Warning: Permanently added '2620:52:6:1161:dead:beef:cafe:c152' (ED25519) to the list of known hosts. You can reproduce this build on your computer by running: sudo dnf install copr-rpmbuild /usr/bin/copr-rpmbuild --verbose --drop-resultdir --task-url https://copr.fedorainfracloud.org/backend/get-build-task/9942909-fedora-rawhide-ppc64le --chroot fedora-rawhide-ppc64le Version: 1.6 PID: 12735 Logging PID: 12737 Task: {'allow_user_ssh': False, 'appstream': False, 'background': True, 'build_id': 9942909, 'buildroot_pkgs': [], 'chroot': 'fedora-rawhide-ppc64le', 'enable_net': False, 'fedora_review': False, 'git_hash': 'bb30ca8b07fd437a5eccbde201db2ee5f9e02c0e', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/siddhesh/mbp-gcc-16/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-8', 'project_dirname': 'mbp-gcc-16', 'project_name': 'mbp-gcc-16', 'project_owner': 'siddhesh', 'repo_priority': None, 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/siddhesh/mbp-gcc-16/fedora-rawhide-ppc64le/', 'id': 'copr_base', 'name': 'Copr repository', 'priority': None}, {'baseurl': 'https://kojipkgs.fedoraproject.org/repos/f44-build-side-124978/latest/$basearch/', 'id': 'https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch', 'name': 'Additional repo https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch'}], 'sandbox': 'siddhesh/mbp-gcc-16--siddhesh', 'source_json': {}, 'source_type': None, 'ssh_public_keys': None, 'storage': 0, 'submitter': 'siddhesh', 'tags': [], 'task_id': '9942909-fedora-rawhide-ppc64le', 'timeout': 115200, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/siddhesh/mbp-gcc-16/bowtie /var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/siddhesh/mbp-gcc-16/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie'... Running: git checkout bb30ca8b07fd437a5eccbde201db2ee5f9e02c0e -- cmd: ['git', 'checkout', 'bb30ca8b07fd437a5eccbde201db2ee5f9e02c0e', '--'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie rc: 0 stdout: stderr: Note: switching to 'bb30ca8b07fd437a5eccbde201db2ee5f9e02c0e'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at bb30ca8 automatic import of bowtie Running: dist-git-client sources cmd: ['dist-git-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip INFO: Reading stdout from command: curl --help all INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/siddhesh/mbp-gcc-16/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 7293k 100 7293k 0 0 7435k 0 --:--:-- --:--:-- --:--:-- 7435k INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz tail: /var/lib/copr-rpmbuild/main.log: file truncated % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 34134 100 34134 0 0 404k 0 --:--:-- --:--:-- --:--:-- 406k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz Running (timeout=115200): unbuffer mock --spec /var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1766674341.303132 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 6.6 starting (python version = 3.13.7, NVR = mock-6.6-1.fc42), args: /usr/libexec/mock/mock --spec /var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1766674341.303132 -r /var/lib/copr-rpmbuild/results/configs/child.cfg Start(bootstrap): init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish(bootstrap): init plugins Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie/bowtie.spec) Config(fedora-rawhide-ppc64le) Start: clean chroot Finish: clean chroot Mock Version: 6.6 INFO: Mock Version: 6.6 Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-bootstrap-1766674341.303132/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata INFO: Guessed host environment type: unknown INFO: Using container image: registry.fedoraproject.org/fedora:rawhide INFO: Pulling image: registry.fedoraproject.org/fedora:rawhide INFO: Tagging container image as mock-bootstrap-2866aaa6-23c7-4fd9-8ead-f19019fbd628 INFO: Checking that 2a11093149de2150ffaaa8d82e22bb8bb41aa1aa16b3693f0f97e4921acde31b image matches host's architecture INFO: Copy content of container 2a11093149de2150ffaaa8d82e22bb8bb41aa1aa16b3693f0f97e4921acde31b to /var/lib/mock/fedora-rawhide-ppc64le-bootstrap-1766674341.303132/root INFO: mounting 2a11093149de2150ffaaa8d82e22bb8bb41aa1aa16b3693f0f97e4921acde31b with podman image mount INFO: image 2a11093149de2150ffaaa8d82e22bb8bb41aa1aa16b3693f0f97e4921acde31b as /var/lib/containers/storage/overlay/5698018051af4b12832f6465fd120ad4dadc1710c2d5059c663b82048d864076/merged INFO: umounting image 2a11093149de2150ffaaa8d82e22bb8bb41aa1aa16b3693f0f97e4921acde31b (/var/lib/containers/storage/overlay/5698018051af4b12832f6465fd120ad4dadc1710c2d5059c663b82048d864076/merged) with podman image umount INFO: Removing image mock-bootstrap-2866aaa6-23c7-4fd9-8ead-f19019fbd628 INFO: Package manager dnf5 detected and used (fallback) INFO: Not updating bootstrap chroot, bootstrap_image_ready=True Start(bootstrap): creating root cache Finish(bootstrap): creating root cache Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-1766674341.303132/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Package manager dnf5 detected and used (direct choice) INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-6.0.1-1.fc44.ppc64le rpm-sequoia-1.10.0-1.fc44.ppc64le dnf5-5.3.0.0-3.fc44.ppc64le dnf5-plugins-5.3.0.0-3.fc44.ppc64le Start: installing minimal buildroot with dnf5 Updating and loading repositories: Additional repo https_kojipkgs_fedorap 100% | 12.3 KiB/s | 3.5 KiB | 00m00s Copr repository 100% | 5.4 KiB/s | 1.5 KiB | 00m00s fedora 100% | 14.5 KiB/s | 4.7 KiB | 00m00s Repositories loaded. Package Arch Version Repository Size Installing group/module packages: bash ppc64le 0:5.3.0-2.fc44 copr_base 8.9 MiB bzip2 ppc64le 0:1.0.8-21.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 171.2 KiB coreutils ppc64le 0:9.9-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 9.3 MiB cpio ppc64le 0:2.15-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB diffutils ppc64le 0:3.12-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.7 MiB fedora-release-common noarch 0:44-0.10 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 20.6 KiB findutils ppc64le 1:4.10.0-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.0 MiB gawk ppc64le 0:5.3.2-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.8 MiB glibc-minimal-langpack ppc64le 0:2.42.9000-17.fc44 fedora 0.0 B grep ppc64le 0:3.12-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.0 MiB gzip ppc64le 0:1.14-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 437.6 KiB info ppc64le 0:7.2-7.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 485.4 KiB patch ppc64le 0:2.8-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 262.4 KiB redhat-rpm-config noarch 0:343-19.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 183.6 KiB rpm-build ppc64le 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 663.4 KiB sed ppc64le 0:4.9-6.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 937.1 KiB shadow-utils ppc64le 2:4.18.0-7.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.8 MiB tar ppc64le 2:1.35-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.1 MiB unzip ppc64le 0:6.0-68.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 533.9 KiB util-linux ppc64le 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.9 MiB which ppc64le 0:2.23-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 123.3 KiB xz ppc64le 1:5.8.1-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.4 MiB Installing dependencies: R-srpm-macros noarch 0:1.3.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.2 KiB add-determinism ppc64le 0:0.7.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.4 MiB alternatives ppc64le 0:1.33-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 90.1 KiB ansible-srpm-macros noarch 0:1-18.1.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 35.7 KiB audit-libs ppc64le 0:4.1.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 550.5 KiB binutils ppc64le 0:2.45.50-12.fc44 copr_base 32.8 MiB build-reproducibility-srpm-macros noarch 0:0.7.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 KiB bzip2-libs ppc64le 0:1.0.8-21.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 136.5 KiB ca-certificates noarch 0:2025.2.80_v9.0.304-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.7 MiB cmake-srpm-macros noarch 0:3.31.10-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 524.0 B coreutils-common ppc64le 0:9.9-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 11.2 MiB crypto-policies noarch 0:20251128-1.git19878fe.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 132.6 KiB curl ppc64le 0:8.18.0~rc2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 527.5 KiB cyrus-sasl-lib ppc64le 0:2.1.28-33.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.9 MiB debugedit ppc64le 0:5.2-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 381.6 KiB dwz ppc64le 0:0.16-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 386.6 KiB ed ppc64le 0:1.22.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 156.8 KiB efi-srpm-macros noarch 0:6-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 40.2 KiB elfutils ppc64le 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.4 MiB elfutils-debuginfod-client ppc64le 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 143.5 KiB elfutils-default-yama-scope noarch 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.8 KiB elfutils-libelf ppc64le 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB elfutils-libs ppc64le 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 874.6 KiB fedora-gpg-keys noarch 0:44-0.1 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 131.2 KiB fedora-release noarch 0:44-0.10 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 0.0 B fedora-release-identity-basic noarch 0:44-0.10 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 664.0 B fedora-repos noarch 0:44-0.1 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.9 KiB fedora-repos-rawhide noarch 0:44-0.1 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.2 KiB file ppc64le 0:5.46-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 140.1 KiB file-libs ppc64le 0:5.46-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 11.9 MiB filesystem ppc64le 0:3.18-50.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 112.0 B filesystem-srpm-macros noarch 0:3.18-50.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 38.2 KiB fonts-srpm-macros noarch 1:5.0.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 55.8 KiB forge-srpm-macros noarch 0:0.4.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 38.9 KiB fpc-srpm-macros noarch 0:1.3-15.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 144.0 B gap-srpm-macros noarch 0:2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.1 KiB gdb-minimal ppc64le 0:16.3-6.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 15.7 MiB gdbm-libs ppc64le 1:1.23-10.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 233.5 KiB ghc-srpm-macros noarch 0:1.9.2-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 779.0 B glibc ppc64le 0:2.42.9000-17.fc44 fedora 11.7 MiB glibc-common ppc64le 0:2.42.9000-17.fc44 fedora 1.5 MiB glibc-gconv-extra ppc64le 0:2.42.9000-17.fc44 fedora 18.5 MiB gmp ppc64le 1:6.3.0-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 786.1 KiB gnat-srpm-macros noarch 0:6-8.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.0 KiB gnulib-l10n noarch 0:20241231-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 655.0 KiB gnupg2 ppc64le 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.9 MiB gnupg2-dirmngr ppc64le 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 838.1 KiB gnupg2-gpg-agent ppc64le 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 975.0 KiB gnupg2-gpgconf ppc64le 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 321.7 KiB gnupg2-keyboxd ppc64le 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 297.2 KiB gnupg2-verify ppc64le 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 428.3 KiB gnutls ppc64le 0:3.8.11-6.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.1 MiB go-srpm-macros noarch 0:3.8.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 61.9 KiB gpgverify noarch 0:2.2-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.7 KiB ima-evm-utils-libs ppc64le 0:1.6.2-7.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 92.6 KiB jansson ppc64le 0:2.14-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 157.0 KiB java-srpm-macros noarch 0:1-7.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 870.0 B json-c ppc64le 0:0.18-7.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 138.6 KiB kernel-srpm-macros noarch 0:1.0-27.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 KiB keyutils-libs ppc64le 0:1.6.3-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 98.0 KiB krb5-libs ppc64le 0:1.21.3-10.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.0 MiB libacl ppc64le 0:2.3.2-4.fc44 copr_base 67.5 KiB libarchive ppc64le 0:3.8.4-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.3 MiB libassuan ppc64le 0:2.5.7-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 215.8 KiB libatomic ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 68.2 KiB libattr ppc64le 0:2.5.2-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 68.1 KiB libblkid ppc64le 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 354.4 KiB libbrotli ppc64le 0:1.2.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.0 MiB libcap ppc64le 0:2.77-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 507.7 KiB libcap-ng ppc64le 0:0.8.5-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 160.3 KiB libcom_err ppc64le 0:1.47.3-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 111.0 KiB libcurl ppc64le 0:8.18.0~rc2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB libeconf ppc64le 0:0.7.9-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 80.8 KiB libevent ppc64le 0:2.1.12-16.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB libfdisk ppc64le 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 482.9 KiB libffi ppc64le 0:3.5.2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 347.7 KiB libfsverity ppc64le 0:1.6-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 68.1 KiB libgcc ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 286.4 KiB libgcrypt ppc64le 0:1.11.2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.5 MiB libgomp ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 654.5 KiB libgpg-error ppc64le 0:1.58-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.0 MiB libidn2 ppc64le 0:2.3.8-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 560.2 KiB libksba ppc64le 0:1.6.7-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 526.5 KiB liblastlog2 ppc64le 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 137.2 KiB libmount ppc64le 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 548.2 KiB libnghttp2 ppc64le 0:1.68.0-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 197.9 KiB libnghttp3 ppc64le 0:1.14.0-1.fc44 fedora 206.5 KiB libpkgconf ppc64le 0:2.3.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 133.9 KiB libpsl ppc64le 0:0.21.5-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 132.1 KiB librtas ppc64le 0:2.0.6-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 305.5 KiB libselinux ppc64le 0:3.9-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 265.1 KiB libselinux-utils ppc64le 0:3.9-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.3 MiB libsemanage ppc64le 0:3.9-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 423.9 KiB libsepol ppc64le 0:3.9-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.0 MiB libsmartcols ppc64le 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 289.3 KiB libssh ppc64le 0:0.11.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 715.2 KiB libssh-config noarch 0:0.11.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 277.0 B libstdc++ ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.9 MiB libtasn1 ppc64le 0:4.20.0-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 220.0 KiB libtool-ltdl ppc64le 0:2.5.4-9.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 93.8 KiB libunistring ppc64le 0:1.1-10.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 MiB libusb1 ppc64le 0:1.0.29-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 242.8 KiB libuuid ppc64le 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 69.2 KiB libverto ppc64le 0:0.3.2-11.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 69.1 KiB libxcrypt ppc64le 0:4.5.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 337.0 KiB libxml2 ppc64le 0:2.12.10-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.3 MiB libzstd ppc64le 0:1.5.7-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.1 MiB linkdupes ppc64le 0:0.7.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 907.1 KiB lua-libs ppc64le 0:5.4.8-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 393.8 KiB lua-srpm-macros noarch 0:1-16.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.3 KiB lz4-libs ppc64le 0:1.10.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 261.1 KiB mpfr ppc64le 0:4.2.2-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 913.7 KiB ncurses-base noarch 0:6.5-8.20250614.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 328.1 KiB ncurses-libs ppc64le 0:6.5-8.20250614.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.5 MiB nettle ppc64le 0:3.10.1-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 957.8 KiB ngtcp2 ppc64le 0:1.18.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 405.2 KiB ngtcp2-crypto-ossl ppc64le 0:1.18.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 67.3 KiB npth ppc64le 0:1.8-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 93.1 KiB ocaml-srpm-macros noarch 0:11-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 KiB openblas-srpm-macros noarch 0:2-20.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 112.0 B openldap ppc64le 0:2.6.10-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 889.9 KiB openssl-libs ppc64le 1:3.5.4-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 9.0 MiB p11-kit ppc64le 0:0.25.8-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.9 MiB p11-kit-trust ppc64le 0:0.25.8-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 594.1 KiB package-notes-srpm-macros noarch 0:0.5-14.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.6 KiB pam-libs ppc64le 0:1.7.1-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 286.3 KiB pcre2 ppc64le 0:10.47-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 842.0 KiB pcre2-syntax noarch 0:10.47-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 281.9 KiB perl-srpm-macros noarch 0:1-60.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 861.0 B pkgconf ppc64le 0:2.3.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 112.3 KiB pkgconf-m4 noarch 0:2.3.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 14.4 KiB pkgconf-pkg-config ppc64le 0:2.3.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 990.0 B policycoreutils ppc64le 0:3.9-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.3 MiB popt ppc64le 0:1.19-9.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 208.7 KiB publicsuffix-list-dafsa noarch 0:20250616-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 69.1 KiB pyproject-srpm-macros noarch 0:1.18.6-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 KiB python-srpm-macros noarch 0:3.14-9.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 51.6 KiB qt5-srpm-macros noarch 0:5.15.18-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 500.0 B qt6-srpm-macros noarch 0:6.10.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 464.0 B readline ppc64le 0:8.3-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 627.5 KiB rpm ppc64le 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.2 MiB rpm-build-libs ppc64le 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 328.0 KiB rpm-libs ppc64le 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB rpm-plugin-selinux ppc64le 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 67.9 KiB rpm-sequoia ppc64le 0:1.10.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.9 MiB rpm-sign-libs ppc64le 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 67.6 KiB rust-srpm-macros noarch 0:28.4-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 5.5 KiB selinux-policy noarch 0:42.19-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 32.0 KiB selinux-policy-targeted noarch 0:42.19-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 18.7 MiB setup noarch 0:2.15.0-27.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 724.9 KiB sqlite-libs ppc64le 0:3.51.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 MiB systemd-libs ppc64le 0:259-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.0 MiB systemd-standalone-sysusers ppc64le 0:259-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 393.6 KiB tpm2-tss ppc64le 0:4.1.3-8.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.5 MiB tree-sitter-srpm-macros noarch 0:0.4.2-1.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.3 KiB util-linux-core ppc64le 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.5 MiB xxhash-libs ppc64le 0:0.8.3-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 85.6 KiB xz-libs ppc64le 1:5.8.1-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 265.3 KiB zig-srpm-macros noarch 0:1-5.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.1 KiB zip ppc64le 0:3.0-44.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 889.8 KiB zlib-ng-compat ppc64le 0:2.3.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 197.3 KiB zstd ppc64le 0:1.5.7-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 573.9 KiB Installing groups: Buildsystem building group Transaction Summary: Installing: 184 packages Total size of inbound packages is 72 MiB. Need to download 0 B. After this operation, 278 MiB extra will be used (install 278 MiB, remove 0 B). [ 1/184] tar-2:1.35-6.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 2/184] bzip2-0:1.0.8-21.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 3/184] redhat-rpm-config-0:343-19.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 4/184] rpm-build-0:6.0.1-1.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 5/184] unzip-0:6.0-68.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 6/184] cpio-0:2.15-6.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 7/184] which-0:2.23-3.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 8/184] bash-0:5.3.0-2.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 9/184] coreutils-0:9.9-1.fc44.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 10/184] grep-0:3.12-2.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 11/184] patch-0:2.8-3.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 12/184] sed-0:4.9-6.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 13/184] shadow-utils-2:4.18.0-7.fc44. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 14/184] util-linux-0:2.41.3-8.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 15/184] diffutils-0:3.12-3.fc43.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 16/184] fedora-release-common-0:44-0. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 17/184] findutils-1:4.10.0-6.fc43.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 18/184] gawk-0:5.3.2-2.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 19/184] glibc-minimal-langpack-0:2.42 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 20/184] gzip-0:1.14-1.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 21/184] info-0:7.2-7.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 22/184] xz-1:5.8.1-4.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 23/184] glibc-0:2.42.9000-17.fc44.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 24/184] glibc-common-0:2.42.9000-17.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 25/184] glibc-gconv-extra-0:2.42.9000 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 26/184] filesystem-0:3.18-50.fc43.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 27/184] ncurses-libs-0:6.5-8.20250614 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 28/184] libgcc-0:16.0.0-0.3.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 29/184] xz-libs-1:5.8.1-4.fc44.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 30/184] audit-libs-0:4.1.2-2.fc44.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 31/184] libblkid-0:2.41.3-8.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 32/184] libcap-ng-0:0.8.5-8.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 33/184] libfdisk-0:2.41.3-8.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 34/184] liblastlog2-0:2.41.3-8.fc44.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 35/184] libmount-0:2.41.3-8.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 36/184] librtas-0:2.0.6-5.fc44.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 37/184] libselinux-0:3.9-5.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 38/184] libsmartcols-0:2.41.3-8.fc44. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 39/184] libuuid-0:2.41.3-8.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 40/184] pam-libs-0:1.7.1-3.fc43.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 41/184] readline-0:8.3-2.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 42/184] systemd-libs-0:259-1.fc44.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 43/184] util-linux-core-0:2.41.3-8.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 44/184] zlib-ng-compat-0:2.3.2-2.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 45/184] bzip2-libs-0:1.0.8-21.fc43.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 46/184] libacl-0:2.3.2-4.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 47/184] libeconf-0:0.7.9-2.fc43.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 48/184] libsemanage-0:3.9-4.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 49/184] libxcrypt-0:4.5.2-2.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 50/184] setup-0:2.15.0-27.fc44.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 51/184] binutils-0:2.45.50-12.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 52/184] debugedit-0:5.2-3.fc44.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 53/184] elfutils-0:0.194-2.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 54/184] elfutils-libelf-0:0.194-2.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 55/184] file-0:5.46-8.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 56/184] libarchive-0:3.8.4-1.fc44.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 57/184] libstdc++-0:16.0.0-0.3.fc44.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 58/184] pkgconf-pkg-config-0:2.3.0-3. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 59/184] popt-0:1.19-9.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 60/184] rpm-0:6.0.1-1.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 61/184] rpm-build-libs-0:6.0.1-1.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 62/184] rpm-libs-0:6.0.1-1.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 63/184] zstd-0:1.5.7-3.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 64/184] curl-0:8.18.0~rc2-1.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 65/184] R-srpm-macros-0:1.3.0-1.fc44. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 66/184] ansible-srpm-macros-0:1-18.1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 67/184] build-reproducibility-srpm-ma 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 68/184] cmake-srpm-macros-0:3.31.10-3 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 69/184] dwz-0:0.16-2.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 70/184] efi-srpm-macros-0:6-5.fc44.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 71/184] filesystem-srpm-macros-0:3.18 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 72/184] fonts-srpm-macros-1:5.0.0-1.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 73/184] forge-srpm-macros-0:0.4.0-3.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 74/184] fpc-srpm-macros-0:1.3-15.fc43 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 75/184] gap-srpm-macros-0:2-1.fc44.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 76/184] ghc-srpm-macros-0:1.9.2-3.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 77/184] gnat-srpm-macros-0:6-8.fc43.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 78/184] go-srpm-macros-0:3.8.0-1.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 79/184] java-srpm-macros-0:1-7.fc43.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 80/184] kernel-srpm-macros-0:1.0-27.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 81/184] lua-srpm-macros-0:1-16.fc43.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 82/184] ocaml-srpm-macros-0:11-2.fc43 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 83/184] openblas-srpm-macros-0:2-20.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 84/184] package-notes-srpm-macros-0:0 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 85/184] perl-srpm-macros-0:1-60.fc43. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 86/184] pyproject-srpm-macros-0:1.18. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 87/184] python-srpm-macros-0:3.14-9.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 88/184] qt5-srpm-macros-0:5.15.18-1.f 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 89/184] qt6-srpm-macros-0:6.10.1-1.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 90/184] rust-srpm-macros-0:28.4-1.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 91/184] tree-sitter-srpm-macros-0:0.4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 92/184] zig-srpm-macros-0:1-5.fc43.no 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 93/184] zip-0:3.0-44.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 94/184] pkgconf-0:2.3.0-3.fc43.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 95/184] pkgconf-m4-0:2.3.0-3.fc43.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 96/184] libpkgconf-0:2.3.0-3.fc43.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 97/184] ed-0:1.22.3-1.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 98/184] libattr-0:2.5.2-6.fc43.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 99/184] ncurses-base-0:6.5-8.20250614 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [100/184] libatomic-0:16.0.0-0.3.fc44.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [101/184] libsepol-0:3.9-2.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [102/184] pcre2-0:10.47-1.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [103/184] sqlite-libs-0:3.51.0-1.fc44.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [104/184] libxml2-0:2.12.10-5.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [105/184] libzstd-0:1.5.7-3.fc44.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [106/184] lz4-libs-0:1.10.0-3.fc43.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [107/184] openssl-libs-1:3.5.4-1.fc44.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [108/184] gmp-1:6.3.0-4.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [109/184] mpfr-0:4.2.2-2.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [110/184] file-libs-0:5.46-8.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [111/184] fedora-repos-0:44-0.1.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [112/184] elfutils-debuginfod-client-0: 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [113/184] elfutils-libs-0:0.194-2.fc44. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [114/184] coreutils-common-0:9.9-1.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [115/184] libcap-0:2.77-1.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [116/184] add-determinism-0:0.7.2-2.fc4 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [117/184] linkdupes-0:0.7.2-2.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [118/184] alternatives-0:1.33-3.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [119/184] jansson-0:2.14-3.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [120/184] lua-libs-0:5.4.8-4.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [121/184] rpm-sequoia-0:1.10.0-1.fc44.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [122/184] libgomp-0:16.0.0-0.3.fc44.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [123/184] rpm-sign-libs-0:6.0.1-1.fc44. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [124/184] pcre2-syntax-0:10.47-1.fc44.n 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [125/184] ca-certificates-0:2025.2.80_v 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [126/184] crypto-policies-0:20251128-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [127/184] fedora-gpg-keys-0:44-0.1.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [128/184] fedora-repos-rawhide-0:44-0.1 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [129/184] elfutils-default-yama-scope-0 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [130/184] json-c-0:0.18-7.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [131/184] gnulib-l10n-0:20241231-1.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [132/184] libffi-0:3.5.2-1.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [133/184] p11-kit-0:0.25.8-1.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [134/184] p11-kit-trust-0:0.25.8-1.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [135/184] gnupg2-0:2.4.8-4.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [136/184] ima-evm-utils-libs-0:1.6.2-7. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [137/184] libfsverity-0:1.6-3.fc43.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [138/184] gpgverify-0:2.2-3.fc43.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [139/184] libtasn1-0:4.20.0-2.fc43.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [140/184] tpm2-tss-0:4.1.3-8.fc43.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [141/184] gnupg2-verify-0:2.4.8-4.fc43. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [142/184] libassuan-0:2.5.7-4.fc43.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [143/184] libgcrypt-0:1.11.2-1.fc44.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [144/184] libgpg-error-0:1.58-1.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [145/184] npth-0:1.8-3.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [146/184] gnupg2-dirmngr-0:2.4.8-4.fc43 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [147/184] gnupg2-gpg-agent-0:2.4.8-4.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [148/184] gnupg2-gpgconf-0:2.4.8-4.fc43 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [149/184] gnupg2-keyboxd-0:2.4.8-4.fc43 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [150/184] libusb1-0:1.0.29-4.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [151/184] libksba-0:1.6.7-4.fc43.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [152/184] gnutls-0:3.8.11-6.fc44.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [153/184] openldap-0:2.6.10-4.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [154/184] cyrus-sasl-lib-0:2.1.28-33.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [155/184] libevent-0:2.1.12-16.fc43.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [156/184] libtool-ltdl-0:2.5.4-9.fc44.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [157/184] libidn2-0:2.3.8-2.fc43.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [158/184] libunistring-0:1.1-10.fc43.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [159/184] nettle-0:3.10.1-2.fc43.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [160/184] gdbm-libs-1:1.23-10.fc43.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [161/184] fedora-release-0:44-0.10.noar 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [162/184] systemd-standalone-sysusers-0 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [163/184] gdb-minimal-0:16.3-6.fc44.ppc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [164/184] xxhash-libs-0:0.8.3-3.fc43.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [165/184] fedora-release-identity-basic 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [166/184] libcurl-0:8.18.0~rc2-1.fc44.p 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [167/184] selinux-policy-targeted-0:42. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [168/184] policycoreutils-0:3.9-5.fc44. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [169/184] selinux-policy-0:42.19-1.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [170/184] rpm-plugin-selinux-0:6.0.1-1. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [171/184] libselinux-utils-0:3.9-5.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [172/184] krb5-libs-0:1.21.3-10.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [173/184] libbrotli-0:1.2.0-1.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [174/184] libnghttp2-0:1.68.0-2.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [175/184] libnghttp3-0:1.14.0-1.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [176/184] libpsl-0:0.21.5-6.fc43.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [177/184] libssh-0:0.11.3-1.fc44.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [178/184] ngtcp2-0:1.18.0-1.fc44.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [179/184] ngtcp2-crypto-ossl-0:1.18.0-1 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [180/184] keyutils-libs-0:1.6.3-6.fc43. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [181/184] libcom_err-0:1.47.3-3.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [182/184] libverto-0:0.3.2-11.fc43.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [183/184] libssh-config-0:0.11.3-1.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [184/184] publicsuffix-list-dafsa-0:202 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded -------------------------------------------------------------------------------- [184/184] Total 100% | 0.0 B/s | 0.0 B | 00m00s Running transaction Importing OpenPGP key 0x6D9F90A6: UserID : "Fedora (44) " Fingerprint: 36F612DCF27F7D1A48A835E4DBFCF71C6D9F90A6 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-44-primary The key was successfully imported. Importing OpenPGP key 0x6D9F90A6: UserID : "Fedora (44) " Fingerprint: 36F612DCF27F7D1A48A835E4DBFCF71C6D9F90A6 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-44-primary The key was successfully imported. Importing OpenPGP key 0x31645531: UserID : "Fedora (43) " Fingerprint: C6E7F081CF80E13146676E88829B606631645531 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-43-primary The key was successfully imported. Importing OpenPGP key 0xF577861E: UserID : "Fedora (45) " Fingerprint: 4F50A6114CD5C6976A7F1179655A4B02F577861E From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-45-primary The key was successfully imported. [ 1/186] Verify package files 100% | 160.0 B/s | 184.0 B | 00m01s >>> Running %pretrans scriptlet: filesystem-0:3.18-50.fc43.ppc64le >>> Finished %pretrans scriptlet: filesystem-0:3.18-50.fc43.ppc64le >>> [RPM] /var/lib/mock/fedora-rawhide-ppc64le-1766674341.303132/root/var/cache/dnf/copr_base-28c6ae514b5b287e/packages/bash-5.3.0-2.fc44.ppc64le.rpm: Header OpenPGP V4 RSA/SHA256 signature, key ID 52ac7d71d4a9769d: NOKEY [ 2/186] Prepare transaction 100% | 897.0 B/s | 184.0 B | 00m00s [ 3/186] Installing libgcc-0:16.0.0-0. 100% | 70.3 MiB/s | 288.1 KiB | 00m00s [ 4/186] Installing publicsuffix-list- 100% | 68.2 MiB/s | 69.8 KiB | 00m00s [ 5/186] Installing libssh-config-0:0. 100% | 796.9 KiB/s | 816.0 B | 00m00s [ 6/186] Installing fedora-release-ide 100% | 898.4 KiB/s | 920.0 B | 00m00s [ 7/186] Installing fedora-repos-rawhi 100% | 2.4 MiB/s | 2.4 KiB | 00m00s [ 8/186] Installing fedora-gpg-keys-0: 100% | 11.7 MiB/s | 179.0 KiB | 00m00s [ 9/186] Installing fedora-repos-0:44- 100% | 5.6 MiB/s | 5.7 KiB | 00m00s [ 10/186] Installing fedora-release-com 100% | 8.1 MiB/s | 24.9 KiB | 00m00s [ 11/186] Installing fedora-release-0:4 100% | 13.5 KiB/s | 124.0 B | 00m00s >>> Running sysusers scriptlet: setup-0:2.15.0-27.fc44.noarch >>> Finished sysusers scriptlet: setup-0:2.15.0-27.fc44.noarch >>> Scriptlet output: >>> Creating group 'adm' with GID 4. >>> Creating group 'audio' with GID 63. >>> Creating group 'cdrom' with GID 11. >>> Creating group 'clock' with GID 103. >>> Creating group 'dialout' with GID 18. >>> Creating group 'disk' with GID 6. >>> Creating group 'floppy' with GID 19. >>> Creating group 'ftp' with GID 50. >>> Creating group 'games' with GID 20. >>> Creating group 'input' with GID 104. >>> Creating group 'kmem' with GID 9. >>> Creating group 'kvm' with GID 36. >>> Creating group 'lock' with GID 54. >>> Creating group 'lp' with GID 7. >>> Creating group 'mail' with GID 12. >>> Creating group 'man' with GID 15. >>> Creating group 'mem' with GID 8. >>> Creating group 'nobody' with GID 65534. >>> Creating group 'render' with GID 105. >>> Creating group 'root' with GID 0. >>> Creating group 'sgx' with GID 106. >>> Creating group 'sys' with GID 3. >>> Creating group 'tape' with GID 33. >>> Creating group 'tty' with GID 5. >>> Creating group 'users' with GID 100. >>> Creating group 'utmp' with GID 22. >>> Creating group 'video' with GID 39. >>> Creating group 'wheel' with GID 10. >>> Creating user 'adm' (adm) with UID 3 and GID 4. >>> Creating group 'bin' with GID 1. >>> Creating user 'bin' (bin) with UID 1 and GID 1. >>> Creating group 'daemon' with GID 2. >>> Creating user 'daemon' (daemon) with UID 2 and GID 2. >>> Creating user 'ftp' (FTP User) with UID 14 and GID 50. >>> Creating user 'games' (games) with UID 12 and GID 100. >>> Creating user 'halt' (halt) with UID 7 and GID 0. >>> Creating user 'lp' (lp) with UID 4 and GID 7. >>> Creating user 'mail' (mail) with UID 8 and GID 12. >>> Creating user 'nobody' (Kernel Overflow User) with UID 65534 and GID 65534. >>> Creating user 'operator' (operator) with UID 11 and GID 0. >>> Creating user 'root' (Super User) with UID 0 and GID 0. >>> Creating user 'shutdown' (shutdown) with UID 6 and GID 0. >>> Creating user 'sync' (sync) with UID 5 and GID 0. >>> [ 12/186] Installing setup-0:2.15.0-27. 100% | 17.4 MiB/s | 730.6 KiB | 00m00s >>> [RPM] /etc/hosts created as /etc/hosts.rpmnew [ 13/186] Installing filesystem-0:3.18- 100% | 733.6 KiB/s | 212.8 KiB | 00m00s [ 14/186] Installing gnulib-l10n-0:2024 100% | 53.9 MiB/s | 661.9 KiB | 00m00s [ 15/186] Installing coreutils-common-0 100% | 117.0 MiB/s | 11.2 MiB | 00m00s [ 16/186] Installing pcre2-syntax-0:10. 100% | 69.4 MiB/s | 284.3 KiB | 00m00s [ 17/186] Installing ncurses-base-0:6.5 100% | 20.3 MiB/s | 353.5 KiB | 00m00s [ 18/186] Installing bash-0:5.3.0-2.fc4 100% | 85.0 MiB/s | 8.9 MiB | 00m00s [ 19/186] Installing glibc-common-0:2.4 100% | 27.5 MiB/s | 1.5 MiB | 00m00s [ 20/186] Installing glibc-gconv-extra- 100% | 123.6 MiB/s | 18.5 MiB | 00m00s [ 21/186] Installing glibc-0:2.42.9000- 100% | 81.5 MiB/s | 11.7 MiB | 00m00s [ 22/186] Installing ncurses-libs-0:6.5 100% | 99.7 MiB/s | 1.5 MiB | 00m00s [ 23/186] Installing glibc-minimal-lang 100% | 121.1 KiB/s | 124.0 B | 00m00s [ 24/186] Installing zlib-ng-compat-0:2 100% | 64.5 MiB/s | 198.1 KiB | 00m00s [ 25/186] Installing bzip2-libs-0:1.0.8 100% | 67.2 MiB/s | 137.7 KiB | 00m00s [ 26/186] Installing libgpg-error-0:1.5 100% | 21.6 MiB/s | 1.0 MiB | 00m00s [ 27/186] Installing libassuan-0:2.5.7- 100% | 53.1 MiB/s | 217.6 KiB | 00m00s [ 28/186] Installing libgcrypt-0:1.11.2 100% | 107.7 MiB/s | 1.5 MiB | 00m00s [ 29/186] Installing readline-0:8.3-2.f 100% | 102.5 MiB/s | 629.7 KiB | 00m00s [ 30/186] Installing xz-libs-1:5.8.1-4. 100% | 86.7 MiB/s | 266.4 KiB | 00m00s [ 31/186] Installing libuuid-0:2.41.3-8 100% | 34.3 MiB/s | 70.3 KiB | 00m00s [ 32/186] Installing gmp-1:6.3.0-4.fc44 100% | 96.2 MiB/s | 788.4 KiB | 00m00s [ 33/186] Installing popt-0:1.19-9.fc43 100% | 26.3 MiB/s | 215.3 KiB | 00m00s [ 34/186] Installing libzstd-0:1.5.7-3. 100% | 109.2 MiB/s | 1.1 MiB | 00m00s [ 35/186] Installing elfutils-libelf-0: 100% | 120.7 MiB/s | 1.2 MiB | 00m00s [ 36/186] Installing npth-0:1.8-3.fc43. 100% | 46.0 MiB/s | 94.2 KiB | 00m00s [ 37/186] Installing libblkid-0:2.41.3- 100% | 86.8 MiB/s | 355.5 KiB | 00m00s [ 38/186] Installing systemd-libs-0:259 100% | 118.5 MiB/s | 3.0 MiB | 00m00s [ 39/186] Installing libxcrypt-0:4.5.2- 100% | 66.4 MiB/s | 339.7 KiB | 00m00s [ 40/186] Installing libsepol-0:3.9-2.f 100% | 104.2 MiB/s | 1.0 MiB | 00m00s [ 41/186] Installing sqlite-libs-0:3.51 100% | 107.7 MiB/s | 1.9 MiB | 00m00s [ 42/186] Installing gnupg2-gpgconf-0:2 100% | 8.3 MiB/s | 323.9 KiB | 00m00s [ 43/186] Installing libattr-0:2.5.2-6. 100% | 33.7 MiB/s | 69.1 KiB | 00m00s [ 44/186] Installing libacl-0:2.3.2-4.f 100% | 33.4 MiB/s | 68.3 KiB | 00m00s [ 45/186] Installing pcre2-0:10.47-1.fc 100% | 103.0 MiB/s | 843.4 KiB | 00m00s [ 46/186] Installing libselinux-0:3.9-5 100% | 65.0 MiB/s | 266.4 KiB | 00m00s [ 47/186] Installing grep-0:3.12-2.fc43 100% | 20.3 MiB/s | 1.0 MiB | 00m00s [ 48/186] Installing sed-0:4.9-6.fc44.p 100% | 18.8 MiB/s | 945.3 KiB | 00m00s [ 49/186] Installing findutils-1:4.10.0 100% | 36.5 MiB/s | 2.0 MiB | 00m00s [ 50/186] Installing libtasn1-0:4.20.0- 100% | 72.2 MiB/s | 221.9 KiB | 00m00s [ 51/186] Installing libunistring-0:1.1 100% | 117.0 MiB/s | 1.9 MiB | 00m00s [ 52/186] Installing libidn2-0:2.3.8-2. 100% | 32.5 MiB/s | 566.4 KiB | 00m00s [ 53/186] Installing crypto-policies-0: 100% | 7.7 MiB/s | 157.7 KiB | 00m00s [ 54/186] Installing xz-1:5.8.1-4.fc44. 100% | 25.7 MiB/s | 1.4 MiB | 00m00s [ 55/186] Installing libmount-0:2.41.3- 100% | 89.4 MiB/s | 549.2 KiB | 00m00s [ 56/186] Installing gnupg2-verify-0:2. 100% | 10.0 MiB/s | 429.7 KiB | 00m00s [ 57/186] Installing dwz-0:0.16-2.fc43. 100% | 9.5 MiB/s | 388.0 KiB | 00m00s [ 58/186] Installing mpfr-0:4.2.2-2.fc4 100% | 89.4 MiB/s | 915.3 KiB | 00m00s [ 59/186] Installing gawk-0:5.3.2-2.fc4 100% | 44.9 MiB/s | 2.8 MiB | 00m00s [ 60/186] Installing libksba-0:1.6.7-4. 100% | 86.1 MiB/s | 529.0 KiB | 00m00s [ 61/186] Installing unzip-0:6.0-68.fc4 100% | 13.1 MiB/s | 537.4 KiB | 00m00s [ 62/186] Installing file-libs-0:5.46-8 100% | 182.8 MiB/s | 11.9 MiB | 00m00s [ 63/186] Installing file-0:5.46-8.fc44 100% | 3.7 MiB/s | 141.6 KiB | 00m00s [ 64/186] Installing diffutils-0:3.12-3 100% | 32.4 MiB/s | 1.7 MiB | 00m00s [ 65/186] Installing libcap-ng-0:0.8.5- 100% | 52.8 MiB/s | 162.1 KiB | 00m00s [ 66/186] Installing audit-libs-0:4.1.2 100% | 90.0 MiB/s | 553.2 KiB | 00m00s [ 67/186] Installing libsemanage-0:3.9- 100% | 83.1 MiB/s | 425.7 KiB | 00m00s [ 68/186] Installing libsmartcols-0:2.4 100% | 70.9 MiB/s | 290.5 KiB | 00m00s [ 69/186] Installing libeconf-0:0.7.9-2 100% | 26.9 MiB/s | 82.5 KiB | 00m00s [ 70/186] Installing pam-libs-0:1.7.1-3 100% | 70.5 MiB/s | 288.6 KiB | 00m00s [ 71/186] Installing libcap-0:2.77-1.fc 100% | 12.2 MiB/s | 512.9 KiB | 00m00s [ 72/186] Installing alternatives-0:1.3 100% | 2.5 MiB/s | 91.7 KiB | 00m00s [ 73/186] Installing lua-libs-0:5.4.8-4 100% | 77.2 MiB/s | 395.3 KiB | 00m00s [ 74/186] Installing json-c-0:0.18-7.fc 100% | 68.3 MiB/s | 139.8 KiB | 00m00s [ 75/186] Installing libffi-0:3.5.2-1.f 100% | 85.2 MiB/s | 349.0 KiB | 00m00s [ 76/186] Installing p11-kit-0:0.25.8-1 100% | 44.0 MiB/s | 2.9 MiB | 00m00s [ 77/186] Installing p11-kit-trust-0:0. 100% | 12.4 MiB/s | 595.9 KiB | 00m00s [ 78/186] Installing ngtcp2-0:1.18.0-1. 100% | 79.4 MiB/s | 406.7 KiB | 00m00s [ 79/186] Installing openssl-libs-1:3.5 100% | 125.7 MiB/s | 9.0 MiB | 00m00s [ 80/186] Installing coreutils-0:9.9-1. 100% | 80.6 MiB/s | 9.4 MiB | 00m00s [ 81/186] Installing ca-certificates-0: 100% | 729.7 KiB/s | 2.5 MiB | 00m03s [ 82/186] Installing gzip-0:1.14-1.fc44 100% | 7.9 MiB/s | 443.1 KiB | 00m00s [ 83/186] Installing rpm-sequoia-0:1.10 100% | 127.7 MiB/s | 4.9 MiB | 00m00s [ 84/186] Installing libfsverity-0:1.6- 100% | 33.7 MiB/s | 69.1 KiB | 00m00s [ 85/186] Installing libevent-0:2.1.12- 100% | 110.0 MiB/s | 1.2 MiB | 00m00s [ 86/186] Installing ngtcp2-crypto-ossl 100% | 33.3 MiB/s | 68.1 KiB | 00m00s [ 87/186] Installing util-linux-core-0: 100% | 40.0 MiB/s | 2.5 MiB | 00m00s [ 88/186] Installing zip-0:3.0-44.fc43. 100% | 20.3 MiB/s | 893.7 KiB | 00m00s [ 89/186] Installing gnupg2-keyboxd-0:2 100% | 36.4 MiB/s | 298.5 KiB | 00m00s [ 90/186] Installing libpsl-0:0.21.5-6. 100% | 43.4 MiB/s | 133.2 KiB | 00m00s [ 91/186] Installing tar-2:1.35-6.fc43. 100% | 48.9 MiB/s | 3.1 MiB | 00m00s [ 92/186] Installing linkdupes-0:0.7.2- 100% | 20.6 MiB/s | 908.5 KiB | 00m00s [ 93/186] Installing libselinux-utils-0 100% | 28.3 MiB/s | 1.4 MiB | 00m00s [ 94/186] Installing liblastlog2-0:2.41 100% | 17.0 MiB/s | 139.4 KiB | 00m00s [ 95/186] Installing systemd-standalone 100% | 10.1 MiB/s | 394.1 KiB | 00m00s [ 96/186] Installing libusb1-0:1.0.29-4 100% | 18.4 MiB/s | 244.4 KiB | 00m00s >>> Running sysusers scriptlet: tpm2-tss-0:4.1.3-8.fc43.ppc64le >>> Finished sysusers scriptlet: tpm2-tss-0:4.1.3-8.fc43.ppc64le >>> Scriptlet output: >>> Creating group 'tss' with GID 59. >>> Creating user 'tss' (Account used for TPM access) with UID 59 and GID 59. >>> [ 97/186] Installing tpm2-tss-0:4.1.3-8 100% | 107.4 MiB/s | 2.5 MiB | 00m00s [ 98/186] Installing ima-evm-utils-libs 100% | 45.8 MiB/s | 93.9 KiB | 00m00s [ 99/186] Installing gnupg2-gpg-agent-0 100% | 19.1 MiB/s | 979.0 KiB | 00m00s [100/186] Installing libfdisk-0:2.41.3- 100% | 94.5 MiB/s | 483.9 KiB | 00m00s [101/186] Installing nettle-0:3.10.1-2. 100% | 104.3 MiB/s | 960.9 KiB | 00m00s [102/186] Installing gnutls-0:3.8.11-6. 100% | 119.8 MiB/s | 4.1 MiB | 00m00s [103/186] Installing libxml2-0:2.12.10- 100% | 40.5 MiB/s | 2.3 MiB | 00m00s [104/186] Installing bzip2-0:1.0.8-21.f 100% | 4.5 MiB/s | 175.7 KiB | 00m00s [105/186] Installing add-determinism-0: 100% | 43.9 MiB/s | 2.4 MiB | 00m00s [106/186] Installing cpio-0:2.15-6.fc43 100% | 24.1 MiB/s | 1.2 MiB | 00m00s [107/186] Installing librtas-0:2.0.6-5. 100% | 20.0 MiB/s | 307.6 KiB | 00m00s [108/186] Installing util-linux-0:2.41. 100% | 58.6 MiB/s | 7.0 MiB | 00m00s [109/186] Installing policycoreutils-0: 100% | 18.7 MiB/s | 1.3 MiB | 00m00s [110/186] Installing selinux-policy-0:4 100% | 1.2 MiB/s | 33.6 KiB | 00m00s [111/186] Installing selinux-policy-tar 100% | 51.8 MiB/s | 14.9 MiB | 00m00s [112/186] Installing build-reproducibil 100% | 1.5 MiB/s | 1.5 KiB | 00m00s [113/186] Installing libpkgconf-0:2.3.0 100% | 65.9 MiB/s | 135.0 KiB | 00m00s [114/186] Installing pkgconf-0:2.3.0-3. 100% | 2.9 MiB/s | 114.8 KiB | 00m00s [115/186] Installing ed-0:1.22.3-1.fc44 100% | 4.2 MiB/s | 159.1 KiB | 00m00s [116/186] Installing patch-0:2.8-3.fc44 100% | 6.4 MiB/s | 263.9 KiB | 00m00s [117/186] Installing libatomic-0:16.0.0 100% | 33.7 MiB/s | 69.0 KiB | 00m00s [118/186] Installing libstdc++-0:16.0.0 100% | 126.3 MiB/s | 3.9 MiB | 00m00s [119/186] Installing rpm-libs-0:6.0.1-1 100% | 102.0 MiB/s | 1.2 MiB | 00m00s [120/186] Installing zstd-0:1.5.7-3.fc4 100% | 13.4 MiB/s | 577.4 KiB | 00m00s [121/186] Installing lz4-libs-0:1.10.0- 100% | 64.0 MiB/s | 262.2 KiB | 00m00s [122/186] Installing libarchive-0:3.8.4 100% | 97.5 MiB/s | 1.3 MiB | 00m00s [123/186] Installing jansson-0:2.14-3.f 100% | 51.6 MiB/s | 158.4 KiB | 00m00s [124/186] Installing libgomp-0:16.0.0-0 100% | 106.8 MiB/s | 655.9 KiB | 00m00s [125/186] Installing libtool-ltdl-0:2.5 100% | 46.3 MiB/s | 94.9 KiB | 00m00s [126/186] Installing gdbm-libs-1:1.23-1 100% | 57.4 MiB/s | 235.2 KiB | 00m00s [127/186] Installing cyrus-sasl-lib-0:2 100% | 47.8 MiB/s | 2.9 MiB | 00m00s [128/186] Installing openldap-0:2.6.10- 100% | 87.3 MiB/s | 893.7 KiB | 00m00s [129/186] Installing gnupg2-dirmngr-0:2 100% | 17.1 MiB/s | 840.8 KiB | 00m00s [130/186] Installing gnupg2-0:2.4.8-4.f 100% | 73.4 MiB/s | 6.9 MiB | 00m00s [131/186] Installing rpm-sign-libs-0:6. 100% | 33.4 MiB/s | 68.5 KiB | 00m00s [132/186] Installing gpgverify-0:2.2-3. 100% | 9.2 MiB/s | 9.4 KiB | 00m00s [133/186] Installing xxhash-libs-0:0.8. 100% | 42.5 MiB/s | 87.0 KiB | 00m00s [134/186] Installing libbrotli-0:1.2.0- 100% | 84.6 MiB/s | 1.0 MiB | 00m00s [135/186] Installing libnghttp2-0:1.68. 100% | 64.8 MiB/s | 199.0 KiB | 00m00s [136/186] Installing libnghttp3-0:1.14. 100% | 67.7 MiB/s | 207.9 KiB | 00m00s [137/186] Installing keyutils-libs-0:1. 100% | 48.5 MiB/s | 99.4 KiB | 00m00s [138/186] Installing libcom_err-0:1.47. 100% | 54.8 MiB/s | 112.1 KiB | 00m00s [139/186] Installing libverto-0:0.3.2-1 100% | 23.1 MiB/s | 70.9 KiB | 00m00s [140/186] Installing krb5-libs-0:1.21.3 100% | 102.4 MiB/s | 3.0 MiB | 00m00s [141/186] Installing libssh-0:0.11.3-1. 100% | 87.6 MiB/s | 717.3 KiB | 00m00s [142/186] Installing libcurl-0:8.18.0~r 100% | 100.7 MiB/s | 1.2 MiB | 00m00s [143/186] Installing curl-0:8.18.0~rc2- 100% | 10.0 MiB/s | 530.2 KiB | 00m00s [144/186] Installing rpm-0:6.0.1-1.fc44 100% | 30.4 MiB/s | 2.8 MiB | 00m00s [145/186] Installing cmake-srpm-macros- 100% | 785.2 KiB/s | 804.0 B | 00m00s [146/186] Installing efi-srpm-macros-0: 100% | 20.1 MiB/s | 41.2 KiB | 00m00s [147/186] Installing java-srpm-macros-0 100% | 1.1 MiB/s | 1.1 KiB | 00m00s [148/186] Installing lua-srpm-macros-0: 100% | 1.9 MiB/s | 1.9 KiB | 00m00s [149/186] Installing tree-sitter-srpm-m 100% | 4.5 MiB/s | 9.3 KiB | 00m00s [150/186] Installing zig-srpm-macros-0: 100% | 1.6 MiB/s | 1.7 KiB | 00m00s [151/186] Installing filesystem-srpm-ma 100% | 19.0 MiB/s | 38.9 KiB | 00m00s [152/186] Installing elfutils-default-y 100% | 408.6 KiB/s | 2.0 KiB | 00m00s [153/186] Installing elfutils-libs-0:0. 100% | 85.6 MiB/s | 876.4 KiB | 00m00s [154/186] Installing elfutils-debuginfo 100% | 3.6 MiB/s | 145.7 KiB | 00m00s [155/186] Installing binutils-0:2.45.50 100% | 117.7 MiB/s | 32.8 MiB | 00m00s [156/186] Installing elfutils-0:0.194-2 100% | 55.7 MiB/s | 3.5 MiB | 00m00s [157/186] Installing gdb-minimal-0:16.3 100% | 102.4 MiB/s | 15.7 MiB | 00m00s [158/186] Installing debugedit-0:5.2-3. 100% | 8.7 MiB/s | 384.9 KiB | 00m00s [159/186] Installing rpm-build-libs-0:6 100% | 80.3 MiB/s | 328.8 KiB | 00m00s [160/186] Installing pkgconf-m4-0:2.3.0 100% | 14.5 MiB/s | 14.8 KiB | 00m00s [161/186] Installing pkgconf-pkg-config 100% | 49.3 KiB/s | 1.8 KiB | 00m00s [162/186] Installing rust-srpm-macros-0 100% | 6.2 MiB/s | 6.4 KiB | 00m00s [163/186] Installing qt6-srpm-macros-0: 100% | 722.7 KiB/s | 740.0 B | 00m00s [164/186] Installing qt5-srpm-macros-0: 100% | 757.8 KiB/s | 776.0 B | 00m00s [165/186] Installing perl-srpm-macros-0 100% | 1.1 MiB/s | 1.1 KiB | 00m00s [166/186] Installing package-notes-srpm 100% | 2.0 MiB/s | 2.0 KiB | 00m00s [167/186] Installing openblas-srpm-macr 100% | 382.8 KiB/s | 392.0 B | 00m00s [168/186] Installing ocaml-srpm-macros- 100% | 2.1 MiB/s | 2.1 KiB | 00m00s [169/186] Installing kernel-srpm-macros 100% | 2.3 MiB/s | 2.3 KiB | 00m00s [170/186] Installing gnat-srpm-macros-0 100% | 1.2 MiB/s | 1.3 KiB | 00m00s [171/186] Installing ghc-srpm-macros-0: 100% | 1.0 MiB/s | 1.0 KiB | 00m00s [172/186] Installing gap-srpm-macros-0: 100% | 2.6 MiB/s | 2.7 KiB | 00m00s [173/186] Installing fpc-srpm-macros-0: 100% | 410.2 KiB/s | 420.0 B | 00m00s [174/186] Installing ansible-srpm-macro 100% | 17.7 MiB/s | 36.2 KiB | 00m00s [175/186] Installing rpm-build-0:6.0.1- 100% | 13.1 MiB/s | 672.5 KiB | 00m00s [176/186] Installing pyproject-srpm-mac 100% | 1.2 MiB/s | 2.5 KiB | 00m00s [177/186] Installing redhat-rpm-config- 100% | 26.5 MiB/s | 189.9 KiB | 00m00s [178/186] Installing forge-srpm-macros- 100% | 19.7 MiB/s | 40.3 KiB | 00m00s [179/186] Installing fonts-srpm-macros- 100% | 27.8 MiB/s | 57.0 KiB | 00m00s [180/186] Installing go-srpm-macros-0:3 100% | 30.8 MiB/s | 63.0 KiB | 00m00s [181/186] Installing R-srpm-macros-0:1. 100% | 2.0 MiB/s | 4.0 KiB | 00m00s [182/186] Installing python-srpm-macros 100% | 25.9 MiB/s | 52.9 KiB | 00m00s [183/186] Installing rpm-plugin-selinux 100% | 33.6 MiB/s | 68.9 KiB | 00m00s [184/186] Installing which-0:2.23-3.fc4 100% | 3.0 MiB/s | 125.5 KiB | 00m00s [185/186] Installing shadow-utils-2:4.1 100% | 46.8 MiB/s | 4.9 MiB | 00m00s [186/186] Installing info-0:7.2-7.fc44. 100% | 34.3 KiB/s | 485.8 KiB | 00m14s Warning: skipped OpenPGP checks for 179 packages from repositories: copr_base, https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch Complete! Finish: installing minimal buildroot with dnf5 Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: R-srpm-macros-1.3.0-1.fc44.noarch add-determinism-0.7.2-2.fc44.ppc64le alternatives-1.33-3.fc44.ppc64le ansible-srpm-macros-1-18.1.fc43.noarch audit-libs-4.1.2-2.fc44.ppc64le bash-5.3.0-2.fc44.ppc64le binutils-2.45.50-12.fc44.ppc64le build-reproducibility-srpm-macros-0.7.2-2.fc44.noarch bzip2-1.0.8-21.fc43.ppc64le bzip2-libs-1.0.8-21.fc43.ppc64le ca-certificates-2025.2.80_v9.0.304-2.fc44.noarch cmake-srpm-macros-3.31.10-3.fc44.noarch coreutils-9.9-1.fc44.ppc64le coreutils-common-9.9-1.fc44.ppc64le cpio-2.15-6.fc43.ppc64le crypto-policies-20251128-1.git19878fe.fc44.noarch curl-8.18.0~rc2-1.fc44.ppc64le cyrus-sasl-lib-2.1.28-33.fc44.ppc64le debugedit-5.2-3.fc44.ppc64le diffutils-3.12-3.fc43.ppc64le dwz-0.16-2.fc43.ppc64le ed-1.22.3-1.fc44.ppc64le efi-srpm-macros-6-5.fc44.noarch elfutils-0.194-2.fc44.ppc64le elfutils-debuginfod-client-0.194-2.fc44.ppc64le elfutils-default-yama-scope-0.194-2.fc44.noarch elfutils-libelf-0.194-2.fc44.ppc64le elfutils-libs-0.194-2.fc44.ppc64le fedora-gpg-keys-44-0.1.noarch fedora-release-44-0.10.noarch fedora-release-common-44-0.10.noarch fedora-release-identity-basic-44-0.10.noarch fedora-repos-44-0.1.noarch fedora-repos-rawhide-44-0.1.noarch file-5.46-8.fc44.ppc64le file-libs-5.46-8.fc44.ppc64le filesystem-3.18-50.fc43.ppc64le filesystem-srpm-macros-3.18-50.fc43.noarch findutils-4.10.0-6.fc43.ppc64le fonts-srpm-macros-5.0.0-1.fc44.noarch forge-srpm-macros-0.4.0-3.fc43.noarch fpc-srpm-macros-1.3-15.fc43.noarch gap-srpm-macros-2-1.fc44.noarch gawk-5.3.2-2.fc43.ppc64le gdb-minimal-16.3-6.fc44.ppc64le gdbm-libs-1.23-10.fc43.ppc64le ghc-srpm-macros-1.9.2-3.fc43.noarch glibc-2.42.9000-17.fc44.ppc64le glibc-common-2.42.9000-17.fc44.ppc64le glibc-gconv-extra-2.42.9000-17.fc44.ppc64le glibc-minimal-langpack-2.42.9000-17.fc44.ppc64le gmp-6.3.0-4.fc44.ppc64le gnat-srpm-macros-6-8.fc43.noarch gnulib-l10n-20241231-1.fc44.noarch gnupg2-2.4.8-4.fc43.ppc64le gnupg2-dirmngr-2.4.8-4.fc43.ppc64le gnupg2-gpg-agent-2.4.8-4.fc43.ppc64le gnupg2-gpgconf-2.4.8-4.fc43.ppc64le gnupg2-keyboxd-2.4.8-4.fc43.ppc64le gnupg2-verify-2.4.8-4.fc43.ppc64le gnutls-3.8.11-6.fc44.ppc64le go-srpm-macros-3.8.0-1.fc44.noarch gpg-pubkey-36f612dcf27f7d1a48a835e4dbfcf71c6d9f90a6-6786af3b gpg-pubkey-4f50a6114cd5c6976a7f1179655a4b02f577861e-6888bc98 gpg-pubkey-c6e7f081cf80e13146676e88829b606631645531-66b6dccf gpgverify-2.2-3.fc43.noarch grep-3.12-2.fc43.ppc64le gzip-1.14-1.fc44.ppc64le ima-evm-utils-libs-1.6.2-7.fc44.ppc64le info-7.2-7.fc44.ppc64le jansson-2.14-3.fc43.ppc64le java-srpm-macros-1-7.fc43.noarch json-c-0.18-7.fc43.ppc64le kernel-srpm-macros-1.0-27.fc43.noarch keyutils-libs-1.6.3-6.fc43.ppc64le krb5-libs-1.21.3-10.fc44.ppc64le libacl-2.3.2-4.fc44.ppc64le libarchive-3.8.4-1.fc44.ppc64le libassuan-2.5.7-4.fc43.ppc64le libatomic-16.0.0-0.3.fc44.ppc64le libattr-2.5.2-6.fc43.ppc64le libblkid-2.41.3-8.fc44.ppc64le libbrotli-1.2.0-1.fc44.ppc64le libcap-2.77-1.fc44.ppc64le libcap-ng-0.8.5-8.fc44.ppc64le libcom_err-1.47.3-3.fc44.ppc64le libcurl-8.18.0~rc2-1.fc44.ppc64le libeconf-0.7.9-2.fc43.ppc64le libevent-2.1.12-16.fc43.ppc64le libfdisk-2.41.3-8.fc44.ppc64le libffi-3.5.2-1.fc44.ppc64le libfsverity-1.6-3.fc43.ppc64le libgcc-16.0.0-0.3.fc44.ppc64le libgcrypt-1.11.2-1.fc44.ppc64le libgomp-16.0.0-0.3.fc44.ppc64le libgpg-error-1.58-1.fc44.ppc64le libidn2-2.3.8-2.fc43.ppc64le libksba-1.6.7-4.fc43.ppc64le liblastlog2-2.41.3-8.fc44.ppc64le libmount-2.41.3-8.fc44.ppc64le libnghttp2-1.68.0-2.fc44.ppc64le libnghttp3-1.14.0-1.fc44.ppc64le libpkgconf-2.3.0-3.fc43.ppc64le libpsl-0.21.5-6.fc43.ppc64le librtas-2.0.6-5.fc44.ppc64le libselinux-3.9-5.fc44.ppc64le libselinux-utils-3.9-5.fc44.ppc64le libsemanage-3.9-4.fc44.ppc64le libsepol-3.9-2.fc43.ppc64le libsmartcols-2.41.3-8.fc44.ppc64le libssh-0.11.3-1.fc44.ppc64le libssh-config-0.11.3-1.fc44.noarch libstdc++-16.0.0-0.3.fc44.ppc64le libtasn1-4.20.0-2.fc43.ppc64le libtool-ltdl-2.5.4-9.fc44.ppc64le libunistring-1.1-10.fc43.ppc64le libusb1-1.0.29-4.fc44.ppc64le libuuid-2.41.3-8.fc44.ppc64le libverto-0.3.2-11.fc43.ppc64le libxcrypt-4.5.2-2.fc44.ppc64le libxml2-2.12.10-5.fc44.ppc64le libzstd-1.5.7-3.fc44.ppc64le linkdupes-0.7.2-2.fc44.ppc64le lua-libs-5.4.8-4.fc44.ppc64le lua-srpm-macros-1-16.fc43.noarch lz4-libs-1.10.0-3.fc43.ppc64le mpfr-4.2.2-2.fc43.ppc64le ncurses-base-6.5-8.20250614.fc44.noarch ncurses-libs-6.5-8.20250614.fc44.ppc64le nettle-3.10.1-2.fc43.ppc64le ngtcp2-1.18.0-1.fc44.ppc64le ngtcp2-crypto-ossl-1.18.0-1.fc44.ppc64le npth-1.8-3.fc43.ppc64le ocaml-srpm-macros-11-2.fc43.noarch openblas-srpm-macros-2-20.fc43.noarch openldap-2.6.10-4.fc44.ppc64le openssl-libs-3.5.4-1.fc44.ppc64le p11-kit-0.25.8-1.fc44.ppc64le p11-kit-trust-0.25.8-1.fc44.ppc64le package-notes-srpm-macros-0.5-14.fc43.noarch pam-libs-1.7.1-3.fc43.ppc64le patch-2.8-3.fc44.ppc64le pcre2-10.47-1.fc44.ppc64le pcre2-syntax-10.47-1.fc44.noarch perl-srpm-macros-1-60.fc43.noarch pkgconf-2.3.0-3.fc43.ppc64le pkgconf-m4-2.3.0-3.fc43.noarch pkgconf-pkg-config-2.3.0-3.fc43.ppc64le policycoreutils-3.9-5.fc44.ppc64le popt-1.19-9.fc43.ppc64le publicsuffix-list-dafsa-20250616-2.fc43.noarch pyproject-srpm-macros-1.18.6-1.fc44.noarch python-srpm-macros-3.14-9.fc44.noarch qt5-srpm-macros-5.15.18-1.fc44.noarch qt6-srpm-macros-6.10.1-1.fc44.noarch readline-8.3-2.fc43.ppc64le redhat-rpm-config-343-19.fc44.noarch rpm-6.0.1-1.fc44.ppc64le rpm-build-6.0.1-1.fc44.ppc64le rpm-build-libs-6.0.1-1.fc44.ppc64le rpm-libs-6.0.1-1.fc44.ppc64le rpm-plugin-selinux-6.0.1-1.fc44.ppc64le rpm-sequoia-1.10.0-1.fc44.ppc64le rpm-sign-libs-6.0.1-1.fc44.ppc64le rust-srpm-macros-28.4-1.fc44.noarch sed-4.9-6.fc44.ppc64le selinux-policy-42.19-1.fc44.noarch selinux-policy-targeted-42.19-1.fc44.noarch setup-2.15.0-27.fc44.noarch shadow-utils-4.18.0-7.fc44.ppc64le sqlite-libs-3.51.0-1.fc44.ppc64le systemd-libs-259-1.fc44.ppc64le systemd-standalone-sysusers-259-1.fc44.ppc64le tar-1.35-6.fc43.ppc64le tpm2-tss-4.1.3-8.fc43.ppc64le tree-sitter-srpm-macros-0.4.2-1.fc43.noarch unzip-6.0-68.fc44.ppc64le util-linux-2.41.3-8.fc44.ppc64le util-linux-core-2.41.3-8.fc44.ppc64le which-2.23-3.fc43.ppc64le xxhash-libs-0.8.3-3.fc43.ppc64le xz-5.8.1-4.fc44.ppc64le xz-libs-5.8.1-4.fc44.ppc64le zig-srpm-macros-1-5.fc43.noarch zip-3.0-44.fc43.ppc64le zlib-ng-compat-2.3.2-2.fc44.ppc64le zstd-1.5.7-3.fc44.ppc64le Start: buildsrpm Start: rpmbuild -bs Building target platforms: ppc64le Building for target ppc64le setting SOURCE_DATE_EPOCH=1753228800 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-8.fc44.src.rpm Finish: rpmbuild -bs INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-ppc64le-1766674341.303132/root/var/log/dnf5.log INFO: chroot_scan: creating tarball /var/lib/copr-rpmbuild/results/chroot_scan.tar.gz /bin/tar: Removing leading `/' from member names Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-2p3wse04/bowtie/bowtie.spec) Config(child) 0 minutes 43 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-8.fc44.src.rpm) Config(fedora-rawhide-ppc64le) Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-bootstrap-1766674341.303132/root. INFO: reusing tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-bootstrap-1766674341.303132/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-ppc64le-1766674341.303132/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-6.0.1-1.fc44.ppc64le rpm-sequoia-1.10.0-1.fc44.ppc64le dnf5-5.3.0.0-3.fc44.ppc64le dnf5-plugins-5.3.0.0-3.fc44.ppc64le Finish: chroot init Start: build phase for bowtie-1.3.1-8.fc44.src.rpm Start: build setup for bowtie-1.3.1-8.fc44.src.rpm Building target platforms: ppc64le Building for target ppc64le setting SOURCE_DATE_EPOCH=1753228800 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-8.fc44.src.rpm Updating and loading repositories: Additional repo https_kojipkgs_fedorap 100% | 14.1 KiB/s | 3.5 KiB | 00m00s Copr repository 100% | 6.2 KiB/s | 1.5 KiB | 00m00s fedora 100% | 15.9 KiB/s | 4.7 KiB | 00m00s Repositories loaded. Package Arch Version Repository Size Installing: gcc-c++ ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 47.7 MiB hostname ppc64le 0:3.25-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 89.3 KiB make ppc64le 1:4.4.1-11.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 MiB perl-Clone ppc64le 0:0.47-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 80.1 KiB perl-Data-Dumper ppc64le 0:2.191-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 135.4 KiB perl-FindBin noarch 0:1.54-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.8 KiB perl-Getopt-Long noarch 1:2.58-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 144.5 KiB perl-Test-Deep noarch 0:1.205-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 265.7 KiB perl-interpreter ppc64le 4:5.42.0-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 174.5 KiB perl-lib ppc64le 0:0.65-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.5 KiB python3 ppc64le 0:3.14.2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 84.8 KiB tbb-devel ppc64le 0:2022.3.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.4 MiB zlib-ng-compat-devel ppc64le 0:2.3.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 107.0 KiB Installing dependencies: annobin-docs noarch 0:13.04-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 99.2 KiB annobin-plugin-gcc ppc64le 0:13.04-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 707.4 KiB cmake-filesystem ppc64le 0:3.31.10-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 0.0 B cpp ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 41.7 MiB expat ppc64le 0:2.7.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 424.7 KiB gcc ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 117.9 MiB gcc-plugin-annobin ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 68.9 KiB glibc-devel ppc64le 0:2.42.9000-17.fc44 fedora 3.7 MiB groff-base ppc64le 0:1.23.0-11.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.5 MiB hwloc-libs ppc64le 0:2.12.0-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.1 MiB kernel-headers ppc64le 0:6.19.0-0.rc2.20.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.8 MiB libasan ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.2 MiB libmpc ppc64le 0:1.3.1-8.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 281.6 KiB libstdc++-devel ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 38.6 MiB libubsan ppc64le 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 669.0 KiB libxcrypt-devel ppc64le 0:4.5.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 31.0 KiB mpdecimal ppc64le 0:4.0.1-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 281.2 KiB ncurses ppc64le 0:6.5-8.20250614.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 956.9 KiB perl-AutoLoader noarch 0:5.74-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 20.6 KiB perl-B ppc64le 0:1.89-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 545.2 KiB perl-Carp noarch 0:1.54-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 46.6 KiB perl-Class-Struct noarch 0:0.68-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 25.4 KiB perl-Digest noarch 0:1.20-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 35.3 KiB perl-Digest-MD5 ppc64le 0:2.59-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 103.4 KiB perl-DynaLoader ppc64le 0:1.57-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 32.1 KiB perl-Encode ppc64le 4:3.21-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.8 MiB perl-Errno ppc64le 0:1.38-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.4 KiB perl-Exporter noarch 0:5.79-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 54.3 KiB perl-Fcntl ppc64le 0:1.20-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 92.5 KiB perl-File-Basename noarch 0:2.86-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 14.0 KiB perl-File-Path noarch 0:2.18-521.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 63.5 KiB perl-File-Temp noarch 1:0.231.200-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 163.7 KiB perl-File-stat noarch 0:1.14-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 12.5 KiB perl-FileHandle noarch 0:2.05-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 9.4 KiB perl-Getopt-Std noarch 0:1.14-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 11.2 KiB perl-HTTP-Tiny noarch 0:0.090-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 154.4 KiB perl-IO ppc64le 0:1.55-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 191.1 KiB perl-IO-Socket-IP noarch 0:0.43-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 100.3 KiB perl-IO-Socket-SSL noarch 0:2.095-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 714.5 KiB perl-IPC-Open3 noarch 0:1.24-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 27.7 KiB perl-JSON-PP noarch 1:4.16-522.fc44 fedora 141.9 KiB perl-MIME-Base32 noarch 0:1.303-24.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 30.7 KiB perl-MIME-Base64 ppc64le 0:3.16-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 93.7 KiB perl-Math-BigInt noarch 1:2.0050.03-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.1 MiB perl-Math-Complex noarch 0:1.63-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 85.1 KiB perl-Net-SSLeay ppc64le 0:1.94-11.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.5 MiB perl-POSIX ppc64le 0:2.23-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 328.3 KiB perl-PathTools ppc64le 0:3.94-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 223.9 KiB perl-Pod-Escapes noarch 1:1.07-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 24.9 KiB perl-Pod-Perldoc noarch 0:3.28.01-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 163.7 KiB perl-Pod-Simple noarch 1:3.47-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 565.3 KiB perl-Pod-Usage noarch 4:2.05-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 86.3 KiB perl-Scalar-List-Utils ppc64le 5:1.70-1.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 152.6 KiB perl-SelectSaver noarch 0:1.02-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.2 KiB perl-Socket ppc64le 4:2.040-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 143.9 KiB perl-Storable ppc64le 1:3.37-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 243.1 KiB perl-Symbol noarch 0:1.09-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.8 KiB perl-Term-ANSIColor noarch 0:5.01-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 97.5 KiB perl-Term-Cap noarch 0:1.18-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 29.3 KiB perl-Term-Table noarch 0:0.025-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 78.0 KiB perl-Test-Simple noarch 3:1.302219-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.8 MiB perl-Text-ParseWords noarch 0:3.31-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 13.6 KiB perl-Text-Tabs+Wrap noarch 0:2024.001-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 22.6 KiB perl-Time-HiRes ppc64le 4:1.9778-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 151.5 KiB perl-Time-Local noarch 2:1.350-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 69.0 KiB perl-URI noarch 0:5.34-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 268.0 KiB perl-base noarch 0:2.27-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 12.6 KiB perl-constant noarch 0:1.33-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 26.2 KiB perl-if noarch 0:0.61.000-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 5.8 KiB perl-libnet noarch 0:3.15-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 289.4 KiB perl-libs ppc64le 4:5.42.0-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 12.3 MiB perl-locale noarch 0:1.13-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.1 KiB perl-mro ppc64le 0:1.29-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 81.2 KiB perl-overload noarch 0:1.40-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 71.6 KiB perl-overloading noarch 0:0.02-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.9 KiB perl-parent noarch 1:0.244-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 10.3 KiB perl-podlators noarch 1:6.0.2-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 317.5 KiB perl-threads ppc64le 1:2.43-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 134.9 KiB perl-vars noarch 0:1.05-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.9 KiB python-pip-wheel noarch 0:25.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB python3-libs ppc64le 0:3.14.2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 46.4 MiB tbb ppc64le 0:2022.3.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 696.7 KiB tbb-bind ppc64le 0:2022.3.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 67.5 KiB tzdata noarch 0:2025c-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB Transaction Summary: Installing: 97 packages Total size of inbound packages is 101 MiB. Need to download 12 MiB. After this operation, 351 MiB extra will be used (install 351 MiB, remove 0 B). [ 1/97] gcc-c++-0:16.0.0-0.3.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 2/97] make-1:4.4.1-11.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 3/97] python3-0:3.14.2-1.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 4/97] zlib-ng-compat-devel-0:2.3.2-2. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 5/97] cmake-filesystem-0:3.31.10-3.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 6/97] python3-libs-0:3.14.2-1.fc44.pp 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 7/97] gcc-0:16.0.0-0.3.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 8/97] libmpc-0:1.3.1-8.fc43.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [ 9/97] libstdc++-devel-0:16.0.0-0.3.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [10/97] cpp-0:16.0.0-0.3.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [11/97] glibc-devel-0:2.42.9000-17.fc44 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [12/97] libasan-0:16.0.0-0.3.fc44.ppc64 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [13/97] libubsan-0:16.0.0-0.3.fc44.ppc6 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [14/97] kernel-headers-0:6.19.0-0.rc2.2 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [15/97] libxcrypt-devel-0:4.5.2-2.fc44. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [16/97] expat-0:2.7.3-1.fc44.ppc64le 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [17/97] mpdecimal-0:4.0.1-2.fc43.ppc64l 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [18/97] python-pip-wheel-0:25.3-1.fc44. 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [19/97] tzdata-0:2025c-1.fc44.noarch 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [20/97] annobin-plugin-gcc-0:13.04-3.fc 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [21/97] gcc-plugin-annobin-0:16.0.0-0.3 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [22/97] annobin-docs-0:13.04-3.fc44.noa 100% | 0.0 B/s | 0.0 B | 00m00s >>> Already downloaded [23/97] hostname-0:3.25-3.fc43.ppc64le 100% | 924.7 KiB/s | 27.7 KiB | 00m00s [24/97] perl-Clone-0:0.47-4.fc43.ppc64l 100% | 701.4 KiB/s | 22.4 KiB | 00m00s [25/97] perl-Data-Dumper-0:2.191-521.fc 100% | 1.7 MiB/s | 58.3 KiB | 00m00s [26/97] perl-FindBin-0:1.54-520.fc43.no 100% | 3.5 MiB/s | 14.2 KiB | 00m00s [27/97] perl-Getopt-Long-1:2.58-520.fc4 100% | 20.7 MiB/s | 63.6 KiB | 00m00s [28/97] perl-lib-0:0.65-520.fc43.ppc64l 100% | 7.3 MiB/s | 14.9 KiB | 00m00s [29/97] perl-interpreter-4:5.42.0-520.f 100% | 35.4 MiB/s | 72.4 KiB | 00m00s [30/97] perl-Test-Deep-0:1.205-2.fc43.n 100% | 14.8 MiB/s | 105.8 KiB | 00m00s [31/97] tbb-0:2022.3.0-1.fc44.ppc64le 100% | 25.0 MiB/s | 179.5 KiB | 00m00s [32/97] tbb-bind-0:2022.3.0-1.fc44.ppc6 100% | 4.7 MiB/s | 19.4 KiB | 00m00s [33/97] tbb-devel-0:2022.3.0-1.fc44.ppc 100% | 20.0 MiB/s | 225.8 KiB | 00m00s [34/97] perl-Carp-0:1.54-520.fc43.noarc 100% | 9.3 MiB/s | 28.7 KiB | 00m00s [35/97] perl-Exporter-0:5.79-520.fc43.n 100% | 15.1 MiB/s | 30.9 KiB | 00m00s [36/97] perl-Scalar-List-Utils-5:1.70-1 100% | 15.1 MiB/s | 77.3 KiB | 00m00s [37/97] perl-Test-Simple-3:1.302219-1.f 100% | 53.4 MiB/s | 820.8 KiB | 00m00s [38/97] perl-base-0:2.27-520.fc43.noarc 100% | 15.8 MiB/s | 16.2 KiB | 00m00s [39/97] hwloc-libs-0:2.12.0-2.fc43.ppc6 100% | 52.0 MiB/s | 2.1 MiB | 00m00s [40/97] perl-overload-0:1.40-520.fc43.n 100% | 4.0 MiB/s | 45.6 KiB | 00m00s [41/97] perl-libs-4:5.42.0-520.fc43.ppc 100% | 50.3 MiB/s | 2.6 MiB | 00m00s [42/97] perl-Pod-Usage-4:2.05-520.fc43. 100% | 2.8 MiB/s | 40.5 KiB | 00m00s [43/97] perl-Text-ParseWords-0:3.31-520 100% | 1.2 MiB/s | 16.3 KiB | 00m00s [44/97] perl-constant-0:1.33-521.fc43.n 100% | 7.4 MiB/s | 22.8 KiB | 00m00s [45/97] perl-File-Basename-0:2.86-520.f 100% | 8.4 MiB/s | 17.2 KiB | 00m00s [46/97] perl-PathTools-0:3.94-520.fc43. 100% | 27.2 MiB/s | 83.6 KiB | 00m00s [47/97] perl-AutoLoader-0:5.74-520.fc43 100% | 20.7 MiB/s | 21.2 KiB | 00m00s [48/97] perl-if-0:0.61.000-520.fc43.noa 100% | 6.8 MiB/s | 14.0 KiB | 00m00s [49/97] perl-B-0:1.89-520.fc43.ppc64le 100% | 44.1 MiB/s | 180.6 KiB | 00m00s [50/97] perl-overloading-0:0.02-520.fc4 100% | 6.3 MiB/s | 12.9 KiB | 00m00s [51/97] perl-mro-0:1.29-520.fc43.ppc64l 100% | 14.8 MiB/s | 30.3 KiB | 00m00s [52/97] perl-DynaLoader-0:1.57-520.fc43 100% | 25.3 MiB/s | 25.9 KiB | 00m00s [53/97] perl-File-Temp-1:0.231.200-1.fc 100% | 29.1 MiB/s | 59.5 KiB | 00m00s [54/97] perl-POSIX-0:2.23-520.fc43.ppc6 100% | 38.3 MiB/s | 117.7 KiB | 00m00s [55/97] perl-Encode-4:3.21-520.fc43.ppc 100% | 86.2 MiB/s | 1.0 MiB | 00m00s [56/97] perl-Storable-1:3.37-521.fc43.p 100% | 16.6 MiB/s | 102.1 KiB | 00m00s [57/97] perl-Symbol-0:1.09-520.fc43.noa 100% | 13.9 MiB/s | 14.2 KiB | 00m00s [58/97] perl-Term-ANSIColor-0:5.01-521. 100% | 46.5 MiB/s | 47.6 KiB | 00m00s [59/97] perl-Term-Table-0:0.025-1.fc44. 100% | 10.6 MiB/s | 43.2 KiB | 00m00s [60/97] perl-Time-HiRes-4:1.9778-520.fc 100% | 14.1 MiB/s | 57.8 KiB | 00m00s [61/97] perl-parent-1:0.244-520.fc43.no 100% | 14.5 MiB/s | 14.8 KiB | 00m00s [62/97] perl-Fcntl-0:1.20-520.fc43.ppc6 100% | 29.4 MiB/s | 30.1 KiB | 00m00s [63/97] perl-threads-1:2.43-520.fc43.pp 100% | 18.9 MiB/s | 58.2 KiB | 00m00s [64/97] perl-IO-0:1.55-520.fc43.ppc64le 100% | 38.3 MiB/s | 78.4 KiB | 00m00s [65/97] perl-Pod-Perldoc-0:3.28.01-521. 100% | 38.4 MiB/s | 78.7 KiB | 00m00s [66/97] perl-podlators-1:6.0.2-520.fc43 100% | 40.5 MiB/s | 124.3 KiB | 00m00s [67/97] perl-HTTP-Tiny-0:0.090-521.fc43 100% | 27.5 MiB/s | 56.3 KiB | 00m00s [68/97] groff-base-0:1.23.0-11.fc44.ppc 100% | 85.4 MiB/s | 1.1 MiB | 00m00s [69/97] perl-IPC-Open3-0:1.24-520.fc43. 100% | 3.3 MiB/s | 23.9 KiB | 00m00s [70/97] perl-vars-0:1.05-520.fc43.noarc 100% | 6.3 MiB/s | 13.0 KiB | 00m00s [71/97] perl-Pod-Simple-1:3.47-3.fc43.n 100% | 51.4 MiB/s | 210.5 KiB | 00m00s [72/97] perl-Errno-0:1.38-520.fc43.ppc6 100% | 14.5 MiB/s | 14.9 KiB | 00m00s [73/97] perl-locale-0:1.13-520.fc43.noa 100% | 13.2 MiB/s | 13.5 KiB | 00m00s [74/97] perl-File-stat-0:1.14-520.fc43. 100% | 8.3 MiB/s | 17.1 KiB | 00m00s [75/97] perl-SelectSaver-0:1.02-520.fc4 100% | 11.4 MiB/s | 11.7 KiB | 00m00s [76/97] perl-Socket-4:2.040-2.fc43.ppc6 100% | 27.1 MiB/s | 55.5 KiB | 00m00s [77/97] perl-IO-Socket-SSL-0:2.095-2.fc 100% | 75.4 MiB/s | 231.5 KiB | 00m00s [78/97] perl-MIME-Base64-0:3.16-520.fc4 100% | 10.0 MiB/s | 30.6 KiB | 00m00s [79/97] perl-Time-Local-2:1.350-520.fc4 100% | 16.8 MiB/s | 34.4 KiB | 00m00s [80/97] perl-Net-SSLeay-0:1.94-11.fc43. 100% | 72.3 MiB/s | 370.0 KiB | 00m00s [81/97] perl-Class-Struct-0:0.68-520.fc 100% | 7.2 MiB/s | 22.1 KiB | 00m00s [82/97] perl-File-Path-0:2.18-521.fc44. 100% | 34.2 MiB/s | 35.0 KiB | 00m00s [83/97] perl-Getopt-Std-0:1.14-520.fc43 100% | 15.3 MiB/s | 15.7 KiB | 00m00s [84/97] perl-Term-Cap-0:1.18-520.fc43.n 100% | 21.4 MiB/s | 21.9 KiB | 00m00s [85/97] ncurses-0:6.5-8.20250614.fc44.p 100% | 70.2 MiB/s | 431.1 KiB | 00m00s [86/97] perl-Math-BigInt-1:2.0050.03-3. 100% | 25.4 MiB/s | 234.5 KiB | 00m00s [87/97] perl-Pod-Escapes-1:1.07-520.fc4 100% | 9.7 MiB/s | 19.8 KiB | 00m00s [88/97] perl-Text-Tabs+Wrap-0:2024.001- 100% | 21.1 MiB/s | 21.6 KiB | 00m00s [89/97] perl-IO-Socket-IP-0:0.43-521.fc 100% | 41.1 MiB/s | 42.1 KiB | 00m00s [90/97] perl-Math-Complex-0:1.63-520.fc 100% | 15.0 MiB/s | 46.2 KiB | 00m00s [91/97] perl-MIME-Base32-0:1.303-24.fc4 100% | 19.9 MiB/s | 20.4 KiB | 00m00s [92/97] perl-URI-0:5.34-2.fc44.noarch 100% | 43.8 MiB/s | 134.5 KiB | 00m00s [93/97] perl-libnet-0:3.15-521.fc43.noa 100% | 60.0 MiB/s | 122.8 KiB | 00m00s [94/97] perl-Digest-MD5-0:2.59-520.fc43 100% | 17.6 MiB/s | 36.0 KiB | 00m00s [95/97] perl-FileHandle-0:2.05-520.fc43 100% | 15.1 MiB/s | 15.5 KiB | 00m00s [96/97] perl-Digest-0:1.20-520.fc43.noa 100% | 24.2 MiB/s | 24.8 KiB | 00m00s [97/97] perl-JSON-PP-1:4.16-522.fc44.no 100% | 2.2 KiB/s | 65.6 KiB | 00m30s >>> Curl error (28): Timeout was reached for https://dl.fedoraproject.org/pub/fedora-secondary/development/rawhide/Everything/ppc64le/os/Packages/p/perl-JSON-PP-4.16-522.fc44.noarch.rpm [Connection timed out after 30001 milliseconds] - https://dl.fedoraproject.org/pub/fedora-secondary/development/rawhide/Everything/ppc64le/os/Packages/p/perl-JSON-PP-4.16-522.fc44.noarch.rpm -------------------------------------------------------------------------------- [97/97] Total 100% | 407.5 KiB/s | 12.2 MiB | 00m31s Running transaction [ 1/99] Verify package files 100% | 64.0 B/s | 97.0 B | 00m02s [ 2/99] Prepare transaction 100% | 470.0 B/s | 97.0 B | 00m00s [ 3/99] Installing libmpc-0:1.3.1-8.fc4 100% | 69.1 MiB/s | 283.1 KiB | 00m00s [ 4/99] Installing tbb-0:2022.3.0-1.fc4 100% | 75.9 MiB/s | 699.7 KiB | 00m00s [ 5/99] Installing cmake-filesystem-0:3 100% | 1.9 MiB/s | 7.6 KiB | 00m00s [ 6/99] Installing cpp-0:16.0.0-0.3.fc4 100% | 116.2 MiB/s | 41.7 MiB | 00m00s [ 7/99] Installing annobin-docs-0:13.04 100% | 32.7 MiB/s | 100.3 KiB | 00m00s [ 8/99] Installing ncurses-0:6.5-8.2025 100% | 17.1 MiB/s | 963.5 KiB | 00m00s [ 9/99] Installing groff-base-0:1.23.0- 100% | 48.5 MiB/s | 4.5 MiB | 00m00s [10/99] Installing perl-Digest-0:1.20-5 100% | 12.1 MiB/s | 37.1 KiB | 00m00s [11/99] Installing perl-Digest-MD5-0:2. 100% | 34.3 MiB/s | 105.3 KiB | 00m00s [12/99] Installing perl-FileHandle-0:2. 100% | 9.6 MiB/s | 9.8 KiB | 00m00s [13/99] Installing perl-B-0:1.89-520.fc 100% | 76.5 MiB/s | 548.6 KiB | 00m00s [14/99] Installing perl-Data-Dumper-0:2 100% | 33.5 MiB/s | 137.3 KiB | 00m00s [15/99] Installing perl-libnet-0:3.15-5 100% | 48.0 MiB/s | 294.7 KiB | 00m00s [16/99] Installing perl-MIME-Base32-0:1 100% | 10.5 MiB/s | 32.2 KiB | 00m00s [17/99] Installing perl-URI-0:5.34-2.fc 100% | 22.9 MiB/s | 281.8 KiB | 00m00s [18/99] Installing perl-IO-Socket-IP-0: 100% | 33.3 MiB/s | 102.2 KiB | 00m00s [19/99] Installing perl-AutoLoader-0:5. 100% | 20.5 MiB/s | 21.0 KiB | 00m00s [20/99] Installing perl-IO-Socket-SSL-0 100% | 78.0 MiB/s | 718.6 KiB | 00m00s [21/99] Installing perl-Text-Tabs+Wrap- 100% | 11.7 MiB/s | 23.9 KiB | 00m00s [22/99] Installing perl-Pod-Escapes-1:1 100% | 12.7 MiB/s | 25.9 KiB | 00m00s [23/99] Installing perl-File-Path-0:2.1 100% | 31.5 MiB/s | 64.5 KiB | 00m00s [24/99] Installing perl-Time-Local-2:1. 100% | 23.0 MiB/s | 70.6 KiB | 00m00s [25/99] Installing perl-Net-SSLeay-0:1. 100% | 74.2 MiB/s | 1.6 MiB | 00m00s [26/99] Installing perl-locale-0:1.13-5 100% | 6.4 MiB/s | 6.5 KiB | 00m00s [27/99] Installing perl-if-0:0.61.000-5 100% | 6.1 MiB/s | 6.2 KiB | 00m00s [28/99] Installing perl-HTTP-Tiny-0:0.0 100% | 38.2 MiB/s | 156.4 KiB | 00m00s [29/99] Installing perl-Pod-Simple-1:3. 100% | 56.1 MiB/s | 574.9 KiB | 00m00s [30/99] Installing perl-Term-Cap-0:1.18 100% | 14.9 MiB/s | 30.6 KiB | 00m00s [31/99] Installing perl-File-Temp-1:0.2 100% | 53.9 MiB/s | 165.5 KiB | 00m00s [32/99] Installing perl-Class-Struct-0: 100% | 25.3 MiB/s | 25.9 KiB | 00m00s [33/99] Installing perl-IPC-Open3-0:1.2 100% | 27.8 MiB/s | 28.5 KiB | 00m00s [34/99] Installing perl-POSIX-0:2.23-52 100% | 80.5 MiB/s | 329.5 KiB | 00m00s [35/99] Installing perl-Term-ANSIColor- 100% | 32.3 MiB/s | 99.2 KiB | 00m00s [36/99] Installing perl-Pod-Perldoc-0:3 100% | 3.9 MiB/s | 169.2 KiB | 00m00s [37/99] Installing perl-podlators-1:6.0 100% | 7.5 MiB/s | 321.4 KiB | 00m00s [38/99] Installing perl-File-stat-0:1.1 100% | 12.8 MiB/s | 13.1 KiB | 00m00s [39/99] Installing perl-Socket-4:2.040- 100% | 47.5 MiB/s | 145.9 KiB | 00m00s [40/99] Installing perl-SelectSaver-0:1 100% | 2.6 MiB/s | 2.6 KiB | 00m00s [41/99] Installing perl-Symbol-0:1.09-5 100% | 7.1 MiB/s | 7.3 KiB | 00m00s [42/99] Installing perl-Pod-Usage-4:2.0 100% | 2.1 MiB/s | 87.9 KiB | 00m00s [43/99] Installing perl-IO-0:1.55-520.f 100% | 38.2 MiB/s | 195.4 KiB | 00m00s [44/99] Installing perl-Fcntl-0:1.20-52 100% | 45.7 MiB/s | 93.6 KiB | 00m00s [45/99] Installing perl-mro-0:1.29-520. 100% | 40.2 MiB/s | 82.3 KiB | 00m00s [46/99] Installing perl-overloading-0:0 100% | 5.4 MiB/s | 5.6 KiB | 00m00s [47/99] Installing perl-Text-ParseWords 100% | 14.2 MiB/s | 14.6 KiB | 00m00s [48/99] Installing perl-base-0:2.27-520 100% | 12.7 MiB/s | 13.0 KiB | 00m00s [49/99] Installing perl-Getopt-Long-1:2 100% | 35.9 MiB/s | 147.2 KiB | 00m00s [50/99] Installing perl-Getopt-Std-0:1. 100% | 11.5 MiB/s | 11.8 KiB | 00m00s [51/99] Installing perl-Storable-1:3.37 100% | 59.7 MiB/s | 244.7 KiB | 00m00s [52/99] Installing perl-MIME-Base64-0:3 100% | 31.2 MiB/s | 95.9 KiB | 00m00s [53/99] Installing perl-Errno-0:1.38-52 100% | 8.6 MiB/s | 8.8 KiB | 00m00s [54/99] Installing perl-vars-0:1.05-520 100% | 4.2 MiB/s | 4.3 KiB | 00m00s [55/99] Installing perl-parent-1:0.244- 100% | 10.7 MiB/s | 11.0 KiB | 00m00s [56/99] Installing perl-overload-0:1.40 100% | 70.3 MiB/s | 72.0 KiB | 00m00s [57/99] Installing perl-File-Basename-0 100% | 14.3 MiB/s | 14.6 KiB | 00m00s [58/99] Installing perl-constant-0:1.33 100% | 13.4 MiB/s | 27.4 KiB | 00m00s [59/99] Installing perl-Scalar-List-Uti 100% | 30.5 MiB/s | 156.4 KiB | 00m00s [60/99] Installing perl-Encode-4:3.21-5 100% | 62.0 MiB/s | 4.8 MiB | 00m00s [61/99] Installing perl-PathTools-0:3.9 100% | 44.6 MiB/s | 228.4 KiB | 00m00s [62/99] Installing perl-DynaLoader-0:1. 100% | 31.7 MiB/s | 32.5 KiB | 00m00s [63/99] Installing perl-Exporter-0:5.79 100% | 27.1 MiB/s | 55.6 KiB | 00m00s [64/99] Installing perl-Carp-0:1.54-520 100% | 9.3 MiB/s | 47.7 KiB | 00m00s [65/99] Installing perl-libs-4:5.42.0-5 100% | 81.3 MiB/s | 12.4 MiB | 00m00s [66/99] Installing perl-interpreter-4:5 100% | 4.3 MiB/s | 176.2 KiB | 00m00s [67/99] Installing perl-Term-Table-0:0. 100% | 26.4 MiB/s | 81.2 KiB | 00m00s [68/99] Installing perl-Time-HiRes-4:1. 100% | 37.5 MiB/s | 153.5 KiB | 00m00s [69/99] Installing perl-threads-1:2.43- 100% | 33.4 MiB/s | 137.0 KiB | 00m00s [70/99] Installing perl-Math-Complex-0: 100% | 42.0 MiB/s | 86.0 KiB | 00m00s [71/99] Installing perl-Math-BigInt-1:2 100% | 96.7 MiB/s | 1.1 MiB | 00m00s [72/99] Installing perl-JSON-PP-1:4.16- 100% | 3.3 MiB/s | 143.6 KiB | 00m00s [73/99] Installing perl-Test-Simple-3:1 100% | 32.0 MiB/s | 1.8 MiB | 00m00s [74/99] Installing tzdata-0:2025c-1.fc4 100% | 11.3 MiB/s | 1.5 MiB | 00m00s [75/99] Installing python-pip-wheel-0:2 100% | 172.0 MiB/s | 1.2 MiB | 00m00s [76/99] Installing mpdecimal-0:4.0.1-2. 100% | 69.0 MiB/s | 282.8 KiB | 00m00s [77/99] Installing expat-0:2.7.3-1.fc44 100% | 8.3 MiB/s | 426.8 KiB | 00m00s [78/99] Installing python3-libs-0:3.14. 100% | 98.8 MiB/s | 46.7 MiB | 00m00s [79/99] Installing kernel-headers-0:6.1 100% | 53.3 MiB/s | 7.0 MiB | 00m00s [80/99] Installing glibc-devel-0:2.42.9 100% | 61.6 MiB/s | 3.8 MiB | 00m00s [81/99] Installing libxcrypt-devel-0:4. 100% | 16.3 MiB/s | 33.3 KiB | 00m00s [82/99] Installing libubsan-0:16.0.0-0. 100% | 109.0 MiB/s | 669.8 KiB | 00m00s [83/99] Installing libasan-0:16.0.0-0.3 100% | 114.1 MiB/s | 2.2 MiB | 00m00s [84/99] Installing libstdc++-devel-0:16 100% | 129.5 MiB/s | 38.7 MiB | 00m00s [85/99] Installing hwloc-libs-0:2.12.0- 100% | 145.6 MiB/s | 3.1 MiB | 00m00s [86/99] Installing tbb-bind-0:2022.3.0- 100% | 33.4 MiB/s | 68.4 KiB | 00m00s [87/99] Installing make-1:4.4.1-11.fc43 100% | 32.4 MiB/s | 1.9 MiB | 00m00s [88/99] Installing gcc-0:16.0.0-0.3.fc4 100% | 131.5 MiB/s | 118.0 MiB | 00m01s [89/99] Installing gcc-c++-0:16.0.0-0.3 100% | 120.9 MiB/s | 47.8 MiB | 00m00s [90/99] Installing annobin-plugin-gcc-0 100% | 31.5 MiB/s | 709.1 KiB | 00m00s [91/99] Installing gcc-plugin-annobin-0 100% | 3.3 MiB/s | 70.6 KiB | 00m00s [92/99] Installing tbb-devel-0:2022.3.0 100% | 65.1 MiB/s | 1.4 MiB | 00m00s [93/99] Installing python3-0:3.14.2-1.f 100% | 2.1 MiB/s | 86.5 KiB | 00m00s [94/99] Installing perl-Test-Deep-0:1.2 100% | 24.9 MiB/s | 280.8 KiB | 00m00s [95/99] Installing perl-Clone-0:0.47-4. 100% | 26.6 MiB/s | 81.8 KiB | 00m00s [96/99] Installing perl-FindBin-0:1.54- 100% | 7.0 MiB/s | 7.2 KiB | 00m00s [97/99] Installing perl-lib-0:0.65-520. 100% | 8.7 MiB/s | 8.9 KiB | 00m00s [98/99] Installing zlib-ng-compat-devel 100% | 35.3 MiB/s | 108.6 KiB | 00m00s [99/99] Installing hostname-0:3.25-3.fc 100% | 289.2 KiB/s | 92.2 KiB | 00m00s Warning: skipped OpenPGP checks for 95 packages from repository: https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch Complete! Building target platforms: ppc64le Building for target ppc64le setting SOURCE_DATE_EPOCH=1753228800 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-8.fc44.src.rpm Updating and loading repositories: Additional repo https_kojipkgs_fedorap 100% | 2.8 KiB/s | 3.5 KiB | 00m01s Copr repository 100% | 1.2 KiB/s | 1.5 KiB | 00m01s fedora 100% | 3.7 KiB/s | 4.7 KiB | 00m01s Repositories loaded. Nothing to do. Package "gcc-c++-16.0.0-0.3.fc44.ppc64le" is already installed. Package "hostname-3.25-3.fc43.ppc64le" is already installed. Package "make-1:4.4.1-11.fc43.ppc64le" is already installed. Package "perl-Clone-0.47-4.fc43.ppc64le" is already installed. Package "perl-Data-Dumper-2.191-521.fc43.ppc64le" is already installed. Package "perl-FindBin-1.54-520.fc43.noarch" is already installed. Package "perl-Getopt-Long-1:2.58-520.fc43.noarch" is already installed. Package "perl-Test-Deep-1.205-2.fc43.noarch" is already installed. Package "perl-lib-0.65-520.fc43.ppc64le" is already installed. Package "perl-interpreter-4:5.42.0-520.fc43.ppc64le" is already installed. Package "python3-3.14.2-1.fc44.ppc64le" is already installed. Package "tbb-devel-2022.3.0-1.fc44.ppc64le" is already installed. Package "zlib-ng-compat-devel-2.3.2-2.fc44.ppc64le" is already installed. Finish: build setup for bowtie-1.3.1-8.fc44.src.rpm Start: rpmbuild bowtie-1.3.1-8.fc44.src.rpm Building target platforms: ppc64le Building for target ppc64le setting SOURCE_DATE_EPOCH=1753228800 Executing(%mkbuilddir): /bin/sh -e /var/tmp/rpm-tmp.BWel8I Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.OdhL08 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd /builddir/build/BUILD/bowtie-1.3.1-build + rm -rf bowtie-1.3.1-src + /usr/lib/rpm/rpmuncompress -x /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-inspect + RPM_EC=0 ++ jobs -p + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.rtqW95 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + export POPCNT_CAPABILITY=0 + POPCNT_CAPABILITY=0 ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CFLAGS ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CXXFLAGS + /usr/bin/make -O -j5 V=1 VERBOSE=1 allall EXTRA_FLAGS=-g g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_inspect.cpp:7: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from bowtie_inspect.cpp:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_build.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from ebwt_build.cpp:10: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt_search_backtrack.h:8, from ebwt.h:1525: ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::hhCheckTop(uint32_t, uint32_t, uint32_t, const EList&, uint64_t)’: ebwt_search_backtrack.h:1245:52: warning: variable ‘hiHalfMms’ set but not used [-Wunused-but-set-variable=] 1245 | int loHalfMms = 0, hiHalfMms = 0; | ^~~~~~~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::sanityCheckEligibility(uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, TIndexOffU*, uint8_t*)’: ebwt_search_backtrack.h:1675:26: warning: variable ‘eligiblesVisited’ set but not used [-Wunused-but-set-variable=] 1675 | uint32_t eligiblesVisited = 0; | ^~~~~~~~~~~~~~~~ ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In member function ‘void Ebwt::checkOrigs(const EList >&, bool) const’: ebwt.h:2791:20: warning: variable ‘restOff’ set but not used [-Wunused-but-set-variable=] 2791 | TIndexOffU restOff = 0; | ^~~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h:3882:20: warning: variable ‘seqsRead’ set but not used [-Wunused-but-set-variable=] 3882 | TIndexOffU seqsRead = 0; | ^~~~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h:3882:20: warning: variable ‘seqsRead’ set but not used [-Wunused-but-set-variable=] 3882 | TIndexOffU seqsRead = 0; | ^~~~~~~~ In file included from blockwise_sa.h:17, from ebwt.h:25: diff_sample.h: In instantiation of ‘EList getDeltaMap(T, const EList&) [with T = unsigned int]’: required from ‘DifferenceCoverSample::DifferenceCoverSample(const TStr&, uint32_t, bool, bool, std::ostream&) [with TStr = SString; uint32_t = unsigned int; std::ostream = std::basic_ostream]’ diff_sample.h:534:20: 534 | _dmap(getDeltaMap(_v, _ds)), | ~~~~~~~~~~~^~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:378:10: 378 | _dc = new TDC(this->text(), _dcV, this->verbose(), this->sanityCheck()); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:464:16: warning: variable ‘amapEnts’ set but not used [-Wunused-but-set-variable=] 464 | size_t amapEnts = 1; | ^~~~~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::buildSPrime(EList&, size_t) [with TStr = SString; size_t = long unsigned int]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = SString]’ diff_sample.h:839:2: 839 | buildSPrime(sPrime, padding); | ^~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:738:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 738 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::doBuiltSanityCheck() const [with TStr = SString]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = SString]’ diff_sample.h:994:26: 994 | if(this->sanityCheck()) doBuiltSanityCheck(); | ^~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:669:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 669 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::buildSPrime(EList&, size_t) [with TStr = S2bDnaString; size_t = long unsigned int]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = S2bDnaString]’ diff_sample.h:839:2: 839 | buildSPrime(sPrime, padding); | ^~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = S2bDnaString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = S2bDnaString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:738:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 738 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::doBuiltSanityCheck() const [with TStr = S2bDnaString]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = S2bDnaString]’ diff_sample.h:994:26: 994 | if(this->sanityCheck()) doBuiltSanityCheck(); | ^~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = S2bDnaString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = S2bDnaString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:669:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 669 | TIndexOffU added = 0; | ^~~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ In file included from diff_sample.h:14: multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_build_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_build.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from ebwt_build.cpp:10: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt_search_backtrack.h:8, from ebwt.h:1525: ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::hhCheckTop(uint32_t, uint32_t, uint32_t, const EList&, uint64_t)’: ebwt_search_backtrack.h:1245:52: warning: variable ‘hiHalfMms’ set but not used [-Wunused-but-set-variable=] 1245 | int loHalfMms = 0, hiHalfMms = 0; | ^~~~~~~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::sanityCheckEligibility(uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, TIndexOffU*, uint8_t*)’: ebwt_search_backtrack.h:1674:26: warning: variable ‘cumSz’ set but not used [-Wunused-but-set-variable=] 1674 | uint32_t cumSz = 0; | ^~~~~ ebwt_search_backtrack.h:1675:26: warning: variable ‘eligiblesVisited’ set but not used [-Wunused-but-set-variable=] 1675 | uint32_t eligiblesVisited = 0; | ^~~~~~~~~~~~~~~~ ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In member function ‘void Ebwt::checkOrigs(const EList >&, bool) const’: ebwt.h:2791:20: warning: variable ‘restOff’ set but not used [-Wunused-but-set-variable=] 2791 | TIndexOffU restOff = 0; | ^~~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h:3882:20: warning: variable ‘seqsRead’ set but not used [-Wunused-but-set-variable=] 3882 | TIndexOffU seqsRead = 0; | ^~~~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h:3882:20: warning: variable ‘seqsRead’ set but not used [-Wunused-but-set-variable=] 3882 | TIndexOffU seqsRead = 0; | ^~~~~~~~ In file included from blockwise_sa.h:17, from ebwt.h:25: diff_sample.h: In instantiation of ‘EList getDeltaMap(T, const EList&) [with T = unsigned int]’: required from ‘DifferenceCoverSample::DifferenceCoverSample(const TStr&, uint32_t, bool, bool, std::ostream&) [with TStr = SString; uint32_t = unsigned int; std::ostream = std::basic_ostream]’ diff_sample.h:534:20: 534 | _dmap(getDeltaMap(_v, _ds)), | ~~~~~~~~~~~^~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:378:10: 378 | _dc = new TDC(this->text(), _dcV, this->verbose(), this->sanityCheck()); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:464:16: warning: variable ‘amapEnts’ set but not used [-Wunused-but-set-variable=] 464 | size_t amapEnts = 1; | ^~~~~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::buildSPrime(EList&, size_t) [with TStr = SString; size_t = long unsigned int]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = SString]’ diff_sample.h:839:2: 839 | buildSPrime(sPrime, padding); | ^~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:738:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 738 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::doBuiltSanityCheck() const [with TStr = SString]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = SString]’ diff_sample.h:994:26: 994 | if(this->sanityCheck()) doBuiltSanityCheck(); | ^~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:669:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 669 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::buildSPrime(EList&, size_t) [with TStr = S2bDnaString; size_t = long unsigned int]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = S2bDnaString]’ diff_sample.h:839:2: 839 | buildSPrime(sPrime, padding); | ^~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = S2bDnaString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = S2bDnaString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = S2bDnaString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:738:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 738 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::doBuiltSanityCheck() const [with TStr = S2bDnaString]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = S2bDnaString]’ diff_sample.h:994:26: 994 | if(this->sanityCheck()) doBuiltSanityCheck(); | ^~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = S2bDnaString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = S2bDnaString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = S2bDnaString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:669:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 669 | TIndexOffU added = 0; | ^~~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ In file included from diff_sample.h:14: multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_build_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_inspect.cpp:7: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from bowtie_inspect.cpp:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from aligner.h:17, from ebwt_search.cpp:17: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from aligner.h:18: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt_search_backtrack.h:8, from ebwt.h:1525: ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::hhCheckTop(uint32_t, uint32_t, uint32_t, const EList&, uint64_t)’: ebwt_search_backtrack.h:1245:52: warning: variable ‘hiHalfMms’ set but not used [-Wunused-but-set-variable=] 1245 | int loHalfMms = 0, hiHalfMms = 0; | ^~~~~~~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::sanityCheckEligibility(uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, TIndexOffU*, uint8_t*)’: ebwt_search_backtrack.h:1675:26: warning: variable ‘eligiblesVisited’ set but not used [-Wunused-but-set-variable=] 1675 | uint32_t eligiblesVisited = 0; | ^~~~~~~~~~~~~~~~ ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In member function ‘void Ebwt::checkOrigs(const EList >&, bool) const’: ebwt.h:2791:20: warning: variable ‘restOff’ set but not used [-Wunused-but-set-variable=] 2791 | TIndexOffU restOff = 0; | ^~~~~~~ ebwt_search.cpp: In function ‘void exactSearch(PatternComposer&, HitSink&, Ebwt&, EList >&)’: ebwt_search.cpp:1426:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1426 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void mismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:1807:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1807 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void twoOrThreeMismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&, bool)’: ebwt_search.cpp:2303:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2303 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void seededQualCutoffSearchFull(int, int, int, PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:2849:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2849 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from pat.h:17, from pat.cpp:10: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ pat.cpp: In member function ‘virtual std::pair SoloPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:148:33: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 148 | cur_++; | ^~~~ pat.cpp: In member function ‘virtual std::pair DualPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:176:52: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 176 | if(cur + 1 > cur_) cur_++; | ^~~~ pat.cpp:205:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 205 | cur_++; | ^~~~ ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_search_util.h:8, from ebwt_search_util.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt_search_util.h:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from log.h:5, from log.cpp:5: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit_set.cpp:11: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from bitset.h:10, from hit.h:15, from sam.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from hit.cpp:2: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from aligner.h:17, from ebwt_search.cpp:17: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from aligner.h:18: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt_search_backtrack.h:8, from ebwt.h:1525: ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::hhCheckTop(uint32_t, uint32_t, uint32_t, const EList&, uint64_t)’: ebwt_search_backtrack.h:1245:52: warning: variable ‘hiHalfMms’ set but not used [-Wunused-but-set-variable=] 1245 | int loHalfMms = 0, hiHalfMms = 0; | ^~~~~~~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::sanityCheckEligibility(uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, TIndexOffU*, uint8_t*)’: ebwt_search_backtrack.h:1674:26: warning: variable ‘cumSz’ set but not used [-Wunused-but-set-variable=] 1674 | uint32_t cumSz = 0; | ^~~~~ ebwt_search_backtrack.h:1675:26: warning: variable ‘eligiblesVisited’ set but not used [-Wunused-but-set-variable=] 1675 | uint32_t eligiblesVisited = 0; | ^~~~~~~~~~~~~~~~ ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In member function ‘void Ebwt::checkOrigs(const EList >&, bool) const’: ebwt.h:2791:20: warning: variable ‘restOff’ set but not used [-Wunused-but-set-variable=] 2791 | TIndexOffU restOff = 0; | ^~~~~~~ ebwt_search.cpp: In function ‘void exactSearch(PatternComposer&, HitSink&, Ebwt&, EList >&)’: ebwt_search.cpp:1426:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1426 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void mismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:1807:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1807 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void twoOrThreeMismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&, bool)’: ebwt_search.cpp:2303:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2303 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void seededQualCutoffSearchFull(int, int, int, PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:2849:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2849 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from pat.h:17, from pat.cpp:10: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ pat.cpp: In member function ‘virtual std::pair SoloPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:148:33: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 148 | cur_++; | ^~~~ pat.cpp: In member function ‘virtual std::pair DualPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:176:52: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 176 | if(cur + 1 > cur_) cur_++; | ^~~~ pat.cpp:205:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 205 | cur_++; | ^~~~ ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_search_util.h:8, from ebwt_search_util.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt_search_util.h:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from log.h:5, from log.cpp:5: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit_set.cpp:11: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from bitset.h:10, from hit.h:15, from sam.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from hit.cpp:2: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_inspect.cpp:7: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from bowtie_inspect.cpp:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_build.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from ebwt_build.cpp:10: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ In file included from blockwise_sa.h:17, from ebwt.h:25: diff_sample.h: In instantiation of ‘EList getDeltaMap(T, const EList&) [with T = unsigned int]’: required from ‘DifferenceCoverSample::DifferenceCoverSample(const TStr&, uint32_t, bool, bool, std::ostream&) [with TStr = SString; uint32_t = unsigned int; std::ostream = std::basic_ostream]’ diff_sample.h:534:20: 534 | _dmap(getDeltaMap(_v, _ds)), | ~~~~~~~~~~~^~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:378:10: 378 | _dc = new TDC(this->text(), _dcV, this->verbose(), this->sanityCheck()); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:464:16: warning: variable ‘amapEnts’ set but not used [-Wunused-but-set-variable=] 464 | size_t amapEnts = 1; | ^~~~~~~~ In file included from ebwt.h:31: ref_read.h: In function ‘fastaRefReadAppend(FileBuf&, bool, S2bDnaString&, unsigned int&, RefReadInParams&, std::__cxx11::basic_string, std::allocator >*)RefRecord’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t[]’ [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ In file included from ebwt.h:21: alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ ref_read.h: In function ‘fastaRefReadAppend >(FileBuf&, bool, SString&, unsigned int&, RefReadInParams&, std::__cxx11::basic_string, std::allocator >*)RefRecord’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t[]’ [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_build_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_build.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from ebwt_build.cpp:10: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ In file included from blockwise_sa.h:17, from ebwt.h:25: diff_sample.h: In instantiation of ‘EList getDeltaMap(T, const EList&) [with T = unsigned int]’: required from ‘DifferenceCoverSample::DifferenceCoverSample(const TStr&, uint32_t, bool, bool, std::ostream&) [with TStr = SString; uint32_t = unsigned int; std::ostream = std::basic_ostream]’ diff_sample.h:534:20: 534 | _dmap(getDeltaMap(_v, _ds)), | ~~~~~~~~~~~^~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:378:10: 378 | _dc = new TDC(this->text(), _dcV, this->verbose(), this->sanityCheck()); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:464:16: warning: variable ‘amapEnts’ set but not used [-Wunused-but-set-variable=] 464 | size_t amapEnts = 1; | ^~~~~~~~ In file included from ebwt.h:31: ref_read.h: In function ‘fastaRefReadAppend(FileBuf&, bool, S2bDnaString&, unsigned long&, RefReadInParams&, std::__cxx11::basic_string, std::allocator >*)RefRecord’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t[]’ [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ In file included from ebwt.h:21: alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ ref_read.h: In function ‘fastaRefReadAppend >(FileBuf&, bool, SString&, unsigned long&, RefReadInParams&, std::__cxx11::basic_string, std::allocator >*)RefRecord’: ref_read.h:239:46: warning: array subscript -1 is below array bounds of ‘uint8_t[]’ [-Warray-bounds=] 239 | if(rparms.nsToAs && dna4Cat[c] == 2) c = 'A'; | ~~~~~~~~~^ alphabet.h:140:16: note: while referencing ‘dna4Cat’ 140 | extern uint8_t dna4Cat[]; | ^~~~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_build_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_inspect.cpp:7: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from bowtie_inspect.cpp:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from aligner.h:17, from ebwt_search.cpp:17: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from aligner.h:18: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt_search.cpp: In function ‘void exactSearch(PatternComposer&, HitSink&, Ebwt&, EList >&)’: ebwt_search.cpp:1426:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1426 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void mismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:1807:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1807 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void twoOrThreeMismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&, bool)’: ebwt_search.cpp:2303:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2303 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void seededQualCutoffSearchFull(int, int, int, PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:2849:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2849 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from pat.h:17, from pat.cpp:10: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ pat.cpp: In member function ‘virtual std::pair SoloPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:148:33: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 148 | cur_++; | ^~~~ pat.cpp: In member function ‘virtual std::pair DualPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:176:52: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 176 | if(cur + 1 > cur_) cur_++; | ^~~~ pat.cpp:205:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 205 | cur_++; | ^~~~ ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_search_util.h:8, from ebwt_search_util.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt_search_util.h:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from log.h:5, from log.cpp:5: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit_set.cpp:11: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from bitset.h:10, from hit.h:15, from sam.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from hit.cpp:2: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from aligner.h:17, from ebwt_search.cpp:17: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from aligner.h:18: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt_search.cpp: In function ‘void exactSearch(PatternComposer&, HitSink&, Ebwt&, EList >&)’: ebwt_search.cpp:1426:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1426 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void mismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:1807:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1807 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void twoOrThreeMismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&, bool)’: ebwt_search.cpp:2303:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2303 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void seededQualCutoffSearchFull(int, int, int, PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:2849:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2849 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from pat.h:17, from pat.cpp:10: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ pat.cpp: In member function ‘virtual std::pair SoloPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:148:33: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 148 | cur_++; | ^~~~ pat.cpp: In member function ‘virtual std::pair DualPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:176:52: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 176 | if(cur + 1 > cur_) cur_++; | ^~~~ pat.cpp:205:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 205 | cur_++; | ^~~~ ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_search_util.h:8, from ebwt_search_util.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt_search_util.h:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from log.h:5, from log.cpp:5: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit_set.cpp:11: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from bitset.h:10, from hit.h:15, from sam.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from hit.cpp:2: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here + RPM_EC=0 ++ jobs -p + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.hBSIZ8 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + '[' /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT '!=' / ']' + rm -rf /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT ++ dirname /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT + mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build + mkdir /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/bin ; \ done + mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie + cp -a reads /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + /usr/bin/find-debuginfo -j5 --strict-build-id -m -i --build-id-seed 1.3.1-8.fc44 --unique-debug-suffix -1.3.1-8.fc44.ppc64le --unique-debug-src-base bowtie-1.3.1-8.fc44.ppc64le --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 50000000 --remove-section .gnu.build.attributes -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src find-debuginfo: starting Extracting debug info from 12 files DWARF-compressing 12 files sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. Creating .debug symlinks for symlinks to ELF files Copying sources found by 'debugedit -l' to /usr/src/debug/bowtie-1.3.1-8.fc44.ppc64le find-debuginfo: done + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig + COMPRESS='gzip -9 -n' + COMPRESS_EXT=.gz + /usr/lib/rpm/brp-compress + /usr/lib/rpm/redhat/brp-strip-lto /usr/bin/strip + /usr/lib/rpm/check-rpaths + /usr/lib/rpm/redhat/brp-mangle-shebangs mangling shebang in /usr/share/bowtie/scripts/make_mm8.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg19.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/run-hbb.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/build_test.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg18.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm9.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_c_elegans.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/bowtie-hbb.sh from /bin/bash to #!/usr/bin/bash mangling shebang in /usr/share/bowtie/scripts/make_canFam2.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_a_thaliana_tair.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_m_musculus_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_b_taurus_UMD3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_s_cerevisiae.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_d_melanogaster.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_galGal3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi36.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_e_coli.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_rn4.sh from /bin/sh to #!/usr/bin/sh + /usr/lib/rpm/brp-remove-la-files + /usr/lib/rpm/redhat/brp-python-rpm-in-distinfo + env /usr/lib/rpm/redhat/brp-python-bytecompile '' 1 0 -j5 + /usr/lib/rpm/redhat/brp-python-hardlink + /usr/bin/add-det --brp -j5 /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT Scanned 17 directories and 167 files, processed 0 inodes, 0 modified (0 replaced + 0 rewritten), 0 unsupported format, 0 errors + /usr/bin/linkdupes --brp /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr Scanned 16 directories and 167 files, considered 167 files, read 4 files, linked 0 files, 0 errors sum of sizes of linked files: 0 bytes Reading /builddir/build/BUILD/bowtie-1.3.1-build/SPECPARTS/rpm-debuginfo.specpart Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.0HfvOy + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -mcpu=power8 -mtune=power8 -fasynchronous-unwind-tables -fstack-clash-protection -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl scripts/test/cs_dec.pl scripts/test/random_bowtie_tests.sh scripts/test/btface.py scripts/test/long_read.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/random_bowtie_tests.pl scripts/test/args.pl scripts/test/DNA.pm scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/cs_trim.pl scripts/test/btdata.py scripts/test/build_big.py scripts/test/large_idx.py scripts/test/all.sh + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG 0.00%) Reported 1 paired-end alignments ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 PASSED + RPM_EC=0 ++ jobs -p + exit 0 Processing files: bowtie-1.3.1-8.fc44.ppc64le Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.FIxJgH + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + export LC_ALL=C.UTF-8 + LC_ALL=C.UTF-8 + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/MANUAL /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/NEWS /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/VERSION /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/AUTHORS /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/TUTORIAL /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/doc/manual.html /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/doc/style.css /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.5M1ipl + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + export LC_ALL=C.UTF-8 + LC_ALL=C.UTF-8 + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/LICENSE /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Provides: bowtie = 1.3.1-8.fc44 bowtie(ppc-64) = 1.3.1-8.fc44 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /usr/bin/bash /usr/bin/perl /usr/bin/python3 /usr/bin/sh libc.so.6()(64bit) libc.so.6(GLIBC_2.17)(64bit) libc.so.6(GLIBC_2.32)(64bit) libc.so.6(GLIBC_2.33)(64bit) libc.so.6(GLIBC_2.34)(64bit) libc.so.6(GLIBC_2.38)(64bit) libc.so.6(GLIBC_ABI_DT_RELR)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.3.1)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.17)(64bit) libm.so.6(GLIBC_2.27)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.15)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.26)(64bit) libstdc++.so.6(GLIBCXX_3.4.29)(64bit) libstdc++.so.6(GLIBCXX_3.4.30)(64bit) libstdc++.so.6(GLIBCXX_3.4.31)(64bit) libstdc++.so.6(GLIBCXX_3.4.32)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-8.fc44.ppc64le Provides: bowtie-debugsource = 1.3.1-8.fc44 bowtie-debugsource(ppc-64) = 1.3.1-8.fc44 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-8.fc44.ppc64le Provides: bowtie-debuginfo = 1.3.1-8.fc44 bowtie-debuginfo(ppc-64) = 1.3.1-8.fc44 debuginfo(build-id) = 09cbaf2906bc390f3bb9dd2616b948bc5bab5272 debuginfo(build-id) = 21afcd21b0cf176c247bdfa54141887ac1cf5391 debuginfo(build-id) = 340f75d2b54aea9891f77340925abd4f426d37bb debuginfo(build-id) = 40dffd43bb5451098f594d626d150cf81d04e5fc debuginfo(build-id) = 5f6d8df237db8335d299ef6a9fd23ef059c0e228 debuginfo(build-id) = 6e27b73b2331ea96dab997c4d9bb6337db6630c6 debuginfo(build-id) = 84cadbe2588dec7d20553b2fee8bc77485b57626 debuginfo(build-id) = 8bdd7980b914762d84b4f90c8f0181a8cb666743 debuginfo(build-id) = a8055c25f8b69857ab666395a884f40479492da0 debuginfo(build-id) = c2c3870450249b4510520e4d6c428e662af5d08f debuginfo(build-id) = de1c970875c2c941fce171dcb3edc54adb2ff510 debuginfo(build-id) = f0f38503feedb7db71b392955e844893dfe547d6 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(ppc-64) = 1.3.1-8.fc44 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-8.fc44.ppc64le.rpm Wrote: /builddir/build/RPMS/bowtie-1.3.1-8.fc44.ppc64le.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-8.fc44.ppc64le.rpm Executing(rmbuild): /bin/sh -e /var/tmp/rpm-tmp.V4LIfp + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + test -d /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w /builddir/build/BUILD/bowtie-1.3.1-build + rm -rf /builddir/build/BUILD/bowtie-1.3.1-build + RPM_EC=0 ++ jobs -p + exit 0 Finish: rpmbuild bowtie-1.3.1-8.fc44.src.rpm Finish: build phase for bowtie-1.3.1-8.fc44.src.rpm INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-ppc64le-1766674341.303132/root/var/log/dnf5.log INFO: chroot_scan: creating tarball /var/lib/copr-rpmbuild/results/chroot_scan.tar.gz /bin/tar: Removing leading `/' from member names INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-8.fc44.src.rpm) Config(child) 5 minutes 35 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool Package info: { "packages": [ { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "8.fc44", "arch": "ppc64le" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "8.fc44", "arch": "src" }, { "name": "bowtie-debugsource", "epoch": null, "version": "1.3.1", "release": "8.fc44", "arch": "ppc64le" }, { "name": "bowtie-debuginfo", "epoch": null, "version": "1.3.1", "release": "8.fc44", "arch": "ppc64le" } ] } RPMResults finished