY=0 + POPCNT_CAPABILITY=0 + /usr/bin/make -O -j4 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:16\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]': ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] list_[cur_++] = el; ^~~~~ ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]': ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] list_[cur_++] = el; ^~~~~ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:16\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread In file included from ebwt_build.cpp:8: ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = S2bDnaString]': ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] list_[cur_++] = el; ^~~~~ ds.h: In function 'void mkeyQSortSuf2(const T&, size_t, TIndexOffU*, size_t, TIndexOffU*, int, size_t, size_t, size_t, size_t, EList*) [with T = SString]': ds.h:497:3: warning: 'tmp3' may be used uninitialized in this function [-Wmaybe-uninitialized] list_[cur_++] = el; ^~~~~ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:16\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:27\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:16\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:16\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:27\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:38\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:39\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:44\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:38\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both \"" -g -Wl,--hash-style=both \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:39\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.WiMz3H + umask 022 + cd /builddir/build/BUILD + '[' /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64 '!=' / ']' + rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64 ++ dirname /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64 + mkdir -p /builddir/build/BUILDROOT + mkdir /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64 + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin ; \ done + mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/share/bowtie + cp -a reads /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64//usr/bin/ + /usr/lib/rpm/find-debuginfo.sh -j4 --strict-build-id -m -i --build-id-seed 1.3.1-1.el8 --unique-debug-suffix -1.3.1-1.el8.aarch64 --unique-debug-src-base bowtie-1.3.1-1.el8.aarch64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 50000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-src extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-align-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-align-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-align-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-align-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-build-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-build-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-build-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-build-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-inspect-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-inspect-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-inspect-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/bin/bowtie-inspect-s-debug /usr/lib/rpm/sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. 2930 blocks + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig /sbin/ldconfig: Warning: ignoring configuration file that cannot be opened: /etc/ld.so.conf: No such file or directory + /usr/lib/rpm/brp-compress + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/brp-python-bytecompile '' 1 + /usr/lib/rpm/brp-python-hardlink + PYTHON3=/usr/bin/python3.6 + /usr/lib/rpm/redhat/brp-mangle-shebangs Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.eedYGr + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/DNA.pm scripts/test/all.sh scripts/test/args.pl scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/btdata.py scripts/test/btface.py scripts/test/build_big.py scripts/test/cs_dec.pl scripts/test/cs_trim.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/large_idx.py scripts/test/long_read.pl scripts/test/random_bowtie_tests.pl scripts/test/random_bowtie_tests.sh scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl Hunk #2 succeeded at 993 (offset -135 lines). + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted 0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments PASSED + exit 0 Processing files: bowtie-1.3.1-1.el8.aarch64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.H1pjp4 + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/doc/bowtie + export LC_ALL=C + LC_ALL=C + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/doc/bowtie + cp -pr MANUAL /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/doc/bowtie + cp -pr NEWS /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/doc/bowtie + cp -pr VERSION /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/doc/bowtie + cp -pr AUTHORS /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/doc/bowtie + cp -pr TUTORIAL /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/doc/bowtie + cp -pr doc/manual.html doc/style.css /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/doc/bowtie + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.EXP6EW + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/licenses/bowtie + export LC_ALL=C + LC_ALL=C + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/licenses/bowtie + cp -pr LICENSE /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64/usr/share/licenses/bowtie + exit 0 Provides: bowtie = 1.3.1-1.el8 bowtie(aarch-64) = 1.3.1-1.el8 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /bin/bash /bin/sh /usr/bin/perl /usr/bin/python3.6 libc.so.6()(64bit) libc.so.6(GLIBC_2.17)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.17)(64bit) libm.so.6(GLIBC_2.27)(64bit) libpthread.so.0()(64bit) libpthread.so.0(GLIBC_2.17)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-1.el8.aarch64 Provides: bowtie-debugsource = 1.3.1-1.el8 bowtie-debugsource(aarch-64) = 1.3.1-1.el8 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-1.el8.aarch64 Provides: bowtie-debuginfo = 1.3.1-1.el8 bowtie-debuginfo(aarch-64) = 1.3.1-1.el8 debuginfo(build-id) = 063f73f8ea528e06b06a3c2d616106c77f03364b debuginfo(build-id) = 0fc227e1d077dc7ff1ca017c9e7482a185f01347 debuginfo(build-id) = 2c0ec2f89b626e2b5ba6f1bb3c12c786d498faa6 debuginfo(build-id) = 3ad513b96ad4408bbacc184b959567c498fe1f41 debuginfo(build-id) = 463c0060a49f30bd3b926424b4a5c66b07452210 debuginfo(build-id) = 718f3854b898e92e1b84cf64bae4cbe06bf0aecd debuginfo(build-id) = 813c8142ee34a4d56aa58eb3df5fb05772617a43 debuginfo(build-id) = 8cb79b2273a6dfe5cdb9aae2cc2af3475e14da5b debuginfo(build-id) = 98005b8af4eb8ae21bf176c375d921df71237036 debuginfo(build-id) = e6d7e5f044f96f37b74500ddcf6070a570e0d61b debuginfo(build-id) = eaf680764c4c91ea149e1d4aec831faf7b12c3eb debuginfo(build-id) = fac732a3727f5d5362f24077fd45d79b8bddf5d5 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(aarch-64) = 1.3.1-1.el8 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64 Wrote: /builddir/build/RPMS/bowtie-1.3.1-1.el8.aarch64.rpm Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-1.el8.aarch64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-1.el8.aarch64.rpm Executing(%clean): /bin/sh -e /var/tmp/rpm-tmp.ORQR4F + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + /usr/bin/rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.aarch64 + exit 0 Finish: rpmbuild bowtie-1.3.1-1.el8.src.rpm Finish: build phase for bowtie-1.3.1-1.el8.src.rpm INFO: chroot_scan: 3 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root/var/log/dnf.rpm.log /var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root/var/log/dnf.librepo.log /var/lib/mock/rhel+epel-8-aarch64-1674075943.812535/root/var/log/dnf.log INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.el8.src.rpm) Config(child) 1 minutes 34 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool