Warning: Permanently added '2620:52:3:1:dead:beef:cafe:c149' (ED25519) to the list of known hosts. Running: /usr/bin/copr-rpmbuild --verbose --drop-resultdir --build-id 5247830 --chroot epel-8-x86_64 --detached Version: 0.62 PID: 4973 Logging PID: 4974 Task: {'appstream': True, 'background': False, 'bootstrap': 'off', 'build_id': 5247830, 'buildroot_pkgs': ['scl-utils-build'], 'chroot': 'epel-8-x86_64', 'enable_net': False, 'fedora_review': False, 'git_hash': '9c61cd33db4fd4153590f5e201f7ec0e8bbdae09', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/loveshack/livhpc/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-1.fc38', 'project_dirname': 'livhpc', 'project_name': 'livhpc', 'project_owner': 'loveshack', 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/loveshack/livhpc/epel-8-x86_64/', 'id': 'copr_base', 'name': 'Copr repository'}], 'sandbox': 'loveshack/livhpc--loveshack', 'source_json': {}, 'source_type': None, 'submitter': 'loveshack', 'tags': [], 'task_id': '5247830-epel-8-x86_64', 'timeout': 18000, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/loveshack/livhpc/bowtie /var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/loveshack/livhpc/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie'... Running: git checkout 9c61cd33db4fd4153590f5e201f7ec0e8bbdae09 cmd: ['git', 'checkout', '9c61cd33db4fd4153590f5e201f7ec0e8bbdae09'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie rc: 0 stdout: stderr: Note: switching to '9c61cd33db4fd4153590f5e201f7ec0e8bbdae09'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at 9c61cd3 automatic import of bowtie Running: copr-distgit-client sources /usr/bin/tail: /var/lib/copr-rpmbuild/main.log: file truncated cmd: ['copr-distgit-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --remote-time --show-error --fail https://copr-dist-git.fedorainfracloud.org/repo/pkgs/loveshack/livhpc/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 7293k 100 7293k 0 0 41.5M 0 --:--:-- --:--:-- --:--:-- 41.6M INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-tests.tgz --location --remote-time --show-error --fail https://copr-dist-git.fedorainfracloud.org/repo/pkgs/loveshack/livhpc/bowtie/bowtie-1.3.1-tests.tgz/md5/a3db68fc7312a3fd8edb769e8d32e1f0/bowtie-1.3.1-tests.tgz % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 33854 100 33854 0 0 520k 0 --:--:-- --:--:-- --:--:-- 524k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz Running (timeout=18000): unbuffer mock --buildsrpm --spec /var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1674075945.719916 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 3.5 starting (python version = 3.11.0, NVR = mock-3.5-1.fc37)... Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie/bowtie.spec) Config(rhel+epel-8-x86_64) Start: clean chroot Finish: clean chroot Start: chroot init INFO: mounting tmpfs at /var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin Mock Version: 3.5 INFO: Mock Version: 3.5 Start: dnf install No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 798 kB/s | 364 kB 00:00 Red Hat Enterprise Linux - BaseOS 32 MB/s | 56 MB 00:01 Red Hat Enterprise Linux - AppStream 36 MB/s | 52 MB 00:01 Red Hat Enterprise Linux - CodeReady Linux Buil 4.5 MB/s | 8.8 MB 00:01 Extra Packages for Enterprise Linux 8 - x86_64 2.8 MB/s | 13 MB 00:04 Dependencies resolved. =========================================================================================== Package Arch Version Repository Size =========================================================================================== Installing: bash x86_64 4.4.20-4.el8_6 rhel-baseos 1.5 M bzip2 x86_64 1.0.6-26.el8 rhel-baseos 60 k coreutils x86_64 8.30-13.el8 rhel-baseos 1.2 M cpio x86_64 2.12-11.el8 rhel-baseos 266 k diffutils x86_64 3.6-6.el8 rhel-baseos 359 k epel-rpm-macros noarch 8-35 epel 24 k findutils x86_64 1:4.6.0-20.el8 rhel-baseos 528 k gawk x86_64 4.2.1-4.el8 rhel-baseos 1.1 M gcc x86_64 8.5.0-16.el8_7 rhel-appstream 23 M gcc-c++ x86_64 8.5.0-16.el8_7 rhel-appstream 12 M grep x86_64 3.1-6.el8 rhel-baseos 274 k gzip x86_64 1.9-13.el8_5 rhel-baseos 167 k info x86_64 6.5-7.el8 rhel-baseos 198 k make x86_64 1:4.2.1-11.el8 rhel-baseos 498 k patch x86_64 2.7.6-11.el8 rhel-baseos 138 k redhat-release x86_64 8.7-0.3.el8 rhel-baseos 44 k redhat-rpm-config noarch 130-1.el8 rhel-appstream 90 k rpm-build x86_64 4.14.3-24.el8_7 rhel-appstream 174 k sed x86_64 4.5-5.el8 rhel-baseos 298 k shadow-utils x86_64 2:4.6-17.el8 rhel-baseos 1.2 M tar x86_64 2:1.30-6.el8 rhel-baseos 838 k unzip x86_64 6.0-46.el8 rhel-baseos 196 k util-linux x86_64 2.32.1-39.el8_7 rhel-baseos 2.5 M which x86_64 2.21-18.el8 rhel-baseos 50 k xz x86_64 5.2.4-4.el8_6 rhel-baseos 153 k Installing dependencies: annobin x86_64 10.67-3.el8 rhel-appstream 955 k ansible-srpm-macros noarch 1-8.1.el8 epel 8.5 k audit-libs x86_64 3.0.7-4.el8 rhel-baseos 123 k basesystem noarch 11-5.el8 rhel-baseos 11 k binutils x86_64 2.30-117.el8 rhel-baseos 5.8 M brotli x86_64 1.0.6-3.el8 rhel-baseos 323 k bzip2-libs x86_64 1.0.6-26.el8 rhel-baseos 48 k ca-certificates noarch 2022.2.54-80.2.el8_6 rhel-baseos 921 k chkconfig x86_64 1.19.1-1.el8 rhel-baseos 198 k coreutils-common x86_64 8.30-13.el8 rhel-baseos 2.0 M cpp x86_64 8.5.0-16.el8_7 rhel-appstream 10 M cracklib x86_64 2.9.6-15.el8 rhel-baseos 93 k cracklib-dicts x86_64 2.9.6-15.el8 rhel-baseos 4.0 M crypto-policies noarch 20211116-1.gitae470d6.el8 rhel-baseos 64 k curl x86_64 7.61.1-25.el8_7.1 rhel-baseos 352 k cyrus-sasl-lib x86_64 2.1.27-6.el8_5 rhel-baseos 123 k dwz x86_64 0.12-10.el8 rhel-appstream 109 k efi-srpm-macros noarch 3-3.el8 rhel-appstream 22 k elfutils x86_64 0.187-4.el8 rhel-baseos 543 k elfutils-default-yama-scope noarch 0.187-4.el8 rhel-baseos 52 k elfutils-libelf x86_64 0.187-4.el8 rhel-baseos 231 k elfutils-libs x86_64 0.187-4.el8 rhel-baseos 297 k expat x86_64 2.2.5-10.el8_7.1 rhel-baseos 113 k file x86_64 5.33-21.el8 rhel-baseos 77 k file-libs x86_64 5.33-21.el8 rhel-baseos 543 k filesystem x86_64 3.8-6.el8 rhel-baseos 1.1 M fpc-srpm-macros noarch 1.3-1.el8 epel 8.2 k gc x86_64 7.6.4-3.el8 rhel-appstream 109 k gcc-plugin-annobin x86_64 8.5.0-16.el8_7 rhel-appstream 35 k gdb-headless x86_64 8.2-19.el8 rhel-appstream 3.7 M gdbm x86_64 1:1.18-2.el8 rhel-baseos 130 k gdbm-libs x86_64 1:1.18-2.el8 rhel-baseos 60 k ghc-srpm-macros noarch 1.4.2-7.el8 rhel-appstream 9.4 k glib2 x86_64 2.56.4-159.el8 rhel-baseos 2.5 M glibc x86_64 2.28-211.el8 rhel-baseos 2.2 M glibc-all-langpacks x86_64 2.28-211.el8 rhel-baseos 26 M glibc-common x86_64 2.28-211.el8 rhel-baseos 1.0 M glibc-devel x86_64 2.28-211.el8 rhel-baseos 82 k glibc-gconv-extra x86_64 2.28-211.el8 rhel-baseos 1.5 M glibc-headers x86_64 2.28-211.el8 rhel-baseos 486 k gmp x86_64 1:6.1.2-10.el8 rhel-baseos 321 k gnupg2 x86_64 2.2.20-3.el8_6 rhel-baseos 2.4 M gnutls x86_64 3.6.16-5.el8_6 rhel-baseos 1.0 M go-srpm-macros noarch 2-17.el8 rhel-appstream 13 k guile x86_64 5:2.0.14-7.el8 rhel-appstream 3.5 M ima-evm-utils x86_64 1.3.2-12.el8 rhel-baseos 64 k isl x86_64 0.16.1-6.el8 rhel-appstream 841 k kernel-headers x86_64 4.18.0-425.10.1.el8_7 rhel-baseos 10 M keyutils-libs x86_64 1.5.10-9.el8 rhel-baseos 34 k krb5-libs x86_64 1.18.2-22.el8_7 rhel-baseos 840 k libacl x86_64 2.2.53-1.el8 rhel-baseos 35 k libarchive x86_64 3.3.3-4.el8 rhel-baseos 360 k libassuan x86_64 2.5.1-3.el8 rhel-baseos 83 k libatomic_ops x86_64 7.6.2-3.el8 rhel-appstream 38 k libattr x86_64 2.4.48-3.el8 rhel-baseos 27 k libbabeltrace x86_64 1.5.4-4.el8 rhel-baseos 200 k libblkid x86_64 2.32.1-39.el8_7 rhel-baseos 220 k libcap x86_64 2.48-4.el8 rhel-baseos 74 k libcap-ng x86_64 0.7.11-1.el8 rhel-baseos 33 k libcom_err x86_64 1.45.6-5.el8 rhel-baseos 49 k libcurl x86_64 7.61.1-25.el8_7.1 rhel-baseos 302 k libdb x86_64 5.3.28-42.el8_4 rhel-baseos 751 k libdb-utils x86_64 5.3.28-42.el8_4 rhel-baseos 150 k libfdisk x86_64 2.32.1-39.el8_7 rhel-baseos 253 k libffi x86_64 3.1-23.el8 rhel-baseos 37 k libgcc x86_64 8.5.0-16.el8_7 rhel-baseos 81 k libgcrypt x86_64 1.8.5-7.el8_6 rhel-baseos 463 k libgomp x86_64 8.5.0-16.el8_7 rhel-baseos 207 k libgpg-error x86_64 1.31-1.el8 rhel-baseos 242 k libidn2 x86_64 2.2.0-1.el8 rhel-baseos 94 k libipt x86_64 1.6.1-8.el8 rhel-appstream 50 k libksba x86_64 1.3.5-8.el8_6 rhel-baseos 134 k libmount x86_64 2.32.1-39.el8_7 rhel-baseos 236 k libmpc x86_64 1.1.0-9.1.el8 rhel-appstream 61 k libnghttp2 x86_64 1.33.0-3.el8_2.1 rhel-baseos 77 k libnsl2 x86_64 1.2.0-2.20180605git4a062cf.el8 rhel-baseos 58 k libpkgconf x86_64 1.4.2-1.el8 rhel-baseos 35 k libpsl x86_64 0.20.2-6.el8 rhel-baseos 61 k libpwquality x86_64 1.4.4-5.el8 rhel-baseos 107 k libselinux x86_64 2.9-6.el8 rhel-baseos 165 k libsemanage x86_64 2.9-9.el8_6 rhel-baseos 168 k libsepol x86_64 2.9-3.el8 rhel-baseos 340 k libsigsegv x86_64 2.11-5.el8 rhel-baseos 30 k libsmartcols x86_64 2.32.1-39.el8_7 rhel-baseos 179 k libssh x86_64 0.9.6-3.el8 rhel-baseos 216 k libssh-config noarch 0.9.6-3.el8 rhel-baseos 19 k libstdc++ x86_64 8.5.0-16.el8_7 rhel-baseos 454 k libstdc++-devel x86_64 8.5.0-16.el8_7 rhel-appstream 2.1 M libtasn1 x86_64 4.13-4.el8_7 rhel-baseos 76 k libtirpc x86_64 1.1.4-8.el8 rhel-baseos 113 k libtool-ltdl x86_64 2.4.6-25.el8 rhel-baseos 58 k libunistring x86_64 0.9.9-3.el8 rhel-baseos 422 k libusbx x86_64 1.0.23-4.el8 rhel-baseos 74 k libutempter x86_64 1.1.6-14.el8 rhel-baseos 32 k libuuid x86_64 2.32.1-39.el8_7 rhel-baseos 98 k libverto x86_64 0.3.2-2.el8 rhel-baseos 24 k libxcrypt x86_64 4.1.1-6.el8 rhel-baseos 73 k libxcrypt-devel x86_64 4.1.1-6.el8 rhel-baseos 25 k libxml2 x86_64 2.9.7-15.el8_7.1 rhel-baseos 697 k libzstd x86_64 1.4.4-1.el8 rhel-baseos 266 k lua-libs x86_64 5.3.4-12.el8 rhel-baseos 118 k lua-srpm-macros noarch 1-3.el8 epel 8.1 k lz4-libs x86_64 1.8.3-3.el8_4 rhel-baseos 66 k mpfr x86_64 3.1.6-1.el8 rhel-baseos 221 k ncurses x86_64 6.1-9.20180224.el8 rhel-baseos 387 k ncurses-base noarch 6.1-9.20180224.el8 rhel-baseos 81 k ncurses-libs x86_64 6.1-9.20180224.el8 rhel-baseos 334 k nettle x86_64 3.4.1-7.el8 rhel-baseos 301 k npth x86_64 1.5-4.el8 rhel-baseos 26 k ocaml-srpm-macros noarch 5-4.el8 rhel-appstream 9.5 k openblas-srpm-macros noarch 2-2.el8 rhel-appstream 8.0 k openldap x86_64 2.4.46-18.el8 rhel-baseos 352 k openssl-libs x86_64 1:1.1.1k-7.el8_6 rhel-baseos 1.5 M p11-kit x86_64 0.23.22-1.el8 rhel-baseos 324 k p11-kit-trust x86_64 0.23.22-1.el8 rhel-baseos 137 k pam x86_64 1.3.1-22.el8 rhel-baseos 743 k pcre x86_64 8.42-6.el8 rhel-baseos 211 k pcre2 x86_64 10.32-3.el8_6 rhel-baseos 247 k perl-srpm-macros noarch 1-25.el8 rhel-appstream 11 k pkgconf x86_64 1.4.2-1.el8 rhel-baseos 38 k pkgconf-m4 noarch 1.4.2-1.el8 rhel-baseos 17 k pkgconf-pkg-config x86_64 1.4.2-1.el8 rhel-baseos 15 k platform-python x86_64 3.6.8-48.el8_7 rhel-baseos 86 k platform-python-setuptools noarch 39.2.0-6.el8 rhel-baseos 632 k popt x86_64 1.18-1.el8 rhel-baseos 61 k publicsuffix-list-dafsa noarch 20180723-1.el8 rhel-baseos 56 k python-rpm-macros noarch 3-43.el8 rhel-appstream 16 k python-srpm-macros noarch 3-43.el8 rhel-appstream 15 k python3-libs x86_64 3.6.8-48.el8_7 rhel-baseos 7.8 M python3-pip-wheel noarch 9.0.3-22.el8 rhel-baseos 895 k python3-rpm-macros noarch 3-43.el8 rhel-appstream 15 k python3-setuptools-wheel noarch 39.2.0-6.el8 rhel-baseos 289 k qt5-srpm-macros noarch 5.15.3-1.el8 rhel-appstream 11 k readline x86_64 7.0-10.el8 rhel-baseos 199 k rpm x86_64 4.14.3-24.el8_7 rhel-baseos 543 k rpm-build-libs x86_64 4.14.3-24.el8_7 rhel-baseos 157 k rpm-libs x86_64 4.14.3-24.el8_7 rhel-baseos 346 k rust-srpm-macros noarch 5-2.el8 rhel-appstream 9.3 k setup noarch 2.12.2-7.el8 rhel-baseos 181 k sqlite-libs x86_64 3.26.0-17.el8_7 rhel-baseos 581 k systemd-libs x86_64 239-68.el8_7.2 rhel-baseos 1.1 M tpm2-tss x86_64 2.3.2-4.el8 rhel-baseos 275 k tzdata noarch 2022g-1.el8 rhel-baseos 470 k xz-libs x86_64 5.2.4-4.el8_6 rhel-baseos 94 k zip x86_64 3.0-23.el8 rhel-baseos 270 k zlib x86_64 1.2.11-21.el8_7 rhel-baseos 103 k zstd x86_64 1.4.4-1.el8 rhel-appstream 393 k Transaction Summary =========================================================================================== Install 172 Packages Total download size: 162 M Installed size: 813 M Downloading Packages: (1/172): libassuan-2.5.1-3.el8.x86_64.rpm 248 kB/s | 83 kB 00:00 (2/172): libutempter-1.1.6-14.el8.x86_64.rpm 94 kB/s | 32 kB 00:00 (3/172): cracklib-2.9.6-15.el8.x86_64.rpm 274 kB/s | 93 kB 00:00 (4/172): pkgconf-1.4.2-1.el8.x86_64.rpm 348 kB/s | 38 kB 00:00 (5/172): grep-3.1-6.el8.x86_64.rpm 1.4 MB/s | 274 kB 00:00 (6/172): libsigsegv-2.11-5.el8.x86_64.rpm 301 kB/s | 30 kB 00:00 (7/172): readline-7.0-10.el8.x86_64.rpm 873 kB/s | 199 kB 00:00 (8/172): npth-1.5-4.el8.x86_64.rpm 273 kB/s | 26 kB 00:00 (9/172): libattr-2.4.48-3.el8.x86_64.rpm 268 kB/s | 27 kB 00:00 (10/172): pkgconf-pkg-config-1.4.2-1.el8.x86_64 89 kB/s | 15 kB 00:00 (11/172): bzip2-libs-1.0.6-26.el8.x86_64.rpm 266 kB/s | 48 kB 00:00 (12/172): mpfr-3.1.6-1.el8.x86_64.rpm 1.7 MB/s | 221 kB 00:00 (13/172): cracklib-dicts-2.9.6-15.el8.x86_64.rp 10 MB/s | 4.0 MB 00:00 (14/172): zip-3.0-23.el8.x86_64.rpm 1.9 MB/s | 270 kB 00:00 (15/172): bzip2-1.0.6-26.el8.x86_64.rpm 567 kB/s | 60 kB 00:00 (16/172): libunistring-0.9.9-3.el8.x86_64.rpm 2.6 MB/s | 422 kB 00:00 (17/172): libnsl2-1.2.0-2.20180605git4a062cf.el 371 kB/s | 58 kB 00:00 (18/172): libpkgconf-1.4.2-1.el8.x86_64.rpm 317 kB/s | 35 kB 00:00 (19/172): publicsuffix-list-dafsa-20180723-1.el 467 kB/s | 56 kB 00:00 (20/172): pkgconf-m4-1.4.2-1.el8.noarch.rpm 157 kB/s | 17 kB 00:00 (21/172): findutils-4.6.0-20.el8.x86_64.rpm 3.7 MB/s | 528 kB 00:00 (22/172): libacl-2.2.53-1.el8.x86_64.rpm 244 kB/s | 35 kB 00:00 (23/172): basesystem-11-5.el8.noarch.rpm 114 kB/s | 11 kB 00:00 (24/172): libtool-ltdl-2.4.6-25.el8.x86_64.rpm 563 kB/s | 58 kB 00:00 (25/172): gmp-6.1.2-10.el8.x86_64.rpm 2.2 MB/s | 321 kB 00:00 (26/172): diffutils-3.6-6.el8.x86_64.rpm 3.5 MB/s | 359 kB 00:00 (27/172): libgpg-error-1.31-1.el8.x86_64.rpm 1.4 MB/s | 242 kB 00:00 (28/172): libnghttp2-1.33.0-3.el8_2.1.x86_64.rp 816 kB/s | 77 kB 00:00 (29/172): patch-2.7.6-11.el8.x86_64.rpm 1.1 MB/s | 138 kB 00:00 (30/172): python3-setuptools-wheel-39.2.0-6.el8 2.7 MB/s | 289 kB 00:00 (31/172): libzstd-1.4.4-1.el8.x86_64.rpm 2.1 MB/s | 266 kB 00:00 (32/172): libidn2-2.2.0-1.el8.x86_64.rpm 284 kB/s | 94 kB 00:00 (33/172): libusbx-1.0.23-4.el8.x86_64.rpm 617 kB/s | 74 kB 00:00 (34/172): platform-python-setuptools-39.2.0-6.e 3.8 MB/s | 632 kB 00:00 (35/172): libpsl-0.20.2-6.el8.x86_64.rpm 652 kB/s | 61 kB 00:00 (36/172): p11-kit-trust-0.23.22-1.el8.x86_64.rp 975 kB/s | 137 kB 00:00 (37/172): popt-1.18-1.el8.x86_64.rpm 666 kB/s | 61 kB 00:00 (38/172): lz4-libs-1.8.3-3.el8_4.x86_64.rpm 609 kB/s | 66 kB 00:00 (39/172): brotli-1.0.6-3.el8.x86_64.rpm 2.3 MB/s | 323 kB 00:00 (40/172): ima-evm-utils-1.3.2-12.el8.x86_64.rpm 662 kB/s | 64 kB 00:00 (41/172): libxcrypt-devel-4.1.1-6.el8.x86_64.rp 250 kB/s | 25 kB 00:00 (42/172): p11-kit-0.23.22-1.el8.x86_64.rpm 2.5 MB/s | 324 kB 00:00 (43/172): tpm2-tss-2.3.2-4.el8.x86_64.rpm 1.8 MB/s | 275 kB 00:00 (44/172): pcre-8.42-6.el8.x86_64.rpm 1.5 MB/s | 211 kB 00:00 (45/172): openldap-2.4.46-18.el8.x86_64.rpm 2.6 MB/s | 352 kB 00:00 (46/172): nettle-3.4.1-7.el8.x86_64.rpm 2.7 MB/s | 301 kB 00:00 (47/172): ncurses-libs-6.1-9.20180224.el8.x86_6 3.1 MB/s | 334 kB 00:00 (48/172): libdb-utils-5.3.28-42.el8_4.x86_64.rp 1.3 MB/s | 150 kB 00:00 (49/172): filesystem-3.8-6.el8.x86_64.rpm 7.9 MB/s | 1.1 MB 00:00 (50/172): chkconfig-1.19.1-1.el8.x86_64.rpm 1.7 MB/s | 198 kB 00:00 (51/172): libcap-ng-0.7.11-1.el8.x86_64.rpm 364 kB/s | 33 kB 00:00 (52/172): libxcrypt-4.1.1-6.el8.x86_64.rpm 483 kB/s | 73 kB 00:00 (53/172): ncurses-6.1-9.20180224.el8.x86_64.rpm 3.6 MB/s | 387 kB 00:00 (54/172): libdb-5.3.28-42.el8_4.x86_64.rpm 5.3 MB/s | 751 kB 00:00 (55/172): libsepol-2.9-3.el8.x86_64.rpm 2.3 MB/s | 340 kB 00:00 (56/172): keyutils-libs-1.5.10-9.el8.x86_64.rpm 336 kB/s | 34 kB 00:00 (57/172): gzip-1.9-13.el8_5.x86_64.rpm 1.1 MB/s | 167 kB 00:00 (58/172): ncurses-base-6.1-9.20180224.el8.noarc 770 kB/s | 81 kB 00:00 (59/172): cyrus-sasl-lib-2.1.27-6.el8_5.x86_64. 922 kB/s | 123 kB 00:00 (60/172): lua-libs-5.3.4-12.el8.x86_64.rpm 1.1 MB/s | 118 kB 00:00 (61/172): cpio-2.12-11.el8.x86_64.rpm 2.3 MB/s | 266 kB 00:00 (62/172): sed-4.5-5.el8.x86_64.rpm 2.4 MB/s | 298 kB 00:00 (63/172): make-4.2.1-11.el8.x86_64.rpm 4.0 MB/s | 498 kB 00:00 (64/172): libffi-3.1-23.el8.x86_64.rpm 212 kB/s | 37 kB 00:00 (65/172): libssh-0.9.6-3.el8.x86_64.rpm 2.1 MB/s | 216 kB 00:00 (66/172): xz-libs-5.2.4-4.el8_6.x86_64.rpm 884 kB/s | 94 kB 00:00 (67/172): python3-pip-wheel-9.0.3-22.el8.noarch 4.0 MB/s | 895 kB 00:00 (68/172): gawk-4.2.1-4.el8.x86_64.rpm 4.9 MB/s | 1.1 MB 00:00 (69/172): xz-5.2.4-4.el8_6.x86_64.rpm 1.5 MB/s | 153 kB 00:00 (70/172): crypto-policies-20211116-1.gitae470d6 507 kB/s | 64 kB 00:00 (71/172): info-6.5-7.el8.x86_64.rpm 1.8 MB/s | 198 kB 00:00 (72/172): libssh-config-0.9.6-3.el8.noarch.rpm 178 kB/s | 19 kB 00:00 (73/172): unzip-6.0-46.el8.x86_64.rpm 1.7 MB/s | 196 kB 00:00 (74/172): libpwquality-1.4.4-5.el8.x86_64.rpm 1.1 MB/s | 107 kB 00:00 (75/172): coreutils-8.30-13.el8.x86_64.rpm 11 MB/s | 1.2 MB 00:00 (76/172): glibc-headers-2.28-211.el8.x86_64.rpm 3.0 MB/s | 486 kB 00:00 (77/172): tar-1.30-6.el8.x86_64.rpm 6.3 MB/s | 838 kB 00:00 (78/172): libbabeltrace-1.5.4-4.el8.x86_64.rpm 1.9 MB/s | 200 kB 00:00 (79/172): libksba-1.3.5-8.el8_6.x86_64.rpm 1.3 MB/s | 134 kB 00:00 (80/172): libverto-0.3.2-2.el8.x86_64.rpm 189 kB/s | 24 kB 00:00 (81/172): gdbm-libs-1.18-2.el8.x86_64.rpm 513 kB/s | 60 kB 00:00 (82/172): coreutils-common-8.30-13.el8.x86_64.r 13 MB/s | 2.0 MB 00:00 (83/172): gnupg2-2.2.20-3.el8_6.x86_64.rpm 11 MB/s | 2.4 MB 00:00 (84/172): glibc-all-langpacks-2.28-211.el8.x86_ 44 MB/s | 26 MB 00:00 (85/172): libtirpc-1.1.4-8.el8.x86_64.rpm 989 kB/s | 113 kB 00:00 (86/172): ca-certificates-2022.2.54-80.2.el8_6. 7.5 MB/s | 921 kB 00:00 (87/172): pcre2-10.32-3.el8_6.x86_64.rpm 2.3 MB/s | 247 kB 00:00 (88/172): pam-1.3.1-22.el8.x86_64.rpm 7.1 MB/s | 743 kB 00:00 (89/172): libgcrypt-1.8.5-7.el8_6.x86_64.rpm 3.9 MB/s | 463 kB 00:00 (90/172): glibc-devel-2.28-211.el8.x86_64.rpm 732 kB/s | 82 kB 00:00 (91/172): binutils-2.30-117.el8.x86_64.rpm 27 MB/s | 5.8 MB 00:00 (92/172): libcom_err-1.45.6-5.el8.x86_64.rpm 377 kB/s | 49 kB 00:00 (93/172): openssl-libs-1.1.1k-7.el8_6.x86_64.rp 8.0 MB/s | 1.5 MB 00:00 (94/172): libsemanage-2.9-9.el8_6.x86_64.rpm 1.4 MB/s | 168 kB 00:00 (95/172): bash-4.4.20-4.el8_6.x86_64.rpm 12 MB/s | 1.5 MB 00:00 (96/172): glibc-gconv-extra-2.28-211.el8.x86_64 12 MB/s | 1.5 MB 00:00 (97/172): gnutls-3.6.16-5.el8_6.x86_64.rpm 4.7 MB/s | 1.0 MB 00:00 (98/172): elfutils-libelf-0.187-4.el8.x86_64.rp 1.9 MB/s | 231 kB 00:00 (99/172): file-libs-5.33-21.el8.x86_64.rpm 4.3 MB/s | 543 kB 00:00 (100/172): file-5.33-21.el8.x86_64.rpm 452 kB/s | 77 kB 00:00 (101/172): gdbm-1.18-2.el8.x86_64.rpm 626 kB/s | 130 kB 00:00 (102/172): which-2.21-18.el8.x86_64.rpm 167 kB/s | 50 kB 00:00 (103/172): glibc-common-2.28-211.el8.x86_64.rpm 7.8 MB/s | 1.0 MB 00:00 (104/172): elfutils-0.187-4.el8.x86_64.rpm 3.3 MB/s | 543 kB 00:00 (105/172): setup-2.12.2-7.el8.noarch.rpm 1.6 MB/s | 181 kB 00:00 (106/172): elfutils-libs-0.187-4.el8.x86_64.rpm 2.2 MB/s | 297 kB 00:00 (107/172): libarchive-3.3.3-4.el8.x86_64.rpm 2.5 MB/s | 360 kB 00:00 (108/172): glibc-2.28-211.el8.x86_64.rpm 3.8 MB/s | 2.2 MB 00:00 (109/172): audit-libs-3.0.7-4.el8.x86_64.rpm 736 kB/s | 123 kB 00:00 (110/172): elfutils-default-yama-scope-0.187-4. 467 kB/s | 52 kB 00:00 (111/172): libcap-2.48-4.el8.x86_64.rpm 423 kB/s | 74 kB 00:00 (112/172): shadow-utils-4.6-17.el8.x86_64.rpm 6.9 MB/s | 1.2 MB 00:00 (113/172): libselinux-2.9-6.el8.x86_64.rpm 1.1 MB/s | 165 kB 00:00 (114/172): glib2-2.56.4-159.el8.x86_64.rpm 14 MB/s | 2.5 MB 00:00 (115/172): redhat-release-8.7-0.3.el8.x86_64.rp 344 kB/s | 44 kB 00:00 (116/172): rpm-libs-4.14.3-24.el8_7.x86_64.rpm 3.2 MB/s | 346 kB 00:00 (117/172): rpm-build-libs-4.14.3-24.el8_7.x86_6 1.3 MB/s | 157 kB 00:00 (118/172): rpm-4.14.3-24.el8_7.x86_64.rpm 2.4 MB/s | 543 kB 00:00 (119/172): python3-libs-3.6.8-48.el8_7.x86_64.r 28 MB/s | 7.8 MB 00:00 (120/172): krb5-libs-1.18.2-22.el8_7.x86_64.rpm 6.1 MB/s | 840 kB 00:00 (121/172): tzdata-2022g-1.el8.noarch.rpm 4.0 MB/s | 470 kB 00:00 (122/172): platform-python-3.6.8-48.el8_7.x86_6 367 kB/s | 86 kB 00:00 (123/172): curl-7.61.1-25.el8_7.1.x86_64.rpm 1.7 MB/s | 352 kB 00:00 (124/172): libgcc-8.5.0-16.el8_7.x86_64.rpm 397 kB/s | 81 kB 00:00 (125/172): util-linux-2.32.1-39.el8_7.x86_64.rp 20 MB/s | 2.5 MB 00:00 (126/172): expat-2.2.5-10.el8_7.1.x86_64.rpm 1.0 MB/s | 113 kB 00:00 (127/172): libtasn1-4.13-4.el8_7.x86_64.rpm 692 kB/s | 76 kB 00:00 (128/172): libuuid-2.32.1-39.el8_7.x86_64.rpm 245 kB/s | 98 kB 00:00 (129/172): libblkid-2.32.1-39.el8_7.x86_64.rpm 1.4 MB/s | 220 kB 00:00 (130/172): libstdc++-8.5.0-16.el8_7.x86_64.rpm 3.4 MB/s | 454 kB 00:00 (131/172): libcurl-7.61.1-25.el8_7.1.x86_64.rpm 2.3 MB/s | 302 kB 00:00 (132/172): libmount-2.32.1-39.el8_7.x86_64.rpm 2.1 MB/s | 236 kB 00:00 (133/172): kernel-headers-4.18.0-425.10.1.el8_7 28 MB/s | 10 MB 00:00 (134/172): zlib-1.2.11-21.el8_7.x86_64.rpm 917 kB/s | 103 kB 00:00 (135/172): systemd-libs-239-68.el8_7.2.x86_64.r 7.5 MB/s | 1.1 MB 00:00 (136/172): libgomp-8.5.0-16.el8_7.x86_64.rpm 2.1 MB/s | 207 kB 00:00 (137/172): sqlite-libs-3.26.0-17.el8_7.x86_64.r 5.2 MB/s | 581 kB 00:00 (138/172): libfdisk-2.32.1-39.el8_7.x86_64.rpm 2.1 MB/s | 253 kB 00:00 (139/172): libsmartcols-2.32.1-39.el8_7.x86_64. 1.5 MB/s | 179 kB 00:00 (140/172): libxml2-2.9.7-15.el8_7.1.x86_64.rpm 6.3 MB/s | 697 kB 00:00 (141/172): rust-srpm-macros-5-2.el8.noarch.rpm 63 kB/s | 9.3 kB 00:00 (142/172): ocaml-srpm-macros-5-4.el8.noarch.rpm 82 kB/s | 9.5 kB 00:00 (143/172): ghc-srpm-macros-1.4.2-7.el8.noarch.r 87 kB/s | 9.4 kB 00:00 (144/172): openblas-srpm-macros-2-2.el8.noarch. 62 kB/s | 8.0 kB 00:00 (145/172): perl-srpm-macros-1-25.el8.noarch.rpm 85 kB/s | 11 kB 00:00 (146/172): libatomic_ops-7.6.2-3.el8.x86_64.rpm 256 kB/s | 38 kB 00:00 (147/172): gc-7.6.4-3.el8.x86_64.rpm 1.0 MB/s | 109 kB 00:00 (148/172): guile-2.0.14-7.el8.x86_64.rpm 21 MB/s | 3.5 MB 00:00 (149/172): libipt-1.6.1-8.el8.x86_64.rpm 465 kB/s | 50 kB 00:00 (150/172): isl-0.16.1-6.el8.x86_64.rpm 5.9 MB/s | 841 kB 00:00 (151/172): zstd-1.4.4-1.el8.x86_64.rpm 2.2 MB/s | 393 kB 00:00 (152/172): libmpc-1.1.0-9.1.el8.x86_64.rpm 286 kB/s | 61 kB 00:00 (153/172): efi-srpm-macros-3-3.el8.noarch.rpm 105 kB/s | 22 kB 00:00 (154/172): go-srpm-macros-2-17.el8.noarch.rpm 118 kB/s | 13 kB 00:00 (155/172): qt5-srpm-macros-5.15.3-1.el8.noarch. 111 kB/s | 11 kB 00:00 (156/172): dwz-0.12-10.el8.x86_64.rpm 698 kB/s | 109 kB 00:00 (157/172): python3-rpm-macros-3-43.el8.noarch.r 110 kB/s | 15 kB 00:00 (158/172): redhat-rpm-config-130-1.el8.noarch.r 346 kB/s | 90 kB 00:00 (159/172): gdb-headless-8.2-19.el8.x86_64.rpm 17 MB/s | 3.7 MB 00:00 (160/172): python-rpm-macros-3-43.el8.noarch.rp 18 kB/s | 16 kB 00:00 (161/172): python-srpm-macros-3-43.el8.noarch.r 21 kB/s | 15 kB 00:00 (162/172): rpm-build-4.14.3-24.el8_7.x86_64.rpm 1.6 MB/s | 174 kB 00:00 (163/172): annobin-10.67-3.el8.x86_64.rpm 1.1 MB/s | 955 kB 00:00 (164/172): libstdc++-devel-8.5.0-16.el8_7.x86_6 12 MB/s | 2.1 MB 00:00 (165/172): cpp-8.5.0-16.el8_7.x86_64.rpm 31 MB/s | 10 MB 00:00 (166/172): gcc-plugin-annobin-8.5.0-16.el8_7.x8 325 kB/s | 35 kB 00:00 (167/172): ansible-srpm-macros-1-8.1.el8.noarch 52 kB/s | 8.5 kB 00:00 (168/172): epel-rpm-macros-8-35.noarch.rpm 415 kB/s | 24 kB 00:00 (169/172): fpc-srpm-macros-1.3-1.el8.noarch.rpm 247 kB/s | 8.2 kB 00:00 (170/172): lua-srpm-macros-1-3.el8.noarch.rpm 113 kB/s | 8.1 kB 00:00 (171/172): gcc-c++-8.5.0-16.el8_7.x86_64.rpm 31 MB/s | 12 MB 00:00 (172/172): gcc-8.5.0-16.el8_7.x86_64.rpm 35 MB/s | 23 MB 00:00 -------------------------------------------------------------------------------- Total 17 MB/s | 162 MB 00:09 Red Hat Enterprise Linux - BaseOS 3.1 MB/s | 3.1 kB 00:00 Importing GPG key 0xFD431D51: Userid : "Red Hat, Inc. (release key 2) " Fingerprint: 567E 347A D004 4ADE 55BA 8A5F 199E 2F91 FD43 1D51 From : /usr/share/distribution-gpg-keys/redhat/RPM-GPG-KEY-redhat8-release Key imported successfully Importing GPG key 0x2FA658E0: Userid : "Red Hat, Inc. (auxiliary key) " Fingerprint: 43A6 E49C 4A38 F4BE 9ABF 2A53 4568 9C88 2FA6 58E0 From : /usr/share/distribution-gpg-keys/redhat/RPM-GPG-KEY-redhat8-release Key imported successfully Extra Packages for Enterprise Linux 8 - x86_64 1.6 MB/s | 1.6 kB 00:00 Importing GPG key 0x2F86D6A1: Userid : "Fedora EPEL (8) " Fingerprint: 94E2 79EB 8D8F 25B2 1810 ADF1 21EA 45AB 2F86 D6A1 From : /usr/share/distribution-gpg-keys/epel/RPM-GPG-KEY-EPEL-8 Key imported successfully Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Running scriptlet: filesystem-3.8-6.el8.x86_64 1/1 Preparing : 1/1 Installing : libgcc-8.5.0-16.el8_7.x86_64 1/172 Running scriptlet: libgcc-8.5.0-16.el8_7.x86_64 1/172 Installing : python-srpm-macros-3-43.el8.noarch 2/172 Installing : crypto-policies-20211116-1.gitae470d6.el8.noarch 3/172 Running scriptlet: crypto-policies-20211116-1.gitae470d6.el8.noarch 3/172 Installing : python-rpm-macros-3-43.el8.noarch 4/172 Installing : redhat-release-8.7-0.3.el8.x86_64 5/172 Installing : setup-2.12.2-7.el8.noarch 6/172 warning: /etc/hosts created as /etc/hosts.rpmnew Running scriptlet: setup-2.12.2-7.el8.noarch 6/172 Installing : filesystem-3.8-6.el8.x86_64 7/172 Installing : python3-pip-wheel-9.0.3-22.el8.noarch 8/172 Installing : python3-setuptools-wheel-39.2.0-6.el8.noarch 9/172 Installing : basesystem-11-5.el8.noarch 10/172 Installing : python3-rpm-macros-3-43.el8.noarch 11/172 Installing : fpc-srpm-macros-1.3-1.el8.noarch 12/172 Installing : ansible-srpm-macros-1-8.1.el8.noarch 13/172 Installing : qt5-srpm-macros-5.15.3-1.el8.noarch 14/172 Installing : go-srpm-macros-2-17.el8.noarch 15/172 Installing : perl-srpm-macros-1-25.el8.noarch 16/172 Installing : openblas-srpm-macros-2-2.el8.noarch 17/172 Installing : ghc-srpm-macros-1.4.2-7.el8.noarch 18/172 Installing : ocaml-srpm-macros-5-4.el8.noarch 19/172 Installing : rust-srpm-macros-5-2.el8.noarch 20/172 Installing : kernel-headers-4.18.0-425.10.1.el8_7.x86_64 21/172 Installing : tzdata-2022g-1.el8.noarch 22/172 Installing : libssh-config-0.9.6-3.el8.noarch 23/172 Installing : ncurses-base-6.1-9.20180224.el8.noarch 24/172 Installing : pcre2-10.32-3.el8_6.x86_64 25/172 Installing : libselinux-2.9-6.el8.x86_64 26/172 Installing : ncurses-libs-6.1-9.20180224.el8.x86_64 27/172 Installing : glibc-all-langpacks-2.28-211.el8.x86_64 28/172 Installing : glibc-gconv-extra-2.28-211.el8.x86_64 29/172 Running scriptlet: glibc-gconv-extra-2.28-211.el8.x86_64 29/172 Installing : glibc-common-2.28-211.el8.x86_64 30/172 Running scriptlet: glibc-2.28-211.el8.x86_64 31/172 Installing : glibc-2.28-211.el8.x86_64 31/172 Running scriptlet: glibc-2.28-211.el8.x86_64 31/172 Installing : bash-4.4.20-4.el8_6.x86_64 32/172 Running scriptlet: bash-4.4.20-4.el8_6.x86_64 32/172 Installing : libsepol-2.9-3.el8.x86_64 33/172 Running scriptlet: libsepol-2.9-3.el8.x86_64 33/172 Installing : zlib-1.2.11-21.el8_7.x86_64 34/172 Installing : info-6.5-7.el8.x86_64 35/172 Installing : bzip2-libs-1.0.6-26.el8.x86_64 36/172 Installing : gmp-1:6.1.2-10.el8.x86_64 37/172 Running scriptlet: gmp-1:6.1.2-10.el8.x86_64 37/172 Installing : xz-libs-5.2.4-4.el8_6.x86_64 38/172 Installing : libstdc++-8.5.0-16.el8_7.x86_64 39/172 Running scriptlet: libstdc++-8.5.0-16.el8_7.x86_64 39/172 Installing : elfutils-libelf-0.187-4.el8.x86_64 40/172 Installing : libxcrypt-4.1.1-6.el8.x86_64 41/172 Installing : mpfr-3.1.6-1.el8.x86_64 42/172 Running scriptlet: mpfr-3.1.6-1.el8.x86_64 42/172 Installing : readline-7.0-10.el8.x86_64 43/172 Running scriptlet: readline-7.0-10.el8.x86_64 43/172 Installing : sqlite-libs-3.26.0-17.el8_7.x86_64 44/172 Installing : libzstd-1.4.4-1.el8.x86_64 45/172 Installing : popt-1.18-1.el8.x86_64 46/172 Installing : libcap-2.48-4.el8.x86_64 47/172 Installing : libcom_err-1.45.6-5.el8.x86_64 48/172 Running scriptlet: libcom_err-1.45.6-5.el8.x86_64 48/172 Installing : libuuid-2.32.1-39.el8_7.x86_64 49/172 Running scriptlet: libuuid-2.32.1-39.el8_7.x86_64 49/172 Installing : chkconfig-1.19.1-1.el8.x86_64 50/172 Installing : libunistring-0.9.9-3.el8.x86_64 51/172 Installing : libattr-2.4.48-3.el8.x86_64 52/172 Installing : libacl-2.2.53-1.el8.x86_64 53/172 Installing : sed-4.5-5.el8.x86_64 54/172 Running scriptlet: sed-4.5-5.el8.x86_64 54/172 Installing : libgpg-error-1.31-1.el8.x86_64 55/172 Installing : lua-libs-5.3.4-12.el8.x86_64 56/172 Installing : libffi-3.1-23.el8.x86_64 57/172 Installing : p11-kit-0.23.22-1.el8.x86_64 58/172 Installing : libidn2-2.2.0-1.el8.x86_64 59/172 Installing : libmpc-1.1.0-9.1.el8.x86_64 60/172 Installing : file-libs-5.33-21.el8.x86_64 61/172 Installing : file-5.33-21.el8.x86_64 62/172 Installing : libgcrypt-1.8.5-7.el8_6.x86_64 63/172 Running scriptlet: libgcrypt-1.8.5-7.el8_6.x86_64 63/172 Installing : unzip-6.0-46.el8.x86_64 64/172 Installing : findutils-1:4.6.0-20.el8.x86_64 65/172 Running scriptlet: findutils-1:4.6.0-20.el8.x86_64 65/172 Running scriptlet: glibc-headers-2.28-211.el8.x86_64 66/172 Installing : glibc-headers-2.28-211.el8.x86_64 66/172 Installing : elfutils-default-yama-scope-0.187-4.el8.noarch 67/172 Running scriptlet: elfutils-default-yama-scope-0.187-4.el8.noarch 67/172 Installing : elfutils-libs-0.187-4.el8.x86_64 68/172 Installing : lz4-libs-1.8.3-3.el8_4.x86_64 69/172 Installing : pcre-8.42-6.el8.x86_64 70/172 Installing : grep-3.1-6.el8.x86_64 71/172 Running scriptlet: grep-3.1-6.el8.x86_64 71/172 Installing : libcap-ng-0.7.11-1.el8.x86_64 72/172 Installing : audit-libs-3.0.7-4.el8.x86_64 73/172 Installing : keyutils-libs-1.5.10-9.el8.x86_64 74/172 Installing : gdbm-libs-1:1.18-2.el8.x86_64 75/172 Installing : expat-2.2.5-10.el8_7.1.x86_64 76/172 Installing : libtasn1-4.13-4.el8_7.x86_64 77/172 Running scriptlet: libtasn1-4.13-4.el8_7.x86_64 77/172 Installing : p11-kit-trust-0.23.22-1.el8.x86_64 78/172 Running scriptlet: p11-kit-trust-0.23.22-1.el8.x86_64 78/172 Installing : gdbm-1:1.18-2.el8.x86_64 79/172 Installing : libsemanage-2.9-9.el8_6.x86_64 80/172 Installing : xz-5.2.4-4.el8_6.x86_64 81/172 Installing : elfutils-0.187-4.el8.x86_64 82/172 Installing : zip-3.0-23.el8.x86_64 83/172 Installing : cpp-8.5.0-16.el8_7.x86_64 84/172 Running scriptlet: cpp-8.5.0-16.el8_7.x86_64 84/172 Installing : libassuan-2.5.1-3.el8.x86_64 85/172 Installing : libksba-1.3.5-8.el8_6.x86_64 86/172 Installing : tar-2:1.30-6.el8.x86_64 87/172 Running scriptlet: tar-2:1.30-6.el8.x86_64 87/172 Installing : patch-2.7.6-11.el8.x86_64 88/172 Installing : dwz-0.12-10.el8.x86_64 89/172 Installing : zstd-1.4.4-1.el8.x86_64 90/172 Installing : libstdc++-devel-8.5.0-16.el8_7.x86_64 91/172 Installing : libxml2-2.9.7-15.el8_7.1.x86_64 92/172 Installing : nettle-3.4.1-7.el8.x86_64 93/172 Running scriptlet: nettle-3.4.1-7.el8.x86_64 93/172 Installing : gnutls-3.6.16-5.el8_6.x86_64 94/172 Installing : isl-0.16.1-6.el8.x86_64 95/172 Running scriptlet: isl-0.16.1-6.el8.x86_64 95/172 Installing : bzip2-1.0.6-26.el8.x86_64 96/172 Installing : diffutils-3.6-6.el8.x86_64 97/172 Running scriptlet: diffutils-3.6-6.el8.x86_64 97/172 Installing : coreutils-common-8.30-13.el8.x86_64 98/172 Running scriptlet: coreutils-common-8.30-13.el8.x86_64 98/172 Installing : libgomp-8.5.0-16.el8_7.x86_64 99/172 Running scriptlet: libgomp-8.5.0-16.el8_7.x86_64 99/172 Installing : libsigsegv-2.11-5.el8.x86_64 100/172 Installing : gawk-4.2.1-4.el8.x86_64 101/172 Installing : npth-1.5-4.el8.x86_64 102/172 Installing : libpkgconf-1.4.2-1.el8.x86_64 103/172 Installing : pkgconf-1.4.2-1.el8.x86_64 104/172 Installing : libtool-ltdl-2.4.6-25.el8.x86_64 105/172 Running scriptlet: libtool-ltdl-2.4.6-25.el8.x86_64 105/172 Installing : libnghttp2-1.33.0-3.el8_2.1.x86_64 106/172 Installing : brotli-1.0.6-3.el8.x86_64 107/172 Installing : ncurses-6.1-9.20180224.el8.x86_64 108/172 Installing : openssl-libs-1:1.1.1k-7.el8_6.x86_64 109/172 Running scriptlet: openssl-libs-1:1.1.1k-7.el8_6.x86_64 109/172 Installing : coreutils-8.30-13.el8.x86_64 110/172 Running scriptlet: ca-certificates-2022.2.54-80.2.el8_6.noarch 111/172 Installing : ca-certificates-2022.2.54-80.2.el8_6.noarch 111/172 Running scriptlet: ca-certificates-2022.2.54-80.2.el8_6.noarch 111/172 Installing : libdb-5.3.28-42.el8_4.x86_64 112/172 Running scriptlet: libdb-5.3.28-42.el8_4.x86_64 112/172 Installing : libblkid-2.32.1-39.el8_7.x86_64 113/172 Running scriptlet: libblkid-2.32.1-39.el8_7.x86_64 113/172 Installing : libmount-2.32.1-39.el8_7.x86_64 114/172 Running scriptlet: libmount-2.32.1-39.el8_7.x86_64 114/172 Installing : systemd-libs-239-68.el8_7.2.x86_64 115/172 Running scriptlet: systemd-libs-239-68.el8_7.2.x86_64 115/172 Installing : gzip-1.9-13.el8_5.x86_64 116/172 Running scriptlet: gzip-1.9-13.el8_5.x86_64 116/172 Installing : cracklib-2.9.6-15.el8.x86_64 117/172 Installing : cracklib-dicts-2.9.6-15.el8.x86_64 118/172 Installing : binutils-2.30-117.el8.x86_64 119/172 Running scriptlet: binutils-2.30-117.el8.x86_64 119/172 Installing : shadow-utils-2:4.6-17.el8.x86_64 120/172 Running scriptlet: libutempter-1.1.6-14.el8.x86_64 121/172 Installing : libutempter-1.1.6-14.el8.x86_64 121/172 Running scriptlet: tpm2-tss-2.3.2-4.el8.x86_64 122/172 Installing : tpm2-tss-2.3.2-4.el8.x86_64 122/172 Running scriptlet: tpm2-tss-2.3.2-4.el8.x86_64 122/172 Installing : ima-evm-utils-1.3.2-12.el8.x86_64 123/172 Installing : libusbx-1.0.23-4.el8.x86_64 124/172 Installing : glib2-2.56.4-159.el8.x86_64 125/172 Installing : libbabeltrace-1.5.4-4.el8.x86_64 126/172 Running scriptlet: libbabeltrace-1.5.4-4.el8.x86_64 126/172 Installing : libfdisk-2.32.1-39.el8_7.x86_64 127/172 Running scriptlet: libfdisk-2.32.1-39.el8_7.x86_64 127/172 Installing : libdb-utils-5.3.28-42.el8_4.x86_64 128/172 Installing : libarchive-3.3.3-4.el8.x86_64 129/172 Installing : cpio-2.12-11.el8.x86_64 130/172 Installing : libverto-0.3.2-2.el8.x86_64 131/172 Installing : krb5-libs-1.18.2-22.el8_7.x86_64 132/172 Installing : libtirpc-1.1.4-8.el8.x86_64 133/172 Running scriptlet: libtirpc-1.1.4-8.el8.x86_64 133/172 Installing : libnsl2-1.2.0-2.20180605git4a062cf.el8.x86_64 134/172 Running scriptlet: libnsl2-1.2.0-2.20180605git4a062cf.el8.x86_64 134/172 Installing : libpwquality-1.4.4-5.el8.x86_64 135/172 Installing : pam-1.3.1-22.el8.x86_64 136/172 Running scriptlet: pam-1.3.1-22.el8.x86_64 136/172 Installing : platform-python-setuptools-39.2.0-6.el8.noarch 137/172 Installing : platform-python-3.6.8-48.el8_7.x86_64 138/172 Running scriptlet: platform-python-3.6.8-48.el8_7.x86_64 138/172 Installing : python3-libs-3.6.8-48.el8_7.x86_64 139/172 Installing : cyrus-sasl-lib-2.1.27-6.el8_5.x86_64 140/172 Running scriptlet: cyrus-sasl-lib-2.1.27-6.el8_5.x86_64 140/172 Installing : openldap-2.4.46-18.el8.x86_64 141/172 Installing : gnupg2-2.2.20-3.el8_6.x86_64 142/172 Installing : libssh-0.9.6-3.el8.x86_64 143/172 Installing : libsmartcols-2.32.1-39.el8_7.x86_64 144/172 Running scriptlet: libsmartcols-2.32.1-39.el8_7.x86_64 144/172 Installing : libatomic_ops-7.6.2-3.el8.x86_64 145/172 Installing : gc-7.6.4-3.el8.x86_64 146/172 Installing : guile-5:2.0.14-7.el8.x86_64 147/172 Running scriptlet: guile-5:2.0.14-7.el8.x86_64 147/172 Installing : libipt-1.6.1-8.el8.x86_64 148/172 Installing : pkgconf-m4-1.4.2-1.el8.noarch 149/172 Installing : pkgconf-pkg-config-1.4.2-1.el8.x86_64 150/172 Installing : glibc-devel-2.28-211.el8.x86_64 151/172 Running scriptlet: glibc-devel-2.28-211.el8.x86_64 151/172 Installing : libxcrypt-devel-4.1.1-6.el8.x86_64 152/172 Installing : gcc-8.5.0-16.el8_7.x86_64 153/172 Running scriptlet: gcc-8.5.0-16.el8_7.x86_64 153/172 Installing : annobin-10.67-3.el8.x86_64 154/172 Installing : gcc-plugin-annobin-8.5.0-16.el8_7.x86_64 155/172 Installing : publicsuffix-list-dafsa-20180723-1.el8.noarch 156/172 Installing : libpsl-0.20.2-6.el8.x86_64 157/172 Installing : libcurl-7.61.1-25.el8_7.1.x86_64 158/172 Installing : curl-7.61.1-25.el8_7.1.x86_64 159/172 Installing : rpm-libs-4.14.3-24.el8_7.x86_64 160/172 Running scriptlet: rpm-libs-4.14.3-24.el8_7.x86_64 160/172 Installing : rpm-4.14.3-24.el8_7.x86_64 161/172 Installing : efi-srpm-macros-3-3.el8.noarch 162/172 Installing : redhat-rpm-config-130-1.el8.noarch 163/172 Running scriptlet: redhat-rpm-config-130-1.el8.noarch 163/172 Installing : lua-srpm-macros-1-3.el8.noarch 164/172 Installing : rpm-build-libs-4.14.3-24.el8_7.x86_64 165/172 Running scriptlet: rpm-build-libs-4.14.3-24.el8_7.x86_64 165/172 Installing : gdb-headless-8.2-19.el8.x86_64 166/172 Installing : rpm-build-4.14.3-24.el8_7.x86_64 167/172 Installing : epel-rpm-macros-8-35.noarch 168/172 Installing : gcc-c++-8.5.0-16.el8_7.x86_64 169/172 Installing : util-linux-2.32.1-39.el8_7.x86_64 170/172 Running scriptlet: util-linux-2.32.1-39.el8_7.x86_64 170/172 Installing : which-2.21-18.el8.x86_64 171/172 Installing : make-1:4.2.1-11.el8.x86_64 172/172 Running scriptlet: make-1:4.2.1-11.el8.x86_64 172/172 Running scriptlet: filesystem-3.8-6.el8.x86_64 172/172 Running scriptlet: glibc-all-langpacks-2.28-211.el8.x86_64 172/172 Running scriptlet: ca-certificates-2022.2.54-80.2.el8_6.noarch 172/172 Running scriptlet: guile-5:2.0.14-7.el8.x86_64 172/172 Running scriptlet: make-1:4.2.1-11.el8.x86_64 172/172 Verifying : libassuan-2.5.1-3.el8.x86_64 1/172 Verifying : cracklib-2.9.6-15.el8.x86_64 2/172 Verifying : libutempter-1.1.6-14.el8.x86_64 3/172 Verifying : grep-3.1-6.el8.x86_64 4/172 Verifying : readline-7.0-10.el8.x86_64 5/172 Verifying : pkgconf-1.4.2-1.el8.x86_64 6/172 Verifying : libsigsegv-2.11-5.el8.x86_64 7/172 Verifying : npth-1.5-4.el8.x86_64 8/172 Verifying : cracklib-dicts-2.9.6-15.el8.x86_64 9/172 Verifying : libattr-2.4.48-3.el8.x86_64 10/172 Verifying : pkgconf-pkg-config-1.4.2-1.el8.x86_64 11/172 Verifying : bzip2-libs-1.0.6-26.el8.x86_64 12/172 Verifying : mpfr-3.1.6-1.el8.x86_64 13/172 Verifying : zip-3.0-23.el8.x86_64 14/172 Verifying : libunistring-0.9.9-3.el8.x86_64 15/172 Verifying : bzip2-1.0.6-26.el8.x86_64 16/172 Verifying : libnsl2-1.2.0-2.20180605git4a062cf.el8.x86_64 17/172 Verifying : libpkgconf-1.4.2-1.el8.x86_64 18/172 Verifying : publicsuffix-list-dafsa-20180723-1.el8.noarch 19/172 Verifying : pkgconf-m4-1.4.2-1.el8.noarch 20/172 Verifying : findutils-1:4.6.0-20.el8.x86_64 21/172 Verifying : libacl-2.2.53-1.el8.x86_64 22/172 Verifying : basesystem-11-5.el8.noarch 23/172 Verifying : libtool-ltdl-2.4.6-25.el8.x86_64 24/172 Verifying : libgpg-error-1.31-1.el8.x86_64 25/172 Verifying : gmp-1:6.1.2-10.el8.x86_64 26/172 Verifying : diffutils-3.6-6.el8.x86_64 27/172 Verifying : libidn2-2.2.0-1.el8.x86_64 28/172 Verifying : patch-2.7.6-11.el8.x86_64 29/172 Verifying : libnghttp2-1.33.0-3.el8_2.1.x86_64 30/172 Verifying : libzstd-1.4.4-1.el8.x86_64 31/172 Verifying : python3-setuptools-wheel-39.2.0-6.el8.noarch 32/172 Verifying : libusbx-1.0.23-4.el8.x86_64 33/172 Verifying : platform-python-setuptools-39.2.0-6.el8.noarch 34/172 Verifying : p11-kit-trust-0.23.22-1.el8.x86_64 35/172 Verifying : libpsl-0.20.2-6.el8.x86_64 36/172 Verifying : popt-1.18-1.el8.x86_64 37/172 Verifying : brotli-1.0.6-3.el8.x86_64 38/172 Verifying : lz4-libs-1.8.3-3.el8_4.x86_64 39/172 Verifying : ima-evm-utils-1.3.2-12.el8.x86_64 40/172 Verifying : p11-kit-0.23.22-1.el8.x86_64 41/172 Verifying : libxcrypt-devel-4.1.1-6.el8.x86_64 42/172 Verifying : tpm2-tss-2.3.2-4.el8.x86_64 43/172 Verifying : pcre-8.42-6.el8.x86_64 44/172 Verifying : openldap-2.4.46-18.el8.x86_64 45/172 Verifying : nettle-3.4.1-7.el8.x86_64 46/172 Verifying : ncurses-libs-6.1-9.20180224.el8.x86_64 47/172 Verifying : libdb-utils-5.3.28-42.el8_4.x86_64 48/172 Verifying : filesystem-3.8-6.el8.x86_64 49/172 Verifying : libxcrypt-4.1.1-6.el8.x86_64 50/172 Verifying : chkconfig-1.19.1-1.el8.x86_64 51/172 Verifying : libcap-ng-0.7.11-1.el8.x86_64 52/172 Verifying : libdb-5.3.28-42.el8_4.x86_64 53/172 Verifying : ncurses-6.1-9.20180224.el8.x86_64 54/172 Verifying : libsepol-2.9-3.el8.x86_64 55/172 Verifying : gzip-1.9-13.el8_5.x86_64 56/172 Verifying : keyutils-libs-1.5.10-9.el8.x86_64 57/172 Verifying : ncurses-base-6.1-9.20180224.el8.noarch 58/172 Verifying : cyrus-sasl-lib-2.1.27-6.el8_5.x86_64 59/172 Verifying : lua-libs-5.3.4-12.el8.x86_64 60/172 Verifying : cpio-2.12-11.el8.x86_64 61/172 Verifying : sed-4.5-5.el8.x86_64 62/172 Verifying : make-1:4.2.1-11.el8.x86_64 63/172 Verifying : libffi-3.1-23.el8.x86_64 64/172 Verifying : python3-pip-wheel-9.0.3-22.el8.noarch 65/172 Verifying : libssh-0.9.6-3.el8.x86_64 66/172 Verifying : gawk-4.2.1-4.el8.x86_64 67/172 Verifying : xz-libs-5.2.4-4.el8_6.x86_64 68/172 Verifying : xz-5.2.4-4.el8_6.x86_64 69/172 Verifying : crypto-policies-20211116-1.gitae470d6.el8.noarch 70/172 Verifying : info-6.5-7.el8.x86_64 71/172 Verifying : libssh-config-0.9.6-3.el8.noarch 72/172 Verifying : unzip-6.0-46.el8.x86_64 73/172 Verifying : coreutils-8.30-13.el8.x86_64 74/172 Verifying : libpwquality-1.4.4-5.el8.x86_64 75/172 Verifying : glibc-headers-2.28-211.el8.x86_64 76/172 Verifying : tar-2:1.30-6.el8.x86_64 77/172 Verifying : glibc-all-langpacks-2.28-211.el8.x86_64 78/172 Verifying : libbabeltrace-1.5.4-4.el8.x86_64 79/172 Verifying : libksba-1.3.5-8.el8_6.x86_64 80/172 Verifying : libverto-0.3.2-2.el8.x86_64 81/172 Verifying : gdbm-libs-1:1.18-2.el8.x86_64 82/172 Verifying : gnupg2-2.2.20-3.el8_6.x86_64 83/172 Verifying : coreutils-common-8.30-13.el8.x86_64 84/172 Verifying : libtirpc-1.1.4-8.el8.x86_64 85/172 Verifying : ca-certificates-2022.2.54-80.2.el8_6.noarch 86/172 Verifying : pcre2-10.32-3.el8_6.x86_64 87/172 Verifying : pam-1.3.1-22.el8.x86_64 88/172 Verifying : libgcrypt-1.8.5-7.el8_6.x86_64 89/172 Verifying : binutils-2.30-117.el8.x86_64 90/172 Verifying : glibc-devel-2.28-211.el8.x86_64 91/172 Verifying : openssl-libs-1:1.1.1k-7.el8_6.x86_64 92/172 Verifying : libcom_err-1.45.6-5.el8.x86_64 93/172 Verifying : libsemanage-2.9-9.el8_6.x86_64 94/172 Verifying : bash-4.4.20-4.el8_6.x86_64 95/172 Verifying : gnutls-3.6.16-5.el8_6.x86_64 96/172 Verifying : glibc-gconv-extra-2.28-211.el8.x86_64 97/172 Verifying : elfutils-libelf-0.187-4.el8.x86_64 98/172 Verifying : file-libs-5.33-21.el8.x86_64 99/172 Verifying : file-5.33-21.el8.x86_64 100/172 Verifying : which-2.21-18.el8.x86_64 101/172 Verifying : gdbm-1:1.18-2.el8.x86_64 102/172 Verifying : glibc-2.28-211.el8.x86_64 103/172 Verifying : elfutils-0.187-4.el8.x86_64 104/172 Verifying : glibc-common-2.28-211.el8.x86_64 105/172 Verifying : setup-2.12.2-7.el8.noarch 106/172 Verifying : elfutils-libs-0.187-4.el8.x86_64 107/172 Verifying : libarchive-3.3.3-4.el8.x86_64 108/172 Verifying : audit-libs-3.0.7-4.el8.x86_64 109/172 Verifying : libcap-2.48-4.el8.x86_64 110/172 Verifying : elfutils-default-yama-scope-0.187-4.el8.noarch 111/172 Verifying : shadow-utils-2:4.6-17.el8.x86_64 112/172 Verifying : glib2-2.56.4-159.el8.x86_64 113/172 Verifying : libselinux-2.9-6.el8.x86_64 114/172 Verifying : redhat-release-8.7-0.3.el8.x86_64 115/172 Verifying : rpm-libs-4.14.3-24.el8_7.x86_64 116/172 Verifying : rpm-4.14.3-24.el8_7.x86_64 117/172 Verifying : python3-libs-3.6.8-48.el8_7.x86_64 118/172 Verifying : rpm-build-libs-4.14.3-24.el8_7.x86_64 119/172 Verifying : platform-python-3.6.8-48.el8_7.x86_64 120/172 Verifying : krb5-libs-1.18.2-22.el8_7.x86_64 121/172 Verifying : tzdata-2022g-1.el8.noarch 122/172 Verifying : curl-7.61.1-25.el8_7.1.x86_64 123/172 Verifying : libuuid-2.32.1-39.el8_7.x86_64 124/172 Verifying : libgcc-8.5.0-16.el8_7.x86_64 125/172 Verifying : util-linux-2.32.1-39.el8_7.x86_64 126/172 Verifying : expat-2.2.5-10.el8_7.1.x86_64 127/172 Verifying : libtasn1-4.13-4.el8_7.x86_64 128/172 Verifying : libblkid-2.32.1-39.el8_7.x86_64 129/172 Verifying : kernel-headers-4.18.0-425.10.1.el8_7.x86_64 130/172 Verifying : libstdc++-8.5.0-16.el8_7.x86_64 131/172 Verifying : libcurl-7.61.1-25.el8_7.1.x86_64 132/172 Verifying : libmount-2.32.1-39.el8_7.x86_64 133/172 Verifying : systemd-libs-239-68.el8_7.2.x86_64 134/172 Verifying : zlib-1.2.11-21.el8_7.x86_64 135/172 Verifying : libgomp-8.5.0-16.el8_7.x86_64 136/172 Verifying : sqlite-libs-3.26.0-17.el8_7.x86_64 137/172 Verifying : libfdisk-2.32.1-39.el8_7.x86_64 138/172 Verifying : libsmartcols-2.32.1-39.el8_7.x86_64 139/172 Verifying : libxml2-2.9.7-15.el8_7.1.x86_64 140/172 Verifying : rust-srpm-macros-5-2.el8.noarch 141/172 Verifying : ocaml-srpm-macros-5-4.el8.noarch 142/172 Verifying : ghc-srpm-macros-1.4.2-7.el8.noarch 143/172 Verifying : openblas-srpm-macros-2-2.el8.noarch 144/172 Verifying : perl-srpm-macros-1-25.el8.noarch 145/172 Verifying : libatomic_ops-7.6.2-3.el8.x86_64 146/172 Verifying : gc-7.6.4-3.el8.x86_64 147/172 Verifying : guile-5:2.0.14-7.el8.x86_64 148/172 Verifying : isl-0.16.1-6.el8.x86_64 149/172 Verifying : libipt-1.6.1-8.el8.x86_64 150/172 Verifying : zstd-1.4.4-1.el8.x86_64 151/172 Verifying : libmpc-1.1.0-9.1.el8.x86_64 152/172 Verifying : efi-srpm-macros-3-3.el8.noarch 153/172 Verifying : go-srpm-macros-2-17.el8.noarch 154/172 Verifying : dwz-0.12-10.el8.x86_64 155/172 Verifying : qt5-srpm-macros-5.15.3-1.el8.noarch 156/172 Verifying : python3-rpm-macros-3-43.el8.noarch 157/172 Verifying : redhat-rpm-config-130-1.el8.noarch 158/172 Verifying : gdb-headless-8.2-19.el8.x86_64 159/172 Verifying : python-rpm-macros-3-43.el8.noarch 160/172 Verifying : python-srpm-macros-3-43.el8.noarch 161/172 Verifying : annobin-10.67-3.el8.x86_64 162/172 Verifying : rpm-build-4.14.3-24.el8_7.x86_64 163/172 Verifying : cpp-8.5.0-16.el8_7.x86_64 164/172 Verifying : gcc-8.5.0-16.el8_7.x86_64 165/172 Verifying : libstdc++-devel-8.5.0-16.el8_7.x86_64 166/172 Verifying : gcc-plugin-annobin-8.5.0-16.el8_7.x86_64 167/172 Verifying : gcc-c++-8.5.0-16.el8_7.x86_64 168/172 Verifying : ansible-srpm-macros-1-8.1.el8.noarch 169/172 Verifying : epel-rpm-macros-8-35.noarch 170/172 Verifying : fpc-srpm-macros-1.3-1.el8.noarch 171/172 Verifying : lua-srpm-macros-1-3.el8.noarch 172/172 Installed products updated. Installed: annobin-10.67-3.el8.x86_64 ansible-srpm-macros-1-8.1.el8.noarch audit-libs-3.0.7-4.el8.x86_64 basesystem-11-5.el8.noarch bash-4.4.20-4.el8_6.x86_64 binutils-2.30-117.el8.x86_64 brotli-1.0.6-3.el8.x86_64 bzip2-1.0.6-26.el8.x86_64 bzip2-libs-1.0.6-26.el8.x86_64 ca-certificates-2022.2.54-80.2.el8_6.noarch chkconfig-1.19.1-1.el8.x86_64 coreutils-8.30-13.el8.x86_64 coreutils-common-8.30-13.el8.x86_64 cpio-2.12-11.el8.x86_64 cpp-8.5.0-16.el8_7.x86_64 cracklib-2.9.6-15.el8.x86_64 cracklib-dicts-2.9.6-15.el8.x86_64 crypto-policies-20211116-1.gitae470d6.el8.noarch curl-7.61.1-25.el8_7.1.x86_64 cyrus-sasl-lib-2.1.27-6.el8_5.x86_64 diffutils-3.6-6.el8.x86_64 dwz-0.12-10.el8.x86_64 efi-srpm-macros-3-3.el8.noarch elfutils-0.187-4.el8.x86_64 elfutils-default-yama-scope-0.187-4.el8.noarch elfutils-libelf-0.187-4.el8.x86_64 elfutils-libs-0.187-4.el8.x86_64 epel-rpm-macros-8-35.noarch expat-2.2.5-10.el8_7.1.x86_64 file-5.33-21.el8.x86_64 file-libs-5.33-21.el8.x86_64 filesystem-3.8-6.el8.x86_64 findutils-1:4.6.0-20.el8.x86_64 fpc-srpm-macros-1.3-1.el8.noarch gawk-4.2.1-4.el8.x86_64 gc-7.6.4-3.el8.x86_64 gcc-8.5.0-16.el8_7.x86_64 gcc-c++-8.5.0-16.el8_7.x86_64 gcc-plugin-annobin-8.5.0-16.el8_7.x86_64 gdb-headless-8.2-19.el8.x86_64 gdbm-1:1.18-2.el8.x86_64 gdbm-libs-1:1.18-2.el8.x86_64 ghc-srpm-macros-1.4.2-7.el8.noarch glib2-2.56.4-159.el8.x86_64 glibc-2.28-211.el8.x86_64 glibc-all-langpacks-2.28-211.el8.x86_64 glibc-common-2.28-211.el8.x86_64 glibc-devel-2.28-211.el8.x86_64 glibc-gconv-extra-2.28-211.el8.x86_64 glibc-headers-2.28-211.el8.x86_64 gmp-1:6.1.2-10.el8.x86_64 gnupg2-2.2.20-3.el8_6.x86_64 gnutls-3.6.16-5.el8_6.x86_64 go-srpm-macros-2-17.el8.noarch grep-3.1-6.el8.x86_64 guile-5:2.0.14-7.el8.x86_64 gzip-1.9-13.el8_5.x86_64 ima-evm-utils-1.3.2-12.el8.x86_64 info-6.5-7.el8.x86_64 isl-0.16.1-6.el8.x86_64 kernel-headers-4.18.0-425.10.1.el8_7.x86_64 keyutils-libs-1.5.10-9.el8.x86_64 krb5-libs-1.18.2-22.el8_7.x86_64 libacl-2.2.53-1.el8.x86_64 libarchive-3.3.3-4.el8.x86_64 libassuan-2.5.1-3.el8.x86_64 libatomic_ops-7.6.2-3.el8.x86_64 libattr-2.4.48-3.el8.x86_64 libbabeltrace-1.5.4-4.el8.x86_64 libblkid-2.32.1-39.el8_7.x86_64 libcap-2.48-4.el8.x86_64 libcap-ng-0.7.11-1.el8.x86_64 libcom_err-1.45.6-5.el8.x86_64 libcurl-7.61.1-25.el8_7.1.x86_64 libdb-5.3.28-42.el8_4.x86_64 libdb-utils-5.3.28-42.el8_4.x86_64 libfdisk-2.32.1-39.el8_7.x86_64 libffi-3.1-23.el8.x86_64 libgcc-8.5.0-16.el8_7.x86_64 libgcrypt-1.8.5-7.el8_6.x86_64 libgomp-8.5.0-16.el8_7.x86_64 libgpg-error-1.31-1.el8.x86_64 libidn2-2.2.0-1.el8.x86_64 libipt-1.6.1-8.el8.x86_64 libksba-1.3.5-8.el8_6.x86_64 libmount-2.32.1-39.el8_7.x86_64 libmpc-1.1.0-9.1.el8.x86_64 libnghttp2-1.33.0-3.el8_2.1.x86_64 libnsl2-1.2.0-2.20180605git4a062cf.el8.x86_64 libpkgconf-1.4.2-1.el8.x86_64 libpsl-0.20.2-6.el8.x86_64 libpwquality-1.4.4-5.el8.x86_64 libselinux-2.9-6.el8.x86_64 libsemanage-2.9-9.el8_6.x86_64 libsepol-2.9-3.el8.x86_64 libsigsegv-2.11-5.el8.x86_64 libsmartcols-2.32.1-39.el8_7.x86_64 libssh-0.9.6-3.el8.x86_64 libssh-config-0.9.6-3.el8.noarch libstdc++-8.5.0-16.el8_7.x86_64 libstdc++-devel-8.5.0-16.el8_7.x86_64 libtasn1-4.13-4.el8_7.x86_64 libtirpc-1.1.4-8.el8.x86_64 libtool-ltdl-2.4.6-25.el8.x86_64 libunistring-0.9.9-3.el8.x86_64 libusbx-1.0.23-4.el8.x86_64 libutempter-1.1.6-14.el8.x86_64 libuuid-2.32.1-39.el8_7.x86_64 libverto-0.3.2-2.el8.x86_64 libxcrypt-4.1.1-6.el8.x86_64 libxcrypt-devel-4.1.1-6.el8.x86_64 libxml2-2.9.7-15.el8_7.1.x86_64 libzstd-1.4.4-1.el8.x86_64 lua-libs-5.3.4-12.el8.x86_64 lua-srpm-macros-1-3.el8.noarch lz4-libs-1.8.3-3.el8_4.x86_64 make-1:4.2.1-11.el8.x86_64 mpfr-3.1.6-1.el8.x86_64 ncurses-6.1-9.20180224.el8.x86_64 ncurses-base-6.1-9.20180224.el8.noarch ncurses-libs-6.1-9.20180224.el8.x86_64 nettle-3.4.1-7.el8.x86_64 npth-1.5-4.el8.x86_64 ocaml-srpm-macros-5-4.el8.noarch openblas-srpm-macros-2-2.el8.noarch openldap-2.4.46-18.el8.x86_64 openssl-libs-1:1.1.1k-7.el8_6.x86_64 p11-kit-0.23.22-1.el8.x86_64 p11-kit-trust-0.23.22-1.el8.x86_64 pam-1.3.1-22.el8.x86_64 patch-2.7.6-11.el8.x86_64 pcre-8.42-6.el8.x86_64 pcre2-10.32-3.el8_6.x86_64 perl-srpm-macros-1-25.el8.noarch pkgconf-1.4.2-1.el8.x86_64 pkgconf-m4-1.4.2-1.el8.noarch pkgconf-pkg-config-1.4.2-1.el8.x86_64 platform-python-3.6.8-48.el8_7.x86_64 platform-python-setuptools-39.2.0-6.el8.noarch popt-1.18-1.el8.x86_64 publicsuffix-list-dafsa-20180723-1.el8.noarch python-rpm-macros-3-43.el8.noarch python-srpm-macros-3-43.el8.noarch python3-libs-3.6.8-48.el8_7.x86_64 python3-pip-wheel-9.0.3-22.el8.noarch python3-rpm-macros-3-43.el8.noarch python3-setuptools-wheel-39.2.0-6.el8.noarch qt5-srpm-macros-5.15.3-1.el8.noarch readline-7.0-10.el8.x86_64 redhat-release-8.7-0.3.el8.x86_64 redhat-rpm-config-130-1.el8.noarch rpm-4.14.3-24.el8_7.x86_64 rpm-build-4.14.3-24.el8_7.x86_64 rpm-build-libs-4.14.3-24.el8_7.x86_64 rpm-libs-4.14.3-24.el8_7.x86_64 rust-srpm-macros-5-2.el8.noarch sed-4.5-5.el8.x86_64 setup-2.12.2-7.el8.noarch shadow-utils-2:4.6-17.el8.x86_64 sqlite-libs-3.26.0-17.el8_7.x86_64 systemd-libs-239-68.el8_7.2.x86_64 tar-2:1.30-6.el8.x86_64 tpm2-tss-2.3.2-4.el8.x86_64 tzdata-2022g-1.el8.noarch unzip-6.0-46.el8.x86_64 util-linux-2.32.1-39.el8_7.x86_64 which-2.21-18.el8.x86_64 xz-5.2.4-4.el8_6.x86_64 xz-libs-5.2.4-4.el8_6.x86_64 zip-3.0-23.el8.x86_64 zlib-1.2.11-21.el8_7.x86_64 zstd-1.4.4-1.el8.x86_64 Complete! No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 67 kB/s | 3.6 kB 00:00 Red Hat Enterprise Linux - BaseOS 17 kB/s | 4.1 kB 00:00 Red Hat Enterprise Linux - AppStream 8.2 kB/s | 4.5 kB 00:00 Red Hat Enterprise Linux - CodeReady Linux Buil 15 kB/s | 4.5 kB 00:00 Extra Packages for Enterprise Linux 8 - x86_64 625 kB/s | 28 kB 00:00 Dependencies resolved. ================================================================================ Package Arch Version Repository Size ================================================================================ Installing: scl-utils-build x86_64 1:2.0.2-15.el8 rhel-appstream 26 k Installing dependencies: iso-codes noarch 3.79-2.el8 rhel-appstream 3.4 M xml-common noarch 0.6.3-50.el8 rhel-baseos 39 k Transaction Summary ================================================================================ Install 3 Packages Total download size: 3.5 M Installed size: 17 M Downloading Packages: (1/3): xml-common-0.6.3-50.el8.noarch.rpm 112 kB/s | 39 kB 00:00 (2/3): scl-utils-build-2.0.2-15.el8.x86_64.rpm 66 kB/s | 26 kB 00:00 (3/3): iso-codes-3.79-2.el8.noarch.rpm 4.5 MB/s | 3.4 MB 00:00 -------------------------------------------------------------------------------- Total 4.6 MB/s | 3.5 MB 00:00 Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Preparing : 1/1 Running scriptlet: xml-common-0.6.3-50.el8.noarch 1/3 Installing : xml-common-0.6.3-50.el8.noarch 1/3 Installing : iso-codes-3.79-2.el8.noarch 2/3 Installing : scl-utils-build-1:2.0.2-15.el8.x86_64 3/3 Running scriptlet: scl-utils-build-1:2.0.2-15.el8.x86_64 3/3 Verifying : xml-common-0.6.3-50.el8.noarch 1/3 Verifying : iso-codes-3.79-2.el8.noarch 2/3 Verifying : scl-utils-build-1:2.0.2-15.el8.x86_64 3/3 Installed products updated. Installed: iso-codes-3.79-2.el8.noarch scl-utils-build-1:2.0.2-15.el8.x86_64 xml-common-0.6.3-50.el8.noarch Complete! Finish: dnf install Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: libacl-2.2.53-1.el8.x86_64 rpm-build-libs-4.14.3-24.el8_7.x86_64 pkgconf-pkg-config-1.4.2-1.el8.x86_64 libpwquality-1.4.4-5.el8.x86_64 cyrus-sasl-lib-2.1.27-6.el8_5.x86_64 gpg-pubkey-2fa658e0-45700c69 ca-certificates-2022.2.54-80.2.el8_6.noarch libtirpc-1.1.4-8.el8.x86_64 tzdata-2022g-1.el8.noarch libpkgconf-1.4.2-1.el8.x86_64 libmpc-1.1.0-9.1.el8.x86_64 expat-2.2.5-10.el8_7.1.x86_64 libdb-5.3.28-42.el8_4.x86_64 libffi-3.1-23.el8.x86_64 glibc-common-2.28-211.el8.x86_64 gnupg2-2.2.20-3.el8_6.x86_64 rust-srpm-macros-5-2.el8.noarch libidn2-2.2.0-1.el8.x86_64 gzip-1.9-13.el8_5.x86_64 ghc-srpm-macros-1.4.2-7.el8.noarch gdbm-1.18-2.el8.x86_64 libverto-0.3.2-2.el8.x86_64 libatomic_ops-7.6.2-3.el8.x86_64 glibc-headers-2.28-211.el8.x86_64 python3-rpm-macros-3-43.el8.noarch coreutils-8.30-13.el8.x86_64 crypto-policies-20211116-1.gitae470d6.el8.noarch glibc-2.28-211.el8.x86_64 libgcrypt-1.8.5-7.el8_6.x86_64 libssh-0.9.6-3.el8.x86_64 libbabeltrace-1.5.4-4.el8.x86_64 libsigsegv-2.11-5.el8.x86_64 ncurses-base-6.1-9.20180224.el8.noarch libarchive-3.3.3-4.el8.x86_64 scl-utils-build-2.0.2-15.el8.x86_64 unzip-6.0-46.el8.x86_64 libgcc-8.5.0-16.el8_7.x86_64 krb5-libs-1.18.2-22.el8_7.x86_64 libipt-1.6.1-8.el8.x86_64 epel-rpm-macros-8-35.noarch cracklib-dicts-2.9.6-15.el8.x86_64 tar-1.30-6.el8.x86_64 pkgconf-1.4.2-1.el8.x86_64 libgomp-8.5.0-16.el8_7.x86_64 openssl-libs-1.1.1k-7.el8_6.x86_64 pkgconf-m4-1.4.2-1.el8.noarch libuuid-2.32.1-39.el8_7.x86_64 ocaml-srpm-macros-5-4.el8.noarch bash-4.4.20-4.el8_6.x86_64 curl-7.61.1-25.el8_7.1.x86_64 platform-python-3.6.8-48.el8_7.x86_64 libattr-2.4.48-3.el8.x86_64 filesystem-3.8-6.el8.x86_64 libnghttp2-1.33.0-3.el8_2.1.x86_64 keyutils-libs-1.5.10-9.el8.x86_64 libassuan-2.5.1-3.el8.x86_64 npth-1.5-4.el8.x86_64 libutempter-1.1.6-14.el8.x86_64 shadow-utils-4.6-17.el8.x86_64 glibc-all-langpacks-2.28-211.el8.x86_64 setup-2.12.2-7.el8.noarch cpp-8.5.0-16.el8_7.x86_64 libksba-1.3.5-8.el8_6.x86_64 guile-2.0.14-7.el8.x86_64 kernel-headers-4.18.0-425.10.1.el8_7.x86_64 libcap-ng-0.7.11-1.el8.x86_64 libzstd-1.4.4-1.el8.x86_64 libpsl-0.20.2-6.el8.x86_64 fpc-srpm-macros-1.3-1.el8.noarch audit-libs-3.0.7-4.el8.x86_64 openldap-2.4.46-18.el8.x86_64 libsemanage-2.9-9.el8_6.x86_64 glibc-gconv-extra-2.28-211.el8.x86_64 coreutils-common-8.30-13.el8.x86_64 tpm2-tss-2.3.2-4.el8.x86_64 xml-common-0.6.3-50.el8.noarch platform-python-setuptools-39.2.0-6.el8.noarch gnutls-3.6.16-5.el8_6.x86_64 libmount-2.32.1-39.el8_7.x86_64 libusbx-1.0.23-4.el8.x86_64 xz-libs-5.2.4-4.el8_6.x86_64 redhat-rpm-config-130-1.el8.noarch openblas-srpm-macros-2-2.el8.noarch go-srpm-macros-2-17.el8.noarch zstd-1.4.4-1.el8.x86_64 rpm-build-4.14.3-24.el8_7.x86_64 rpm-libs-4.14.3-24.el8_7.x86_64 libstdc++-8.5.0-16.el8_7.x86_64 mpfr-3.1.6-1.el8.x86_64 gc-7.6.4-3.el8.x86_64 libselinux-2.9-6.el8.x86_64 gcc-8.5.0-16.el8_7.x86_64 publicsuffix-list-dafsa-20180723-1.el8.noarch elfutils-default-yama-scope-0.187-4.el8.noarch ncurses-6.1-9.20180224.el8.x86_64 p11-kit-0.23.22-1.el8.x86_64 dwz-0.12-10.el8.x86_64 ima-evm-utils-1.3.2-12.el8.x86_64 zlib-1.2.11-21.el8_7.x86_64 binutils-2.30-117.el8.x86_64 libsmartcols-2.32.1-39.el8_7.x86_64 bzip2-libs-1.0.6-26.el8.x86_64 gcc-c++-8.5.0-16.el8_7.x86_64 xz-5.2.4-4.el8_6.x86_64 libstdc++-devel-8.5.0-16.el8_7.x86_64 gdb-headless-8.2-19.el8.x86_64 lz4-libs-1.8.3-3.el8_4.x86_64 libgpg-error-1.31-1.el8.x86_64 cracklib-2.9.6-15.el8.x86_64 nettle-3.4.1-7.el8.x86_64 elfutils-0.187-4.el8.x86_64 bzip2-1.0.6-26.el8.x86_64 libsepol-2.9-3.el8.x86_64 python3-libs-3.6.8-48.el8_7.x86_64 lua-libs-5.3.4-12.el8.x86_64 file-5.33-21.el8.x86_64 libxcrypt-devel-4.1.1-6.el8.x86_64 libcap-2.48-4.el8.x86_64 gdbm-libs-1.18-2.el8.x86_64 make-4.2.1-11.el8.x86_64 patch-2.7.6-11.el8.x86_64 util-linux-2.32.1-39.el8_7.x86_64 brotli-1.0.6-3.el8.x86_64 libxml2-2.9.7-15.el8_7.1.x86_64 qt5-srpm-macros-5.15.3-1.el8.noarch libxcrypt-4.1.1-6.el8.x86_64 elfutils-libs-0.187-4.el8.x86_64 libdb-utils-5.3.28-42.el8_4.x86_64 libcurl-7.61.1-25.el8_7.1.x86_64 info-6.5-7.el8.x86_64 cpio-2.12-11.el8.x86_64 python-rpm-macros-3-43.el8.noarch sed-4.5-5.el8.x86_64 systemd-libs-239-68.el8_7.2.x86_64 gpg-pubkey-2f86d6a1-5cf7cefb python3-setuptools-wheel-39.2.0-6.el8.noarch libcom_err-1.45.6-5.el8.x86_64 chkconfig-1.19.1-1.el8.x86_64 libunistring-0.9.9-3.el8.x86_64 basesystem-11-5.el8.noarch grep-3.1-6.el8.x86_64 diffutils-3.6-6.el8.x86_64 p11-kit-trust-0.23.22-1.el8.x86_64 elfutils-libelf-0.187-4.el8.x86_64 file-libs-5.33-21.el8.x86_64 which-2.21-18.el8.x86_64 libtool-ltdl-2.4.6-25.el8.x86_64 zip-3.0-23.el8.x86_64 iso-codes-3.79-2.el8.noarch gawk-4.2.1-4.el8.x86_64 pam-1.3.1-22.el8.x86_64 pcre2-10.32-3.el8_6.x86_64 annobin-10.67-3.el8.x86_64 perl-srpm-macros-1-25.el8.noarch gpg-pubkey-fd431d51-4ae0493b readline-7.0-10.el8.x86_64 glibc-devel-2.28-211.el8.x86_64 python-srpm-macros-3-43.el8.noarch python3-pip-wheel-9.0.3-22.el8.noarch libblkid-2.32.1-39.el8_7.x86_64 findutils-4.6.0-20.el8.x86_64 libnsl2-1.2.0-2.20180605git4a062cf.el8.x86_64 gcc-plugin-annobin-8.5.0-16.el8_7.x86_64 libtasn1-4.13-4.el8_7.x86_64 ncurses-libs-6.1-9.20180224.el8.x86_64 libfdisk-2.32.1-39.el8_7.x86_64 gmp-6.1.2-10.el8.x86_64 glib2-2.56.4-159.el8.x86_64 rpm-4.14.3-24.el8_7.x86_64 libssh-config-0.9.6-3.el8.noarch pcre-8.42-6.el8.x86_64 isl-0.16.1-6.el8.x86_64 ansible-srpm-macros-1-8.1.el8.noarch redhat-release-8.7-0.3.el8.x86_64 lua-srpm-macros-1-3.el8.noarch efi-srpm-macros-3-3.el8.noarch popt-1.18-1.el8.x86_64 sqlite-libs-3.26.0-17.el8_7.x86_64 Start: buildsrpm Start: rpmbuild -bs Building target platforms: x86_64 Building for target x86_64 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-1.el8.src.rpm Finish: rpmbuild -bs cp: ‘var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root/var/log’: No such file or directory INFO: chroot_scan: 3 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root/var/log/dnf.rpm.log /var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root/var/log/dnf.librepo.log /var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root/var/log/dnf.log Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-0i2rsjr3/bowtie/bowtie.spec) Config(child) 1 minutes 33 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running (timeout=18000): unbuffer mock --rebuild /var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.el8.src.rpm --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1674075945.719916 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 3.5 starting (python version = 3.11.0, NVR = mock-3.5-1.fc37)... Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.el8.src.rpm) Config(rhel+epel-8-x86_64) Start: clean chroot Finish: clean chroot Start: chroot init INFO: mounting tmpfs at /var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin Mock Version: 3.5 INFO: Mock Version: 3.5 Start: dnf update No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 44 kB/s | 3.6 kB 00:00 Red Hat Enterprise Linux - BaseOS 17 kB/s | 4.1 kB 00:00 Red Hat Enterprise Linux - AppStream 18 kB/s | 4.5 kB 00:00 Red Hat Enterprise Linux - CodeReady Linux Buil 19 kB/s | 4.5 kB 00:00 Extra Packages for Enterprise Linux 8 - x86_64 542 kB/s | 28 kB 00:00 Dependencies resolved. Nothing to do. Complete! Finish: dnf update Finish: chroot init Start: build phase for bowtie-1.3.1-1.el8.src.rpm Start: build setup for bowtie-1.3.1-1.el8.src.rpm Building target platforms: x86_64 Building for target x86_64 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-1.el8.src.rpm No matches found for the following disable plugin patterns: local, spacewalk, versionlock Updating Subscription Management repositories. Unable to read consumer identity This system is not registered with an entitlement server. You can use subscription-manager to register. Copr repository 61 kB/s | 3.6 kB 00:00 Red Hat Enterprise Linux - BaseOS 18 kB/s | 4.1 kB 00:00 Red Hat Enterprise Linux - AppStream 19 kB/s | 4.5 kB 00:00 Red Hat Enterprise Linux - CodeReady Linux Buil 17 kB/s | 4.5 kB 00:00 Extra Packages for Enterprise Linux 8 - x86_64 445 kB/s | 28 kB 00:00 Package gcc-c++-8.5.0-16.el8_7.x86_64 is already installed. Package make-1:4.2.1-11.el8.x86_64 is already installed. Dependencies resolved. ================================================================================================= Package Arch Version Repository Size ================================================================================================= Installing: hostname x86_64 3.20-6.el8 rhel-baseos 32 k perl-Clone x86_64 0.39-5.el8 codeready-builder 25 k perl-Data-Dumper x86_64 2.167-399.el8 rhel-baseos 58 k perl-Getopt-Long noarch 1:2.50-4.el8 rhel-baseos 63 k perl-Test-Deep noarch 1.127-4.el8 codeready-builder 69 k perl-interpreter x86_64 4:5.26.3-421.el8 rhel-baseos 6.3 M python36 x86_64 3.6.8-38.module+el8.5.0+12207+5c5719bc rhel-appstream 19 k tbb-devel x86_64 2018.2-9.el8 rhel-appstream 324 k zlib-devel x86_64 1.2.11-21.el8_7 rhel-baseos 58 k Installing dependencies: groff-base x86_64 1.22.3-18.el8 rhel-baseos 1.0 M perl-Carp noarch 1.42-396.el8 rhel-baseos 30 k perl-Encode x86_64 4:2.97-3.el8 rhel-baseos 1.5 M perl-Errno x86_64 1.28-421.el8 rhel-baseos 76 k perl-Exporter noarch 5.72-396.el8 rhel-baseos 34 k perl-File-Path noarch 2.15-2.el8 rhel-baseos 38 k perl-File-Temp noarch 0.230.600-1.el8 rhel-baseos 63 k perl-HTTP-Tiny noarch 0.074-1.el8 rhel-baseos 58 k perl-IO x86_64 1.38-421.el8 rhel-baseos 142 k perl-MIME-Base64 x86_64 3.15-396.el8 rhel-baseos 31 k perl-PathTools x86_64 3.74-1.el8 rhel-baseos 90 k perl-Pod-Escapes noarch 1:1.07-395.el8 rhel-baseos 20 k perl-Pod-Perldoc noarch 3.28-396.el8 rhel-baseos 88 k perl-Pod-Simple noarch 1:3.35-395.el8 rhel-baseos 213 k perl-Pod-Usage noarch 4:1.69-395.el8 rhel-baseos 34 k perl-Scalar-List-Utils x86_64 3:1.49-2.el8 rhel-baseos 68 k perl-Socket x86_64 4:2.027-3.el8 rhel-baseos 59 k perl-Storable x86_64 1:3.11-3.el8 rhel-baseos 98 k perl-Term-ANSIColor noarch 4.06-396.el8 rhel-baseos 46 k perl-Term-Cap noarch 1.17-395.el8 rhel-baseos 23 k perl-Test-Simple noarch 1:1.302135-1.el8 rhel-appstream 516 k perl-Text-ParseWords noarch 3.30-395.el8 rhel-baseos 18 k perl-Text-Tabs+Wrap noarch 2013.0523-395.el8 rhel-baseos 24 k perl-Time-Local noarch 1:1.280-1.el8 rhel-baseos 34 k perl-Unicode-Normalize x86_64 1.25-396.el8 rhel-baseos 82 k perl-constant noarch 1.33-396.el8 rhel-baseos 25 k perl-libs x86_64 4:5.26.3-421.el8 rhel-baseos 1.6 M perl-macros x86_64 4:5.26.3-421.el8 rhel-baseos 72 k perl-parent noarch 1:0.237-1.el8 rhel-baseos 20 k perl-podlators noarch 4.11-1.el8 rhel-baseos 118 k perl-threads x86_64 1:2.21-2.el8 rhel-baseos 61 k perl-threads-shared x86_64 1.58-2.el8 rhel-baseos 48 k platform-python-pip noarch 9.0.3-22.el8 rhel-baseos 1.6 M python3-pip noarch 9.0.3-22.el8 rhel-appstream 20 k python3-setuptools noarch 39.2.0-6.el8 rhel-baseos 163 k tbb x86_64 2018.2-9.el8 rhel-appstream 160 k Enabling module streams: python36 3.6 Transaction Summary ================================================================================================= Install 45 Packages Total download size: 15 M Installed size: 48 M Downloading Packages: (1/45): perl-Data-Dumper-2.167-399.el8.x86_64.r 192 kB/s | 58 kB 00:00 (2/45): perl-Scalar-List-Utils-1.49-2.el8.x86_6 217 kB/s | 68 kB 00:00 (3/45): perl-PathTools-3.74-1.el8.x86_64.rpm 269 kB/s | 90 kB 00:00 (4/45): perl-threads-shared-1.58-2.el8.x86_64.r 363 kB/s | 48 kB 00:00 (5/45): perl-Unicode-Normalize-1.25-396.el8.x86 536 kB/s | 82 kB 00:00 (6/45): groff-base-1.22.3-18.el8.x86_64.rpm 3.7 MB/s | 1.0 MB 00:00 (7/45): perl-Encode-2.97-3.el8.x86_64.rpm 4.8 MB/s | 1.5 MB 00:00 (8/45): perl-MIME-Base64-3.15-396.el8.x86_64.rp 295 kB/s | 31 kB 00:00 (9/45): hostname-3.20-6.el8.x86_64.rpm 254 kB/s | 32 kB 00:00 (10/45): perl-threads-2.21-2.el8.x86_64.rpm 560 kB/s | 61 kB 00:00 (11/45): perl-Term-ANSIColor-4.06-396.el8.noarc 415 kB/s | 46 kB 00:00 (12/45): perl-Pod-Simple-3.35-395.el8.noarch.rp 1.6 MB/s | 213 kB 00:00 (13/45): perl-HTTP-Tiny-0.074-1.el8.noarch.rpm 521 kB/s | 58 kB 00:00 (14/45): perl-Pod-Escapes-1.07-395.el8.noarch.r 186 kB/s | 20 kB 00:00 (15/45): perl-File-Path-2.15-2.el8.noarch.rpm 369 kB/s | 38 kB 00:00 (16/45): perl-Pod-Perldoc-3.28-396.el8.noarch.r 800 kB/s | 88 kB 00:00 (17/45): perl-parent-0.237-1.el8.noarch.rpm 205 kB/s | 20 kB 00:00 (18/45): perl-Text-Tabs+Wrap-2013.0523-395.el8. 216 kB/s | 24 kB 00:00 (19/45): perl-Getopt-Long-2.50-4.el8.noarch.rpm 332 kB/s | 63 kB 00:00 (20/45): perl-podlators-4.11-1.el8.noarch.rpm 990 kB/s | 118 kB 00:00 (21/45): perl-Time-Local-1.280-1.el8.noarch.rpm 324 kB/s | 34 kB 00:00 (22/45): perl-Carp-1.42-396.el8.noarch.rpm 281 kB/s | 30 kB 00:00 (23/45): perl-Exporter-5.72-396.el8.noarch.rpm 342 kB/s | 34 kB 00:00 (24/45): perl-Storable-3.11-3.el8.x86_64.rpm 897 kB/s | 98 kB 00:00 (25/45): perl-Text-ParseWords-3.30-395.el8.noar 189 kB/s | 18 kB 00:00 (26/45): perl-File-Temp-0.230.600-1.el8.noarch. 536 kB/s | 63 kB 00:00 (27/45): perl-constant-1.33-396.el8.noarch.rpm 255 kB/s | 25 kB 00:00 (28/45): perl-Term-Cap-1.17-395.el8.noarch.rpm 230 kB/s | 23 kB 00:00 (29/45): perl-Socket-2.027-3.el8.x86_64.rpm 609 kB/s | 59 kB 00:00 (30/45): perl-Pod-Usage-1.69-395.el8.noarch.rpm 315 kB/s | 34 kB 00:00 (31/45): python3-setuptools-39.2.0-6.el8.noarch 1.2 MB/s | 163 kB 00:00 (32/45): platform-python-pip-9.0.3-22.el8.noarc 9.4 MB/s | 1.6 MB 00:00 (33/45): perl-IO-1.38-421.el8.x86_64.rpm 1.1 MB/s | 142 kB 00:00 (34/45): perl-libs-5.26.3-421.el8.x86_64.rpm 5.3 MB/s | 1.6 MB 00:00 (35/45): perl-macros-5.26.3-421.el8.x86_64.rpm 623 kB/s | 72 kB 00:00 (36/45): perl-interpreter-5.26.3-421.el8.x86_64 26 MB/s | 6.3 MB 00:00 (37/45): perl-Errno-1.28-421.el8.x86_64.rpm 666 kB/s | 76 kB 00:00 (38/45): zlib-devel-1.2.11-21.el8_7.x86_64.rpm 604 kB/s | 58 kB 00:00 (39/45): tbb-devel-2018.2-9.el8.x86_64.rpm 2.6 MB/s | 324 kB 00:00 (40/45): python36-3.6.8-38.module+el8.5.0+12207 166 kB/s | 19 kB 00:00 (41/45): tbb-2018.2-9.el8.x86_64.rpm 577 kB/s | 160 kB 00:00 (42/45): perl-Test-Simple-1.302135-1.el8.noarch 1.6 MB/s | 516 kB 00:00 (43/45): python3-pip-9.0.3-22.el8.noarch.rpm 215 kB/s | 20 kB 00:00 (44/45): perl-Clone-0.39-5.el8.x86_64.rpm 257 kB/s | 25 kB 00:00 (45/45): perl-Test-Deep-1.127-4.el8.noarch.rpm 685 kB/s | 69 kB 00:00 -------------------------------------------------------------------------------- Total 6.5 MB/s | 15 MB 00:02 Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Preparing : 1/1 Installing : tbb-2018.2-9.el8.x86_64 1/45 Running scriptlet: tbb-2018.2-9.el8.x86_64 1/45 Installing : platform-python-pip-9.0.3-22.el8.noarch 2/45 Installing : python3-setuptools-39.2.0-6.el8.noarch 3/45 Installing : python3-pip-9.0.3-22.el8.noarch 4/45 Installing : python36-3.6.8-38.module+el8.5.0+12207+5c5719bc.x8 5/45 Running scriptlet: python36-3.6.8-38.module+el8.5.0+12207+5c5719bc.x8 5/45 Installing : groff-base-1.22.3-18.el8.x86_64 6/45 Installing : perl-Pod-Escapes-1:1.07-395.el8.noarch 7/45 Installing : perl-Time-Local-1:1.280-1.el8.noarch 8/45 Installing : perl-Term-ANSIColor-4.06-396.el8.noarch 9/45 Installing : perl-Term-Cap-1.17-395.el8.noarch 10/45 Installing : perl-HTTP-Tiny-0.074-1.el8.noarch 11/45 Installing : perl-Pod-Simple-1:3.35-395.el8.noarch 12/45 Installing : perl-File-Temp-0.230.600-1.el8.noarch 13/45 Installing : perl-podlators-4.11-1.el8.noarch 14/45 Installing : perl-Pod-Perldoc-3.28-396.el8.noarch 15/45 Installing : perl-Text-ParseWords-3.30-395.el8.noarch 16/45 Installing : perl-Pod-Usage-4:1.69-395.el8.noarch 17/45 Installing : perl-MIME-Base64-3.15-396.el8.x86_64 18/45 Installing : perl-Storable-1:3.11-3.el8.x86_64 19/45 Installing : perl-Getopt-Long-1:2.50-4.el8.noarch 20/45 Installing : perl-Socket-4:2.027-3.el8.x86_64 21/45 Installing : perl-Encode-4:2.97-3.el8.x86_64 22/45 Installing : perl-Errno-1.28-421.el8.x86_64 23/45 Installing : perl-parent-1:0.237-1.el8.noarch 24/45 Installing : perl-Text-Tabs+Wrap-2013.0523-395.el8.noarch 25/45 Installing : perl-Unicode-Normalize-1.25-396.el8.x86_64 26/45 Installing : perl-threads-shared-1.58-2.el8.x86_64 27/45 Installing : perl-threads-1:2.21-2.el8.x86_64 28/45 Installing : perl-Carp-1.42-396.el8.noarch 29/45 Installing : perl-Exporter-5.72-396.el8.noarch 30/45 Installing : perl-libs-4:5.26.3-421.el8.x86_64 31/45 Installing : perl-Scalar-List-Utils-3:1.49-2.el8.x86_64 32/45 Installing : perl-macros-4:5.26.3-421.el8.x86_64 33/45 Installing : perl-File-Path-2.15-2.el8.noarch 34/45 Installing : perl-PathTools-3.74-1.el8.x86_64 35/45 Installing : perl-constant-1.33-396.el8.noarch 36/45 Installing : perl-IO-1.38-421.el8.x86_64 37/45 Installing : perl-interpreter-4:5.26.3-421.el8.x86_64 38/45 Installing : perl-Data-Dumper-2.167-399.el8.x86_64 39/45 Installing : perl-Test-Simple-1:1.302135-1.el8.noarch 40/45 Installing : perl-Test-Deep-1.127-4.el8.noarch 41/45 Installing : perl-Clone-0.39-5.el8.x86_64 42/45 Installing : tbb-devel-2018.2-9.el8.x86_64 43/45 Installing : zlib-devel-1.2.11-21.el8_7.x86_64 44/45 Installing : hostname-3.20-6.el8.x86_64 45/45 Running scriptlet: hostname-3.20-6.el8.x86_64 45/45 Verifying : perl-Scalar-List-Utils-3:1.49-2.el8.x86_64 1/45 Verifying : perl-PathTools-3.74-1.el8.x86_64 2/45 Verifying : perl-Data-Dumper-2.167-399.el8.x86_64 3/45 Verifying : perl-threads-shared-1.58-2.el8.x86_64 4/45 Verifying : perl-Encode-4:2.97-3.el8.x86_64 5/45 Verifying : groff-base-1.22.3-18.el8.x86_64 6/45 Verifying : perl-Unicode-Normalize-1.25-396.el8.x86_64 7/45 Verifying : hostname-3.20-6.el8.x86_64 8/45 Verifying : perl-MIME-Base64-3.15-396.el8.x86_64 9/45 Verifying : perl-threads-1:2.21-2.el8.x86_64 10/45 Verifying : perl-Pod-Simple-1:3.35-395.el8.noarch 11/45 Verifying : perl-Term-ANSIColor-4.06-396.el8.noarch 12/45 Verifying : perl-HTTP-Tiny-0.074-1.el8.noarch 13/45 Verifying : perl-Pod-Escapes-1:1.07-395.el8.noarch 14/45 Verifying : perl-Pod-Perldoc-3.28-396.el8.noarch 15/45 Verifying : perl-File-Path-2.15-2.el8.noarch 16/45 Verifying : perl-parent-1:0.237-1.el8.noarch 17/45 Verifying : perl-Text-Tabs+Wrap-2013.0523-395.el8.noarch 18/45 Verifying : perl-Getopt-Long-1:2.50-4.el8.noarch 19/45 Verifying : perl-podlators-4.11-1.el8.noarch 20/45 Verifying : perl-Time-Local-1:1.280-1.el8.noarch 21/45 Verifying : perl-Carp-1.42-396.el8.noarch 22/45 Verifying : perl-Exporter-5.72-396.el8.noarch 23/45 Verifying : perl-Storable-1:3.11-3.el8.x86_64 24/45 Verifying : perl-Text-ParseWords-3.30-395.el8.noarch 25/45 Verifying : perl-File-Temp-0.230.600-1.el8.noarch 26/45 Verifying : perl-constant-1.33-396.el8.noarch 27/45 Verifying : perl-Term-Cap-1.17-395.el8.noarch 28/45 Verifying : perl-Pod-Usage-4:1.69-395.el8.noarch 29/45 Verifying : perl-Socket-4:2.027-3.el8.x86_64 30/45 Verifying : python3-setuptools-39.2.0-6.el8.noarch 31/45 Verifying : platform-python-pip-9.0.3-22.el8.noarch 32/45 Verifying : perl-libs-4:5.26.3-421.el8.x86_64 33/45 Verifying : perl-IO-1.38-421.el8.x86_64 34/45 Verifying : perl-interpreter-4:5.26.3-421.el8.x86_64 35/45 Verifying : perl-macros-4:5.26.3-421.el8.x86_64 36/45 Verifying : perl-Errno-1.28-421.el8.x86_64 37/45 Verifying : zlib-devel-1.2.11-21.el8_7.x86_64 38/45 Verifying : perl-Test-Simple-1:1.302135-1.el8.noarch 39/45 Verifying : tbb-devel-2018.2-9.el8.x86_64 40/45 Verifying : tbb-2018.2-9.el8.x86_64 41/45 Verifying : python36-3.6.8-38.module+el8.5.0+12207+5c5719bc.x8 42/45 Verifying : python3-pip-9.0.3-22.el8.noarch 43/45 Verifying : perl-Clone-0.39-5.el8.x86_64 44/45 Verifying : perl-Test-Deep-1.127-4.el8.noarch 45/45 Installed products updated. Installed: groff-base-1.22.3-18.el8.x86_64 hostname-3.20-6.el8.x86_64 perl-Carp-1.42-396.el8.noarch perl-Clone-0.39-5.el8.x86_64 perl-Data-Dumper-2.167-399.el8.x86_64 perl-Encode-4:2.97-3.el8.x86_64 perl-Errno-1.28-421.el8.x86_64 perl-Exporter-5.72-396.el8.noarch perl-File-Path-2.15-2.el8.noarch perl-File-Temp-0.230.600-1.el8.noarch perl-Getopt-Long-1:2.50-4.el8.noarch perl-HTTP-Tiny-0.074-1.el8.noarch perl-IO-1.38-421.el8.x86_64 perl-MIME-Base64-3.15-396.el8.x86_64 perl-PathTools-3.74-1.el8.x86_64 perl-Pod-Escapes-1:1.07-395.el8.noarch perl-Pod-Perldoc-3.28-396.el8.noarch perl-Pod-Simple-1:3.35-395.el8.noarch perl-Pod-Usage-4:1.69-395.el8.noarch perl-Scalar-List-Utils-3:1.49-2.el8.x86_64 perl-Socket-4:2.027-3.el8.x86_64 perl-Storable-1:3.11-3.el8.x86_64 perl-Term-ANSIColor-4.06-396.el8.noarch perl-Term-Cap-1.17-395.el8.noarch perl-Test-Deep-1.127-4.el8.noarch perl-Test-Simple-1:1.302135-1.el8.noarch perl-Text-ParseWords-3.30-395.el8.noarch perl-Text-Tabs+Wrap-2013.0523-395.el8.noarch perl-Time-Local-1:1.280-1.el8.noarch perl-Unicode-Normalize-1.25-396.el8.x86_64 perl-constant-1.33-396.el8.noarch perl-interpreter-4:5.26.3-421.el8.x86_64 perl-libs-4:5.26.3-421.el8.x86_64 perl-macros-4:5.26.3-421.el8.x86_64 perl-parent-1:0.237-1.el8.noarch perl-podlators-4.11-1.el8.noarch perl-threads-1:2.21-2.el8.x86_64 perl-threads-shared-1.58-2.el8.x86_64 platform-python-pip-9.0.3-22.el8.noarch python3-pip-9.0.3-22.el8.noarch python3-setuptools-39.2.0-6.el8.noarch python36-3.6.8-38.module+el8.5.0+12207+5c5719bc.x86_64 tbb-2018.2-9.el8.x86_64 tbb-devel-2018.2-9.el8.x86_64 zlib-devel-1.2.11-21.el8_7.x86_64 Complete! Finish: build setup for bowtie-1.3.1-1.el8.src.rpm Start: rpmbuild bowtie-1.3.1-1.el8.src.rpm Building target platforms: x86_64 Building for target x86_64 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.8Yf8xW + umask 022 + cd /builddir/build/BUILD + cd /builddir/build/BUILD + rm -rf bowtie-1.3.1-src + /usr/bin/unzip -qq /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3.6|' bowtie-inspect + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.ZFMv4b + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + /usr/bin/make -O -j2 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:38\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:38\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:38\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:49\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:07:49\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:09\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:10\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:18\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:19\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:24\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:25\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"`hostname`\"" -DBUILD_TIME="\"2023-01-18T21:08:37\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -lz -lpthread + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.ms9kTL + umask 022 + cd /builddir/build/BUILD + '[' /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 '!