Mock Version: 3.5 ENTER ['do_with_status'](['bash', '--login', '-c', '/usr/bin/rpmbuild -bs --target x86_64 --nodeps /builddir/build/SPECS/bowtie.spec'], chrootPath='/var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root'env={'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'}shell=Falselogger=timeout=0uid=1000gid=135user='mockbuild'nspawn_args=['--capability=cap_ipc_lock', '--rlimit=RLIMIT_NOFILE=10240', '--capability=cap_ipc_lock', '--bind=/tmp/mock-resolv.dzu3bgpa:/etc/resolv.conf', '--bind=/dev/btrfs-control', '--bind=/dev/mapper/control', '--bind=/dev/loop-control', '--bind=/dev/loop0', '--bind=/dev/loop1', '--bind=/dev/loop2', '--bind=/dev/loop3', '--bind=/dev/loop4', '--bind=/dev/loop5', '--bind=/dev/loop6', '--bind=/dev/loop7', '--bind=/dev/loop8', '--bind=/dev/loop9', '--bind=/dev/loop10', '--bind=/dev/loop11']unshare_net=TrueprintOutput=True) Using nspawn with args ['--capability=cap_ipc_lock', '--rlimit=RLIMIT_NOFILE=10240', '--capability=cap_ipc_lock', '--bind=/tmp/mock-resolv.dzu3bgpa:/etc/resolv.conf', '--bind=/dev/btrfs-control', '--bind=/dev/mapper/control', '--bind=/dev/loop-control', '--bind=/dev/loop0', '--bind=/dev/loop1', '--bind=/dev/loop2', '--bind=/dev/loop3', '--bind=/dev/loop4', '--bind=/dev/loop5', '--bind=/dev/loop6', '--bind=/dev/loop7', '--bind=/dev/loop8', '--bind=/dev/loop9', '--bind=/dev/loop10', '--bind=/dev/loop11'] Executing command: ['/usr/bin/systemd-nspawn', '-q', '-M', '9702855d445d45d4b94732b2dc23f6ee', '-D', '/var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root', '-a', '-u', 'mockbuild', '--capability=cap_ipc_lock', '--rlimit=RLIMIT_NOFILE=10240', '--capability=cap_ipc_lock', '--bind=/tmp/mock-resolv.dzu3bgpa:/etc/resolv.conf', '--bind=/dev/btrfs-control', '--bind=/dev/mapper/control', '--bind=/dev/loop-control', '--bind=/dev/loop0', '--bind=/dev/loop1', '--bind=/dev/loop2', '--bind=/dev/loop3', '--bind=/dev/loop4', '--bind=/dev/loop5', '--bind=/dev/loop6', '--bind=/dev/loop7', '--bind=/dev/loop8', '--bind=/dev/loop9', '--bind=/dev/loop10', '--bind=/dev/loop11', '--console=pipe', '--setenv=TERM=vt100', '--setenv=SHELL=/bin/bash', '--setenv=HOME=/builddir', '--setenv=HOSTNAME=mock', '--setenv=PATH=/usr/bin:/bin:/usr/sbin:/sbin', '--setenv=PROMPT_COMMAND=printf "\\033]0;\\007"', '--setenv=PS1= \\s-\\v\\$ ', '--setenv=LANG=C.UTF-8', '--resolv-conf=off', 'bash', '--login', '-c', '/usr/bin/rpmbuild -bs --target x86_64 --nodeps /builddir/build/SPECS/bowtie.spec'] with env {'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8', 'SYSTEMD_NSPAWN_TMPFS_TMP': '0', 'SYSTEMD_SECCOMP': '0'} and shell False Building target platforms: x86_64 Building for target x86_64 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-1.el8.src.rpm Child return code was: 0 ENTER ['do_with_status'](['bash', '--login', '-c', '/usr/bin/rpmbuild -bb --target x86_64 --nodeps /builddir/build/SPECS/bowtie.spec'], chrootPath='/var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root'env={'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8'}shell=Falselogger=timeout=0uid=1000gid=135user='mockbuild'nspawn_args=['--capability=cap_ipc_lock', '--rlimit=RLIMIT_NOFILE=10240', '--capability=cap_ipc_lock', '--bind=/tmp/mock-resolv.dzu3bgpa:/etc/resolv.conf', '--bind=/dev/btrfs-control', '--bind=/dev/mapper/control', '--bind=/dev/loop-control', '--bind=/dev/loop0', '--bind=/dev/loop1', '--bind=/dev/loop2', '--bind=/dev/loop3', '--bind=/dev/loop4', '--bind=/dev/loop5', '--bind=/dev/loop6', '--bind=/dev/loop7', '--bind=/dev/loop8', '--bind=/dev/loop9', '--bind=/dev/loop10', '--bind=/dev/loop11']unshare_net=TrueprintOutput=True) Using nspawn with args ['--capability=cap_ipc_lock', '--rlimit=RLIMIT_NOFILE=10240', '--capability=cap_ipc_lock', '--bind=/tmp/mock-resolv.dzu3bgpa:/etc/resolv.conf', '--bind=/dev/btrfs-control', '--bind=/dev/mapper/control', '--bind=/dev/loop-control', '--bind=/dev/loop0', '--bind=/dev/loop1', '--bind=/dev/loop2', '--bind=/dev/loop3', '--bind=/dev/loop4', '--bind=/dev/loop5', '--bind=/dev/loop6', '--bind=/dev/loop7', '--bind=/dev/loop8', '--bind=/dev/loop9', '--bind=/dev/loop10', '--bind=/dev/loop11'] Executing command: ['/usr/bin/systemd-nspawn', '-q', '-M', '9b2c169ece4b4fd882e07fbddad88ba2', '-D', '/var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root', '-a', '-u', 'mockbuild', '--capability=cap_ipc_lock', '--rlimit=RLIMIT_NOFILE=10240', '--capability=cap_ipc_lock', '--bind=/tmp/mock-resolv.dzu3bgpa:/etc/resolv.conf', '--bind=/dev/btrfs-control', '--bind=/dev/mapper/control', '--bind=/dev/loop-control', '--bind=/dev/loop0', '--bind=/dev/loop1', '--bind=/dev/loop2', '--bind=/dev/loop3', '--bind=/dev/loop4', '--bind=/dev/loop5', '--bind=/dev/loop6', '--bind=/dev/loop7', '--bind=/dev/loop8', '--bind=/dev/loop9', '--bind=/dev/loop10', '--bind=/dev/loop11', '--console=pipe', '--setenv=TERM=vt100', '--setenv=SHELL=/bin/bash', '--setenv=HOME=/builddir', '--setenv=HOSTNAME=mock', '--setenv=PATH=/usr/bin:/bin:/usr/sbin:/sbin', '--setenv=PROMPT_COMMAND=printf "\\033]0;\\007"', '--setenv=PS1= \\s-\\v\\$ ', '--setenv=LANG=C.UTF-8', '--resolv-conf=off', 'bash', '--login', '-c', '/usr/bin/rpmbuild -bb --target x86_64 --nodeps /builddir/build/SPECS/bowtie.spec'] with env {'TERM': 'vt100', 'SHELL': '/bin/bash', 'HOME': '/builddir', 'HOSTNAME': 'mock', 'PATH': '/usr/bin:/bin:/usr/sbin:/sbin', 'PROMPT_COMMAND': 'printf "\\033]0;\\007"', 'PS1': ' \\s-\\v\\$ ', 'LANG': 'C.UTF-8', 'SYSTEMD_NSPAWN_TMPFS_TMP': '0', 'SYSTEMD_SECCOMP': '0'} and shell False Building target platforms: x86_64 Building for target x86_64 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.8Yf8xW + umask 022 + cd /builddir/build/BUILD + cd /builddir/build/BUILD + rm -rf bowtie-1.3.1-src + /usr/bin/unzip -qq /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie-inspect + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.ZFMv4b + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + /usr/bin/make -O -j2 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:38\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:38\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:38\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:49\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:49\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:09\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:10\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:18\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:19\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:24\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:25\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:37\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.ms9kTL + umask 022 + cd /builddir/build/BUILD + '[' /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 '!=' / ']' + rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 ++ dirname /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 + mkdir -p /builddir/build/BUILDROOT + mkdir /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin ; \ done + mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie + cp -a reads /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + /usr/lib/rpm/find-debuginfo.sh -j2 --strict-build-id -m -i --build-id-seed 1.3.1-1.el8 --unique-debug-suffix -1.3.1-1.el8.x86_64 --unique-debug-src-base bowtie-1.3.1-1.el8.x86_64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 110000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-src extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-align-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-align-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-align-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-align-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-build-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-build-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-build-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-build-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-inspect-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-inspect-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-inspect-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-inspect-s-debug /usr/lib/rpm/sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. 2935 blocks + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig /sbin/ldconfig: Warning: ignoring configuration file that cannot be opened: /etc/ld.so.conf: No such file or directory + /usr/lib/rpm/brp-compress + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/brp-python-bytecompile '' 1 + /usr/lib/rpm/brp-python-hardlink + PYTHON3=/usr/bin/python3.6 + /usr/lib/rpm/redhat/brp-mangle-shebangs Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.RVmQvV + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + grep 'version 1.3.1' + ./bowtie --version /builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + grep 'version 1.3.1' + ./bowtie-build --version bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + grep 'version 1.3.1' + ./bowtie-inspect --version bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/DNA.pm scripts/test/all.sh scripts/test/args.pl scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/btdata.py scripts/test/btface.py scripts/test/build_big.py scripts/test/cs_dec.pl scripts/test/cs_trim.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/large_idx.py scripts/test/long_read.pl scripts/test/random_bowtie_tests.pl scripts/test/random_bowtie_tests.sh scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl Hunk #2 succeeded at 993 (offset -135 lines). + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" 1 # reads with at least one alignment: 1 (seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads with at least one alignment: r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads with at least one alignment: r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 # reads with at least one alignment: 0 (0.00%) r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: @HD VN:1.0 SO:unsorted 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" %) # reads that failed to align: 1 (100.00%) No alignments r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads with at least one alignment: 1 (100.00%) r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 3 @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 3 (100.00%) seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 @SQ SN:0 LN:19 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 @SQ SN:0 LN:19 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 2 (100.00%) # reads that failed to align: 0 (r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 0 (0.00r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 %) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 0.00%) Reported 2 alignments r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1@HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (100.00%) @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads that failed to align: r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 0 (0.00%) r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 @HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (@SQ SN:0 LN:16 100.00%) @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads that failed to align: 0 (0.00%) Reported 2 alignments r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1@HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Reported 2 alignments r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1@HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (100.00%) @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%)@SQ SN:0 LN:19 # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" 0seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 1 # reads with at least one alignment: 1 (100.00%)0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%)r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00@SQ SN:0 LN:25 %) @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 # reads processed: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:8 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: @SQ SN:0 LN:19 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (@SQ SN:0 LN:25 100.00@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" %) # reads that failed to align: 0r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 (0.00%) Reported 1 paired-end alignmentsr0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 %) Reported 1 paired-end alignmentsr0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: 1 (100.00%) r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%)r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 %) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%)r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 %) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 (100.00%) # reads that failed to align: 0 (0.00%) r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments PASSED + exit 0 Processing files: bowtie-1.3.1-1.el8.x86_64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.Fl1nvy + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + export LC_ALL=C + LC_ALL=C + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr MANUAL /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr NEWS /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr VERSION /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr AUTHORS /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr TUTORIAL /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr doc/manual.html doc/style.css /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.FhEcbm + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/licenses/bowtie + export LC_ALL=C + LC_ALL=C + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/licenses/bowtie + cp -pr LICENSE /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/licenses/bowtie + exit 0 Provides: bowtie = 1.3.1-1.el8 bowtie(x86-64) = 1.3.1-1.el8 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /bin/bash /bin/sh /usr/bin/perl /usr/bin/python3.6 libc.so.6()(64bit) libc.so.6(GLIBC_2.14)(64bit) libc.so.6(GLIBC_2.2.5)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.2.5)(64bit) libm.so.6(GLIBC_2.27)(64bit) libpthread.so.0()(64bit) libpthread.so.0(GLIBC_2.2.5)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-1.el8.x86_64 Provides: bowtie-debugsource = 1.3.1-1.el8 bowtie-debugsource(x86-64) = 1.3.1-1.el8 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-1.el8.x86_64 Provides: bowtie-debuginfo = 1.3.1-1.el8 bowtie-debuginfo(x86-64) = 1.3.1-1.el8 debuginfo(build-id) = 29ec8794fbc6084b20154c1cd14286fa460f9024 debuginfo(build-id) = 38505a2d22aaa723c57e30f3b488e1e893e87970 debuginfo(build-id) = 3abdadcb4a0812d713e0333749b56a36527b032f debuginfo(build-id) = 3d2240524b8dd44a3e9e0dea95735543f1cd2cf1 debuginfo(build-id) = 5bdbd6362e10265ca85a4830c4ea060156139846 debuginfo(build-id) = b0dee9c26087d68579964020c10d1fccbbded556 debuginfo(build-id) = b678af541e9d9833996f09ddf5e21bdc53e0dcc5 debuginfo(build-id) = e6ebcb1bf9cfff96cc06189ba4cecdc3f493b001 debuginfo(build-id) = e8249b603e581e2c9d2f5a7c8f320a44edb2f535 debuginfo(build-id) = f4a47dfc0cdf12ed1ff4a446aacc452b6e007bcd debuginfo(build-id) = f6c7f56c5bc7bf0f6415ca19dd1ff55868f0ef8e debuginfo(build-id) = fdb6278648b93ef7f1425e342e3f7d9c1fbcdc18 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(x86-64) = 1.3.1-1.el8 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 Wrote: /builddir/build/RPMS/bowtie-1.3.1-1.el8.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-1.el8.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-1.el8.x86_64.rpm Executing(%clean): /bin/sh -e /var/tmp/rpm-tmp.yV44zP + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + /usr/bin/rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 + exit 0 Child return code was: 0