=' / ']' + rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 ++ dirname /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 + mkdir -p /builddir/build/BUILDROOT + mkdir /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin ; \ done + mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie + cp -a reads /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64//usr/bin/ + /usr/lib/rpm/find-debuginfo.sh -j2 --strict-build-id -m -i --build-id-seed 1.3.1-1.el8 --unique-debug-suffix -1.3.1-1.el8.x86_64 --unique-debug-src-base bowtie-1.3.1-1.el8.x86_64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 110000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-src extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-align-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-align-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-align-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-align-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-build-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-build-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-build-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-build-s-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-inspect-l extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-inspect-l-debug extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-inspect-s extracting debug info from /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/bin/bowtie-inspect-s-debug /usr/lib/rpm/sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. 2935 blocks + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig /sbin/ldconfig: Warning: ignoring configuration file that cannot be opened: /etc/ld.so.conf: No such file or directory + /usr/lib/rpm/brp-compress + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/brp-python-bytecompile '' 1 + /usr/lib/rpm/brp-python-hardlink + PYTHON3=/usr/bin/python3.6 + /usr/lib/rpm/redhat/brp-mangle-shebangs Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.RVmQvV + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + grep 'version 1.3.1' + ./bowtie --version /builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + grep 'version 1.3.1' + ./bowtie-build --version bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + grep 'version 1.3.1' + ./bowtie-inspect --version bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/DNA.pm scripts/test/all.sh scripts/test/args.pl scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/btdata.py scripts/test/btface.py scripts/test/build_big.py scripts/test/cs_dec.pl scripts/test/cs_trim.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/large_idx.py scripts/test/long_read.pl scripts/test/random_bowtie_tests.pl scripts/test/random_bowtie_tests.sh scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl Hunk #2 succeeded at 993 (offset -135 lines). + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" 1 # reads with at least one alignment: 1 (seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads with at least one alignment: r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads with at least one alignment: r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 # reads with at least one alignment: 0 (0.00%) r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: @HD VN:1.0 SO:unsorted 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" %) # reads that failed to align: 1 (100.00%) No alignments r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads with at least one alignment: 1 (100.00%) r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 3 @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 3 (100.00%) seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 @SQ SN:0 LN:19 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 2 @SQ SN:0 LN:19 # reads with at least one alignment: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 2 (100.00%) # reads that failed to align: 0 (r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 0 (0.00r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 %) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 0.00%) Reported 2 alignments r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1@HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (100.00%) @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads that failed to align: r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 0 (0.00%) r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 @HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (@SQ SN:0 LN:16 100.00%) @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads that failed to align: 0 (0.00%) Reported 2 alignments r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1@HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%)@SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Reported 2 alignments r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1@HD VN:1.0 SO:unsorted # reads with at least one alignment: 1 (100.00%) @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%)@SQ SN:0 LN:19 # reads that failed to align: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" 0seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 1 # reads with at least one alignment: 1 (100.00%)0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%)r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00@SQ SN:0 LN:25 %) @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%)@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 # reads processed: @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported @SQ SN:0 LN:8 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: @SQ SN:0 LN:19 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (@SQ SN:0 LN:25 100.00@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" %) # reads that failed to align: 0r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 (0.00%) Reported 1 paired-end alignmentsr0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 1 (100.00@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" %) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 (100.00%) # reads that failed to align: r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 %) Reported 1 paired-end alignmentsr0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 1@PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads with at least one alignment: 1 (100.00%) r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads that failed to align: 0 (0.00%)r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 %) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%)r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 %) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 (100.00%) # reads that failed to align: 0 (0.00%) r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted 1@SQ SN:0 LN:8 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments PASSED + exit 0 Processing files: bowtie-1.3.1-1.el8.x86_64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.Fl1nvy + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + export LC_ALL=C + LC_ALL=C + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr MANUAL /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr NEWS /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr VERSION /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr AUTHORS /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr TUTORIAL /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + cp -pr doc/manual.html doc/style.css /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/doc/bowtie + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.FhEcbm + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/licenses/bowtie + export LC_ALL=C + LC_ALL=C + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/licenses/bowtie + cp -pr LICENSE /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64/usr/share/licenses/bowtie + exit 0 Provides: bowtie = 1.3.1-1.el8 bowtie(x86-64) = 1.3.1-1.el8 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /bin/bash /bin/sh /usr/bin/perl /usr/bin/python3.6 libc.so.6()(64bit) libc.so.6(GLIBC_2.14)(64bit) libc.so.6(GLIBC_2.2.5)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.2.5)(64bit) libm.so.6(GLIBC_2.27)(64bit) libpthread.so.0()(64bit) libpthread.so.0(GLIBC_2.2.5)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-1.el8.x86_64 Provides: bowtie-debugsource = 1.3.1-1.el8 bowtie-debugsource(x86-64) = 1.3.1-1.el8 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-1.el8.x86_64 Provides: bowtie-debuginfo = 1.3.1-1.el8 bowtie-debuginfo(x86-64) = 1.3.1-1.el8 debuginfo(build-id) = 29ec8794fbc6084b20154c1cd14286fa460f9024 debuginfo(build-id) = 38505a2d22aaa723c57e30f3b488e1e893e87970 debuginfo(build-id) = 3abdadcb4a0812d713e0333749b56a36527b032f debuginfo(build-id) = 3d2240524b8dd44a3e9e0dea95735543f1cd2cf1 debuginfo(build-id) = 5bdbd6362e10265ca85a4830c4ea060156139846 debuginfo(build-id) = b0dee9c26087d68579964020c10d1fccbbded556 debuginfo(build-id) = b678af541e9d9833996f09ddf5e21bdc53e0dcc5 debuginfo(build-id) = e6ebcb1bf9cfff96cc06189ba4cecdc3f493b001 debuginfo(build-id) = e8249b603e581e2c9d2f5a7c8f320a44edb2f535 debuginfo(build-id) = f4a47dfc0cdf12ed1ff4a446aacc452b6e007bcd debuginfo(build-id) = f6c7f56c5bc7bf0f6415ca19dd1ff55868f0ef8e debuginfo(build-id) = fdb6278648b93ef7f1425e342e3f7d9c1fbcdc18 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(x86-64) = 1.3.1-1.el8 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 Wrote: /builddir/build/RPMS/bowtie-1.3.1-1.el8.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-1.el8.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-1.el8.x86_64.rpm Executing(%clean): /bin/sh -e /var/tmp/rpm-tmp.yV44zP + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + /usr/bin/rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-1.el8.x86_64 + exit 0 Finish: rpmbuild bowtie-1.3.1-1.el8.src.rpm Finish: build phase for bowtie-1.3.1-1.el8.src.rpm INFO: chroot_scan: 3 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root/var/log/dnf.rpm.log /var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root/var/log/dnf.librepo.log /var/lib/mock/rhel+epel-8-x86_64-1674075945.719916/root/var/log/dnf.log INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-1.el8.src.rpm) Config(child) 2 minutes 2 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool