Warning: Permanently added '52.87.238.89' (ED25519) to the list of known hosts. You can reproduce this build on your computer by running: sudo dnf install copr-rpmbuild /usr/bin/copr-rpmbuild --verbose --drop-resultdir --task-url https://copr.fedorainfracloud.org/backend/get-build-task/9942909-fedora-rawhide-x86_64 --chroot fedora-rawhide-x86_64 Version: 1.6 PID: 11920 Logging PID: 11922 Task: {'allow_user_ssh': False, 'appstream': False, 'background': True, 'build_id': 9942909, 'buildroot_pkgs': [], 'chroot': 'fedora-rawhide-x86_64', 'enable_net': False, 'fedora_review': False, 'git_hash': 'bb30ca8b07fd437a5eccbde201db2ee5f9e02c0e', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/siddhesh/mbp-gcc-16/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-8', 'project_dirname': 'mbp-gcc-16', 'project_name': 'mbp-gcc-16', 'project_owner': 'siddhesh', 'repo_priority': None, 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/siddhesh/mbp-gcc-16/fedora-rawhide-x86_64/', 'id': 'copr_base', 'name': 'Copr repository', 'priority': None}, {'baseurl': 'https://kojipkgs.fedoraproject.org/repos/f44-build-side-124978/latest/$basearch/', 'id': 'https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch', 'name': 'Additional repo https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch'}], 'sandbox': 'siddhesh/mbp-gcc-16--siddhesh', 'source_json': {}, 'source_type': None, 'ssh_public_keys': None, 'storage': 0, 'submitter': 'siddhesh', 'tags': [], 'task_id': '9942909-fedora-rawhide-x86_64', 'timeout': 115200, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/siddhesh/mbp-gcc-16/bowtie /var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/siddhesh/mbp-gcc-16/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie'... Running: git checkout bb30ca8b07fd437a5eccbde201db2ee5f9e02c0e -- cmd: ['git', 'checkout', 'bb30ca8b07fd437a5eccbde201db2ee5f9e02c0e', '--'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie rc: 0 stdout: stderr: Note: switching to 'bb30ca8b07fd437a5eccbde201db2ee5f9e02c0e'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at bb30ca8 automatic import of bowtie Running: dist-git-client sources cmd: ['dist-git-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip INFO: Reading stdout from command: curl --help all INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/siddhesh/mbp-gcc-16/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 7293k 100 7293k 0 0 211M 0 --:--:-- --:--:-- --:--:-- 215M INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-tests.tgz --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/siddhesh/mbp-gcc-16/bowtie/bowtie-1.3.1-tests.tgz/md5/efa4aeb774a0cd0255fe3f24caf64187/bowtie-1.3.1-tests.tgz % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 34134 100 34134 0 0 2799k 0 --:--:-- --:--:-- --:--:-- 3030k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz tail: /var/lib/copr-rpmbuild/main.log: file truncated Running (timeout=115200): unbuffer mock --spec /var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1766684798.158760 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 6.6 starting (python version = 3.13.7, NVR = mock-6.6-1.fc42), args: /usr/libexec/mock/mock --spec /var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1766684798.158760 -r /var/lib/copr-rpmbuild/results/configs/child.cfg Start(bootstrap): init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish(bootstrap): init plugins Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie/bowtie.spec) Config(fedora-rawhide-x86_64) Start: clean chroot Finish: clean chroot Mock Version: 6.6 INFO: Mock Version: 6.6 Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1766684798.158760/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata INFO: Guessed host environment type: unknown INFO: Using container image: registry.fedoraproject.org/fedora:rawhide INFO: Pulling image: registry.fedoraproject.org/fedora:rawhide INFO: Tagging container image as mock-bootstrap-3478f005-a344-45a8-a701-050c1787910a INFO: Checking that 22510d11cafbb8432e42074df9740f12f5d1ae024d1691e1e840a8a03ad9bb5a image matches host's architecture INFO: Copy content of container 22510d11cafbb8432e42074df9740f12f5d1ae024d1691e1e840a8a03ad9bb5a to /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1766684798.158760/root INFO: mounting 22510d11cafbb8432e42074df9740f12f5d1ae024d1691e1e840a8a03ad9bb5a with podman image mount INFO: image 22510d11cafbb8432e42074df9740f12f5d1ae024d1691e1e840a8a03ad9bb5a as /var/lib/containers/storage/overlay/4f59a40c897e1d5a3dc64832ecfad2706b8a96f39c21590f52d7f3ae0b9d8806/merged INFO: umounting image 22510d11cafbb8432e42074df9740f12f5d1ae024d1691e1e840a8a03ad9bb5a (/var/lib/containers/storage/overlay/4f59a40c897e1d5a3dc64832ecfad2706b8a96f39c21590f52d7f3ae0b9d8806/merged) with podman image umount INFO: Removing image mock-bootstrap-3478f005-a344-45a8-a701-050c1787910a INFO: Package manager dnf5 detected and used (fallback) INFO: Not updating bootstrap chroot, bootstrap_image_ready=True Start(bootstrap): creating root cache Finish(bootstrap): creating root cache Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-1766684798.158760/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Package manager dnf5 detected and used (direct choice) INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-6.0.1-1.fc44.x86_64 rpm-sequoia-1.10.0-1.fc44.x86_64 dnf5-5.3.0.0-3.fc44.x86_64 dnf5-plugins-5.3.0.0-3.fc44.x86_64 Start: installing minimal buildroot with dnf5 Updating and loading repositories: Copr repository 100% | 12.1 MiB/s | 876.8 KiB | 00m00s fedora 100% | 24.8 MiB/s | 22.4 MiB | 00m01s Additional repo https_kojipkgs_fedorap 100% | 13.2 MiB/s | 14.4 MiB | 00m01s Repositories loaded. Package Arch Version Repository Size Installing group/module packages: bash x86_64 0:5.3.0-2.fc44 copr_base 8.5 MiB bzip2 x86_64 0:1.0.8-21.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 95.3 KiB coreutils x86_64 0:9.9-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 5.4 MiB cpio x86_64 0:2.15-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.1 MiB diffutils x86_64 0:3.12-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.6 MiB fedora-release-common noarch 0:44-0.10 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 20.6 KiB findutils x86_64 1:4.10.0-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.8 MiB gawk x86_64 0:5.3.2-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.8 MiB glibc-minimal-langpack x86_64 0:2.42.9000-17.fc44 fedora 0.0 B grep x86_64 0:3.12-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.0 MiB gzip x86_64 0:1.14-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 397.8 KiB info x86_64 0:7.2-7.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 357.9 KiB patch x86_64 0:2.8-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 226.6 KiB redhat-rpm-config noarch 0:343-19.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 183.6 KiB rpm-build x86_64 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 287.5 KiB sed x86_64 0:4.9-6.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 857.3 KiB shadow-utils x86_64 2:4.18.0-7.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.9 MiB tar x86_64 2:1.35-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.9 MiB unzip x86_64 0:6.0-68.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 390.3 KiB util-linux x86_64 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.5 MiB which x86_64 0:2.23-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 83.5 KiB xz x86_64 1:5.8.1-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.3 MiB Installing dependencies: R-srpm-macros noarch 0:1.3.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.2 KiB add-determinism x86_64 0:0.7.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.3 MiB alternatives x86_64 0:1.33-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 62.2 KiB ansible-srpm-macros noarch 0:1-18.1.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 35.7 KiB audit-libs x86_64 0:4.1.2-2.fc44 copr_base 390.5 KiB binutils x86_64 0:2.45.50-12.fc44 copr_base 27.4 MiB build-reproducibility-srpm-macros noarch 0:0.7.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 KiB bzip2-libs x86_64 0:1.0.8-21.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 80.6 KiB ca-certificates noarch 0:2025.2.80_v9.0.304-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.7 MiB cmake-srpm-macros noarch 0:3.31.10-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 524.0 B coreutils-common x86_64 0:9.9-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 11.2 MiB crypto-policies noarch 0:20251128-1.git19878fe.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 132.6 KiB curl x86_64 0:8.18.0~rc2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 471.5 KiB cyrus-sasl-lib x86_64 0:2.1.28-33.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.3 MiB debugedit x86_64 0:5.2-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 214.0 KiB dwz x86_64 0:0.16-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 287.1 KiB ed x86_64 0:1.22.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 148.9 KiB efi-srpm-macros noarch 0:6-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 40.2 KiB elfutils x86_64 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.9 MiB elfutils-debuginfod-client x86_64 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 84.0 KiB elfutils-default-yama-scope noarch 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.8 KiB elfutils-libelf x86_64 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.1 MiB elfutils-libs x86_64 0:0.194-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 687.5 KiB fedora-gpg-keys noarch 0:44-0.1 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 131.2 KiB fedora-release noarch 0:44-0.10 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 0.0 B fedora-release-identity-basic noarch 0:44-0.10 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 664.0 B fedora-repos noarch 0:44-0.1 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.9 KiB fedora-repos-rawhide noarch 0:44-0.1 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.2 KiB file x86_64 0:5.46-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 100.2 KiB file-libs x86_64 0:5.46-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 11.9 MiB filesystem x86_64 0:3.18-50.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 112.0 B filesystem-srpm-macros noarch 0:3.18-50.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 38.2 KiB fonts-srpm-macros noarch 1:5.0.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 55.8 KiB forge-srpm-macros noarch 0:0.4.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 38.9 KiB fpc-srpm-macros noarch 0:1.3-15.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 144.0 B gap-srpm-macros noarch 0:2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.1 KiB gdb-minimal x86_64 0:16.3-6.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 13.3 MiB gdbm-libs x86_64 1:1.23-10.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 129.9 KiB ghc-srpm-macros noarch 0:1.9.2-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 779.0 B glibc x86_64 0:2.42.9000-17.fc44 fedora 6.8 MiB glibc-common x86_64 0:2.42.9000-17.fc44 fedora 1.0 MiB glibc-gconv-extra x86_64 0:2.42.9000-17.fc44 fedora 7.2 MiB gmp x86_64 1:6.3.0-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 815.3 KiB gnat-srpm-macros noarch 0:6-8.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.0 KiB gnulib-l10n noarch 0:20241231-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 655.0 KiB gnupg2 x86_64 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.5 MiB gnupg2-dirmngr x86_64 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 618.4 KiB gnupg2-gpg-agent x86_64 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 671.4 KiB gnupg2-gpgconf x86_64 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 250.0 KiB gnupg2-keyboxd x86_64 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 201.4 KiB gnupg2-verify x86_64 0:2.4.8-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 348.5 KiB gnutls x86_64 0:3.8.11-6.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.6 MiB go-srpm-macros noarch 0:3.8.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 61.9 KiB gpgverify noarch 0:2.2-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.7 KiB ima-evm-utils-libs x86_64 0:1.6.2-7.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 60.7 KiB jansson x86_64 0:2.14-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 89.1 KiB java-srpm-macros noarch 0:1-7.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 870.0 B json-c x86_64 0:0.18-7.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 82.7 KiB kernel-srpm-macros noarch 0:1.0-27.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 KiB keyutils-libs x86_64 0:1.6.3-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 54.3 KiB krb5-libs x86_64 0:1.21.3-10.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.3 MiB libacl x86_64 0:2.3.2-4.fc44 copr_base 35.8 KiB libarchive x86_64 0:3.8.4-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 955.3 KiB libassuan x86_64 0:2.5.7-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 163.8 KiB libatomic x86_64 0:16.0.0-0.3.fc44 copr_base 36.7 KiB libattr x86_64 0:2.5.2-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 24.4 KiB libblkid x86_64 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 262.3 KiB libbrotli x86_64 0:1.2.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 865.4 KiB libcap x86_64 0:2.77-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 209.1 KiB libcap-ng x86_64 0:0.8.5-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 68.9 KiB libcom_err x86_64 0:1.47.3-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 63.1 KiB libcurl x86_64 0:8.18.0~rc2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 984.7 KiB libeconf x86_64 0:0.7.9-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 64.9 KiB libevent x86_64 0:2.1.12-16.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 883.1 KiB libfdisk x86_64 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 380.3 KiB libffi x86_64 0:3.5.2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 83.8 KiB libfsverity x86_64 0:1.6-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 28.5 KiB libgcc x86_64 0:16.0.0-0.3.fc44 copr_base 270.7 KiB libgcrypt x86_64 0:1.11.2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.6 MiB libgomp x86_64 0:16.0.0-0.3.fc44 copr_base 570.9 KiB libgpg-error x86_64 0:1.58-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 941.6 KiB libidn2 x86_64 0:2.3.8-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 552.5 KiB libksba x86_64 0:1.6.7-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 398.5 KiB liblastlog2 x86_64 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 33.6 KiB libmount x86_64 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 372.6 KiB libnghttp2 x86_64 0:1.68.0-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 162.2 KiB libnghttp3 x86_64 0:1.14.0-1.fc44 fedora 155.2 KiB libpkgconf x86_64 0:2.3.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 78.1 KiB libpsl x86_64 0:0.21.5-6.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 76.4 KiB libselinux x86_64 0:3.9-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 193.1 KiB libselinux-utils x86_64 0:3.9-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 309.0 KiB libsemanage x86_64 0:3.9-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 308.5 KiB libsepol x86_64 0:3.9-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 822.0 KiB libsmartcols x86_64 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 180.3 KiB libssh x86_64 0:0.11.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 567.1 KiB libssh-config noarch 0:0.11.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 277.0 B libstdc++ x86_64 0:16.0.0-0.3.fc44 copr_base 2.9 MiB libtasn1 x86_64 0:4.20.0-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 176.3 KiB libtool-ltdl x86_64 0:2.5.4-9.fc44 copr_base 70.0 KiB libunistring x86_64 0:1.1-10.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.7 MiB libusb1 x86_64 0:1.0.29-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 171.3 KiB libuuid x86_64 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 37.2 KiB libverto x86_64 0:0.3.2-11.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 25.4 KiB libxcrypt x86_64 0:4.5.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 285.3 KiB libxml2 x86_64 0:2.12.10-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.7 MiB libzstd x86_64 0:1.5.7-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 940.3 KiB linkdupes x86_64 0:0.7.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 838.7 KiB lua-libs x86_64 0:5.4.8-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 281.9 KiB lua-srpm-macros noarch 0:1-16.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.3 KiB lz4-libs x86_64 0:1.10.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 161.4 KiB mpfr x86_64 0:4.2.2-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 832.8 KiB ncurses-base noarch 0:6.5-8.20250614.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 328.1 KiB ncurses-libs x86_64 0:6.5-8.20250614.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 946.4 KiB nettle x86_64 0:3.10.1-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 790.6 KiB ngtcp2 x86_64 0:1.18.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 314.3 KiB ngtcp2-crypto-ossl x86_64 0:1.18.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 51.7 KiB npth x86_64 0:1.8-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 49.6 KiB ocaml-srpm-macros noarch 0:11-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 KiB openblas-srpm-macros noarch 0:2-20.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 112.0 B openldap x86_64 0:2.6.10-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 659.8 KiB openssl-libs x86_64 1:3.5.4-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.9 MiB p11-kit x86_64 0:0.25.8-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.3 MiB p11-kit-trust x86_64 0:0.25.8-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 446.5 KiB package-notes-srpm-macros noarch 0:0.5-14.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.6 KiB pam-libs x86_64 0:1.7.1-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 126.8 KiB pcre2 x86_64 0:10.47-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 702.6 KiB pcre2-syntax noarch 0:10.47-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 281.9 KiB perl-srpm-macros noarch 0:1-60.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 861.0 B pkgconf x86_64 0:2.3.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 88.5 KiB pkgconf-m4 noarch 0:2.3.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 14.4 KiB pkgconf-pkg-config x86_64 0:2.3.0-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 989.0 B policycoreutils x86_64 0:3.9-5.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 683.5 KiB popt x86_64 0:1.19-9.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 132.8 KiB publicsuffix-list-dafsa noarch 0:20250616-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 69.1 KiB pyproject-srpm-macros noarch 0:1.18.6-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.9 KiB python-srpm-macros noarch 0:3.14-9.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 51.6 KiB qt5-srpm-macros noarch 0:5.15.18-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 500.0 B qt6-srpm-macros noarch 0:6.10.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 464.0 B readline x86_64 0:8.3-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 511.7 KiB rpm x86_64 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.1 MiB rpm-build-libs x86_64 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 264.4 KiB rpm-libs x86_64 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 933.8 KiB rpm-plugin-selinux x86_64 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 12.0 KiB rpm-sequoia x86_64 0:1.10.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.5 MiB rpm-sign-libs x86_64 0:6.0.1-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 39.7 KiB rust-srpm-macros noarch 0:28.4-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 5.5 KiB selinux-policy noarch 0:42.19-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 32.0 KiB selinux-policy-targeted noarch 0:42.19-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 18.7 MiB setup noarch 0:2.15.0-27.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 724.9 KiB sqlite-libs x86_64 0:3.51.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.5 MiB systemd-libs x86_64 0:259-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.3 MiB systemd-standalone-sysusers x86_64 0:259-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 293.5 KiB tpm2-tss x86_64 0:4.1.3-8.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.6 MiB tree-sitter-srpm-macros noarch 0:0.4.2-1.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.3 KiB util-linux-core x86_64 0:2.41.3-8.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.5 MiB xxhash-libs x86_64 0:0.8.3-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 90.2 KiB xz-libs x86_64 1:5.8.1-4.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 217.8 KiB zig-srpm-macros noarch 0:1-5.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.1 KiB zip x86_64 0:3.0-44.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 694.5 KiB zlib-ng-compat x86_64 0:2.3.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 161.5 KiB zstd x86_64 0:1.5.7-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 506.2 KiB Installing groups: Buildsystem building group Transaction Summary: Installing: 183 packages Total size of inbound packages is 66 MiB. Need to download 66 MiB. After this operation, 220 MiB extra will be used (install 220 MiB, remove 0 B). [ 1/183] bzip2-0:1.0.8-21.fc43.x86_64 100% | 782.2 KiB/s | 51.6 KiB | 00m00s [ 2/183] bash-0:5.3.0-2.fc44.x86_64 100% | 16.4 MiB/s | 1.9 MiB | 00m00s [ 3/183] cpio-0:2.15-6.fc43.x86_64 100% | 4.6 MiB/s | 286.6 KiB | 00m00s [ 4/183] fedora-release-common-0:44-0. 100% | 1.6 MiB/s | 24.7 KiB | 00m00s [ 5/183] diffutils-0:3.12-3.fc43.x86_6 100% | 3.8 MiB/s | 384.1 KiB | 00m00s [ 6/183] findutils-1:4.10.0-6.fc43.x86 100% | 7.2 MiB/s | 541.2 KiB | 00m00s [ 7/183] glibc-minimal-langpack-0:2.42 100% | 7.1 MiB/s | 72.9 KiB | 00m00s [ 8/183] coreutils-0:9.9-1.fc44.x86_64 100% | 4.6 MiB/s | 1.1 MiB | 00m00s [ 9/183] grep-0:3.12-2.fc43.x86_64 100% | 10.9 MiB/s | 289.1 KiB | 00m00s [ 10/183] gawk-0:5.3.2-2.fc43.x86_64 100% | 21.8 MiB/s | 1.1 MiB | 00m00s [ 11/183] gzip-0:1.14-1.fc44.x86_64 100% | 9.9 MiB/s | 171.6 KiB | 00m00s [ 12/183] info-0:7.2-7.fc44.x86_64 100% | 10.5 MiB/s | 182.9 KiB | 00m00s [ 13/183] patch-0:2.8-3.fc44.x86_64 100% | 7.4 MiB/s | 113.9 KiB | 00m00s [ 14/183] redhat-rpm-config-0:343-19.fc 100% | 4.5 MiB/s | 73.2 KiB | 00m00s [ 15/183] rpm-build-0:6.0.1-1.fc44.x86_ 100% | 8.5 MiB/s | 129.9 KiB | 00m00s [ 16/183] sed-0:4.9-6.fc44.x86_64 100% | 20.1 MiB/s | 308.7 KiB | 00m00s [ 17/183] unzip-0:6.0-68.fc44.x86_64 100% | 12.0 MiB/s | 184.6 KiB | 00m00s [ 18/183] tar-2:1.35-6.fc43.x86_64 100% | 21.8 MiB/s | 847.8 KiB | 00m00s [ 19/183] shadow-utils-2:4.18.0-7.fc44. 100% | 26.6 MiB/s | 1.2 MiB | 00m00s [ 20/183] which-0:2.23-3.fc43.x86_64 100% | 2.7 MiB/s | 41.7 KiB | 00m00s [ 21/183] util-linux-0:2.41.3-8.fc44.x8 100% | 38.2 MiB/s | 1.1 MiB | 00m00s [ 22/183] glibc-common-0:2.42.9000-17.f 100% | 50.3 MiB/s | 360.5 KiB | 00m00s [ 23/183] xz-1:5.8.1-4.fc44.x86_64 100% | 27.2 MiB/s | 557.0 KiB | 00m00s [ 24/183] glibc-0:2.42.9000-17.fc44.x86 100% | 121.9 MiB/s | 2.3 MiB | 00m00s [ 25/183] glibc-gconv-extra-0:2.42.9000 100% | 94.9 MiB/s | 1.6 MiB | 00m00s [ 26/183] xz-libs-1:5.8.1-4.fc44.x86_64 100% | 6.5 MiB/s | 112.8 KiB | 00m00s [ 27/183] audit-libs-0:4.1.2-2.fc44.x86 100% | 34.5 MiB/s | 141.4 KiB | 00m00s [ 28/183] libblkid-0:2.41.3-8.fc44.x86_ 100% | 7.1 MiB/s | 122.8 KiB | 00m00s [ 29/183] libcap-ng-0:0.8.5-8.fc44.x86_ 100% | 2.0 MiB/s | 32.2 KiB | 00m00s [ 30/183] filesystem-0:3.18-50.fc43.x86 100% | 32.9 MiB/s | 1.3 MiB | 00m00s [ 31/183] libfdisk-0:2.41.3-8.fc44.x86_ 100% | 8.8 MiB/s | 161.4 KiB | 00m00s [ 32/183] liblastlog2-0:2.41.3-8.fc44.x 100% | 1.3 MiB/s | 22.9 KiB | 00m00s [ 33/183] libmount-0:2.41.3-8.fc44.x86_ 100% | 9.3 MiB/s | 162.1 KiB | 00m00s [ 34/183] libselinux-0:3.9-5.fc44.x86_6 100% | 6.4 MiB/s | 97.8 KiB | 00m00s [ 35/183] libsmartcols-0:2.41.3-8.fc44. 100% | 5.1 MiB/s | 83.5 KiB | 00m00s [ 36/183] libuuid-0:2.41.3-8.fc44.x86_6 100% | 1.7 MiB/s | 25.8 KiB | 00m00s [ 37/183] pam-libs-0:1.7.1-3.fc43.x86_6 100% | 3.7 MiB/s | 57.5 KiB | 00m00s [ 38/183] ncurses-libs-0:6.5-8.20250614 100% | 18.1 MiB/s | 333.1 KiB | 00m00s [ 39/183] libgcc-0:16.0.0-0.3.fc44.x86_ 100% | 1.0 MiB/s | 111.4 KiB | 00m00s [ 40/183] readline-0:8.3-2.fc43.x86_64 100% | 13.7 MiB/s | 224.6 KiB | 00m00s [ 41/183] util-linux-core-0:2.41.3-8.fc 100% | 29.0 MiB/s | 534.4 KiB | 00m00s [ 42/183] systemd-libs-0:259-1.fc44.x86 100% | 38.2 MiB/s | 822.5 KiB | 00m00s [ 43/183] libacl-0:2.3.2-4.fc44.x86_64 100% | 12.2 MiB/s | 24.9 KiB | 00m00s [ 44/183] zlib-ng-compat-0:2.3.2-2.fc44 100% | 5.8 MiB/s | 88.9 KiB | 00m00s [ 45/183] bzip2-libs-0:1.0.8-21.fc43.x8 100% | 2.8 MiB/s | 43.1 KiB | 00m00s [ 46/183] libeconf-0:0.7.9-2.fc43.x86_6 100% | 2.0 MiB/s | 35.2 KiB | 00m00s [ 47/183] libsemanage-0:3.9-4.fc44.x86_ 100% | 8.0 MiB/s | 123.5 KiB | 00m00s [ 48/183] libxcrypt-0:4.5.2-2.fc44.x86_ 100% | 7.8 MiB/s | 128.2 KiB | 00m00s [ 49/183] setup-0:2.15.0-27.fc44.noarch 100% | 8.7 MiB/s | 151.3 KiB | 00m00s [ 50/183] debugedit-0:5.2-3.fc44.x86_64 100% | 6.0 MiB/s | 85.6 KiB | 00m00s [ 51/183] binutils-0:2.45.50-12.fc44.x8 100% | 140.4 MiB/s | 6.0 MiB | 00m00s [ 52/183] elfutils-0:0.194-2.fc44.x86_6 100% | 29.3 MiB/s | 569.4 KiB | 00m00s [ 53/183] elfutils-libelf-0:0.194-2.fc4 100% | 11.1 MiB/s | 204.7 KiB | 00m00s [ 54/183] file-0:5.46-8.fc44.x86_64 100% | 3.2 MiB/s | 48.8 KiB | 00m00s [ 55/183] pkgconf-pkg-config-0:2.3.0-3. 100% | 640.6 KiB/s | 9.6 KiB | 00m00s [ 56/183] libarchive-0:3.8.4-1.fc44.x86 100% | 19.7 MiB/s | 422.8 KiB | 00m00s [ 57/183] popt-0:1.19-9.fc43.x86_64 100% | 3.8 MiB/s | 59.1 KiB | 00m00s [ 58/183] rpm-0:6.0.1-1.fc44.x86_64 100% | 28.1 MiB/s | 546.6 KiB | 00m00s [ 59/183] rpm-build-libs-0:6.0.1-1.fc44 100% | 8.3 MiB/s | 126.9 KiB | 00m00s [ 60/183] rpm-libs-0:6.0.1-1.fc44.x86_6 100% | 20.6 MiB/s | 401.1 KiB | 00m00s [ 61/183] libstdc++-0:16.0.0-0.3.fc44.x 100% | 7.6 MiB/s | 933.0 KiB | 00m00s [ 62/183] zstd-0:1.5.7-3.fc44.x86_64 100% | 10.9 MiB/s | 189.5 KiB | 00m00s [ 63/183] curl-0:8.18.0~rc2-1.fc44.x86_ 100% | 13.6 MiB/s | 237.5 KiB | 00m00s [ 64/183] R-srpm-macros-0:1.3.0-1.fc44. 100% | 684.4 KiB/s | 10.3 KiB | 00m00s [ 65/183] ansible-srpm-macros-0:1-18.1. 100% | 1.4 MiB/s | 19.9 KiB | 00m00s [ 66/183] build-reproducibility-srpm-ma 100% | 803.5 KiB/s | 12.9 KiB | 00m00s [ 67/183] cmake-srpm-macros-0:3.31.10-3 100% | 690.2 KiB/s | 10.4 KiB | 00m00s [ 68/183] dwz-0:0.16-2.fc43.x86_64 100% | 8.8 MiB/s | 135.5 KiB | 00m00s [ 69/183] filesystem-srpm-macros-0:3.18 100% | 1.7 MiB/s | 26.4 KiB | 00m00s [ 70/183] fonts-srpm-macros-1:5.0.0-1.f 100% | 1.8 MiB/s | 27.3 KiB | 00m00s [ 71/183] efi-srpm-macros-0:6-5.fc44.no 100% | 1.3 MiB/s | 22.5 KiB | 00m00s [ 72/183] forge-srpm-macros-0:0.4.0-3.f 100% | 1.3 MiB/s | 20.1 KiB | 00m00s [ 73/183] fpc-srpm-macros-0:1.3-15.fc43 100% | 563.7 KiB/s | 7.9 KiB | 00m00s [ 74/183] gap-srpm-macros-0:2-1.fc44.no 100% | 565.9 KiB/s | 9.1 KiB | 00m00s [ 75/183] ghc-srpm-macros-0:1.9.2-3.fc4 100% | 624.7 KiB/s | 8.7 KiB | 00m00s [ 76/183] gnat-srpm-macros-0:6-8.fc43.n 100% | 606.2 KiB/s | 8.5 KiB | 00m00s [ 77/183] go-srpm-macros-0:3.8.0-1.fc44 100% | 1.6 MiB/s | 28.3 KiB | 00m00s [ 78/183] kernel-srpm-macros-0:1.0-27.f 100% | 637.2 KiB/s | 8.9 KiB | 00m00s [ 79/183] java-srpm-macros-0:1-7.fc43.n 100% | 496.5 KiB/s | 7.9 KiB | 00m00s [ 80/183] lua-srpm-macros-0:1-16.fc43.n 100% | 547.3 KiB/s | 8.8 KiB | 00m00s [ 81/183] ocaml-srpm-macros-0:11-2.fc43 100% | 617.4 KiB/s | 9.3 KiB | 00m00s [ 82/183] openblas-srpm-macros-0:2-20.f 100% | 542.5 KiB/s | 7.6 KiB | 00m00s [ 83/183] package-notes-srpm-macros-0:0 100% | 561.6 KiB/s | 9.0 KiB | 00m00s [ 84/183] perl-srpm-macros-0:1-60.fc43. 100% | 592.1 KiB/s | 8.3 KiB | 00m00s [ 85/183] pyproject-srpm-macros-0:1.18. 100% | 951.0 KiB/s | 13.3 KiB | 00m00s [ 86/183] python-srpm-macros-0:3.14-9.f 100% | 1.4 MiB/s | 23.8 KiB | 00m00s [ 87/183] qt5-srpm-macros-0:5.15.18-1.f 100% | 614.5 KiB/s | 8.6 KiB | 00m00s [ 88/183] qt6-srpm-macros-0:6.10.1-1.fc 100% | 623.8 KiB/s | 9.4 KiB | 00m00s [ 89/183] rust-srpm-macros-0:28.4-1.fc4 100% | 640.4 KiB/s | 10.9 KiB | 00m00s [ 90/183] tree-sitter-srpm-macros-0:0.4 100% | 890.0 KiB/s | 13.4 KiB | 00m00s [ 91/183] zig-srpm-macros-0:1-5.fc43.no 100% | 562.3 KiB/s | 8.4 KiB | 00m00s [ 92/183] pkgconf-0:2.3.0-3.fc43.x86_64 100% | 3.1 MiB/s | 44.6 KiB | 00m00s [ 93/183] pkgconf-m4-0:2.3.0-3.fc43.noa 100% | 993.7 KiB/s | 13.9 KiB | 00m00s [ 94/183] zip-0:3.0-44.fc43.x86_64 100% | 14.2 MiB/s | 261.6 KiB | 00m00s [ 95/183] libpkgconf-0:2.3.0-3.fc43.x86 100% | 2.5 MiB/s | 37.9 KiB | 00m00s [ 96/183] ed-0:1.22.3-1.fc44.x86_64 100% | 5.5 MiB/s | 84.1 KiB | 00m00s [ 97/183] libattr-0:2.5.2-6.fc43.x86_64 100% | 1.0 MiB/s | 17.9 KiB | 00m00s [ 98/183] ncurses-base-0:6.5-8.20250614 100% | 4.1 MiB/s | 63.5 KiB | 00m00s [ 99/183] libsepol-0:3.9-2.fc43.x86_64 100% | 21.1 MiB/s | 345.4 KiB | 00m00s [100/183] pcre2-0:10.47-1.fc44.x86_64 100% | 13.7 MiB/s | 267.2 KiB | 00m00s [101/183] sqlite-libs-0:3.51.0-1.fc44.x 100% | 41.6 MiB/s | 766.5 KiB | 00m00s [102/183] libxml2-0:2.12.10-5.fc44.x86_ 100% | 35.6 MiB/s | 692.7 KiB | 00m00s [103/183] libzstd-0:1.5.7-3.fc44.x86_64 100% | 17.5 MiB/s | 359.1 KiB | 00m00s [104/183] lz4-libs-0:1.10.0-3.fc43.x86_ 100% | 5.1 MiB/s | 78.0 KiB | 00m00s [105/183] gmp-1:6.3.0-4.fc44.x86_64 100% | 16.4 MiB/s | 319.3 KiB | 00m00s [106/183] mpfr-0:4.2.2-2.fc43.x86_64 100% | 21.2 MiB/s | 347.0 KiB | 00m00s [107/183] openssl-libs-1:3.5.4-1.fc44.x 100% | 72.7 MiB/s | 2.6 MiB | 00m00s [108/183] file-libs-0:5.46-8.fc44.x86_6 100% | 43.7 MiB/s | 849.9 KiB | 00m00s [109/183] fedora-repos-0:44-0.1.noarch 100% | 604.9 KiB/s | 9.1 KiB | 00m00s [110/183] elfutils-debuginfod-client-0: 100% | 3.0 MiB/s | 46.3 KiB | 00m00s [111/183] elfutils-libs-0:0.194-2.fc44. 100% | 15.6 MiB/s | 271.0 KiB | 00m00s [112/183] libcap-0:2.77-1.fc44.x86_64 100% | 5.3 MiB/s | 87.1 KiB | 00m00s [113/183] coreutils-common-0:9.9-1.fc44 100% | 61.1 MiB/s | 2.1 MiB | 00m00s [114/183] add-determinism-0:0.7.2-2.fc4 100% | 45.6 MiB/s | 887.6 KiB | 00m00s [115/183] linkdupes-0:0.7.2-2.fc44.x86_ 100% | 21.7 MiB/s | 356.3 KiB | 00m00s [116/183] alternatives-0:1.33-3.fc44.x8 100% | 2.7 MiB/s | 40.8 KiB | 00m00s [117/183] jansson-0:2.14-3.fc43.x86_64 100% | 2.8 MiB/s | 45.3 KiB | 00m00s [118/183] lua-libs-0:5.4.8-4.fc44.x86_6 100% | 8.7 MiB/s | 133.1 KiB | 00m00s [119/183] rpm-sequoia-0:1.10.0-1.fc44.x 100% | 43.7 MiB/s | 939.4 KiB | 00m00s [120/183] rpm-sign-libs-0:6.0.1-1.fc44. 100% | 1.7 MiB/s | 28.0 KiB | 00m00s [121/183] pcre2-syntax-0:10.47-1.fc44.n 100% | 10.7 MiB/s | 164.7 KiB | 00m00s [122/183] ca-certificates-0:2025.2.80_v 100% | 50.1 MiB/s | 973.8 KiB | 00m00s [123/183] crypto-policies-0:20251128-1. 100% | 4.9 MiB/s | 74.7 KiB | 00m00s [124/183] libatomic-0:16.0.0-0.3.fc44.x 100% | 169.9 KiB/s | 21.1 KiB | 00m00s [125/183] fedora-gpg-keys-0:44-0.1.noar 100% | 8.9 MiB/s | 127.7 KiB | 00m00s [126/183] libgomp-0:16.0.0-0.3.fc44.x86 100% | 3.9 MiB/s | 369.5 KiB | 00m00s [127/183] elfutils-default-yama-scope-0 100% | 840.0 KiB/s | 11.8 KiB | 00m00s [128/183] json-c-0:0.18-7.fc43.x86_64 100% | 2.9 MiB/s | 45.0 KiB | 00m00s [129/183] fedora-repos-rawhide-0:44-0.1 100% | 480.4 KiB/s | 8.6 KiB | 00m00s [130/183] gnulib-l10n-0:20241231-1.fc44 100% | 9.3 MiB/s | 143.0 KiB | 00m00s [131/183] libffi-0:3.5.2-1.fc44.x86_64 100% | 2.9 MiB/s | 41.1 KiB | 00m00s [132/183] p11-kit-0:0.25.8-1.fc44.x86_6 100% | 26.9 MiB/s | 496.2 KiB | 00m00s [133/183] p11-kit-trust-0:0.25.8-1.fc44 100% | 8.5 MiB/s | 139.7 KiB | 00m00s [134/183] gnupg2-0:2.4.8-4.fc43.x86_64 100% | 70.9 MiB/s | 1.6 MiB | 00m00s [135/183] ima-evm-utils-libs-0:1.6.2-7. 100% | 1.6 MiB/s | 29.4 KiB | 00m00s [136/183] libfsverity-0:1.6-3.fc43.x86_ 100% | 1.2 MiB/s | 18.6 KiB | 00m00s [137/183] libtasn1-0:4.20.0-2.fc43.x86_ 100% | 4.8 MiB/s | 74.5 KiB | 00m00s [138/183] gpgverify-0:2.2-3.fc43.noarch 100% | 653.1 KiB/s | 11.1 KiB | 00m00s [139/183] tpm2-tss-0:4.1.3-8.fc43.x86_6 100% | 24.2 MiB/s | 421.3 KiB | 00m00s [140/183] gnupg2-verify-0:2.4.8-4.fc43. 100% | 10.4 MiB/s | 171.2 KiB | 00m00s [141/183] libassuan-0:2.5.7-4.fc43.x86_ 100% | 3.9 MiB/s | 67.4 KiB | 00m00s [142/183] libgcrypt-0:1.11.2-1.fc44.x86 100% | 34.2 MiB/s | 596.1 KiB | 00m00s [143/183] libgpg-error-0:1.58-1.fc44.x8 100% | 15.0 MiB/s | 245.1 KiB | 00m00s [144/183] npth-0:1.8-3.fc43.x86_64 100% | 1.6 MiB/s | 25.7 KiB | 00m00s [145/183] gnupg2-dirmngr-0:2.4.8-4.fc43 100% | 17.9 MiB/s | 274.6 KiB | 00m00s [146/183] gnupg2-gpg-agent-0:2.4.8-4.fc 100% | 15.7 MiB/s | 272.9 KiB | 00m00s [147/183] gnupg2-gpgconf-0:2.4.8-4.fc43 100% | 6.2 MiB/s | 115.0 KiB | 00m00s [148/183] gnupg2-keyboxd-0:2.4.8-4.fc43 100% | 6.2 MiB/s | 94.7 KiB | 00m00s [149/183] libusb1-0:1.0.29-4.fc44.x86_6 100% | 5.2 MiB/s | 79.9 KiB | 00m00s [150/183] libksba-0:1.6.7-4.fc43.x86_64 100% | 9.2 MiB/s | 160.4 KiB | 00m00s [151/183] gnutls-0:3.8.11-6.fc44.x86_64 100% | 68.0 MiB/s | 1.4 MiB | 00m00s [152/183] openldap-0:2.6.10-4.fc44.x86_ 100% | 14.9 MiB/s | 259.5 KiB | 00m00s [153/183] cyrus-sasl-lib-0:2.1.28-33.fc 100% | 37.0 MiB/s | 796.5 KiB | 00m00s [154/183] libevent-0:2.1.12-16.fc43.x86 100% | 14.0 MiB/s | 257.8 KiB | 00m00s [155/183] libtool-ltdl-0:2.5.4-9.fc44.x 100% | 1.0 MiB/s | 36.9 KiB | 00m00s [156/183] libidn2-0:2.3.8-2.fc43.x86_64 100% | 9.7 MiB/s | 168.9 KiB | 00m00s [157/183] libunistring-0:1.1-10.fc43.x8 100% | 25.2 MiB/s | 542.9 KiB | 00m00s [158/183] nettle-0:3.10.1-2.fc43.x86_64 100% | 23.0 MiB/s | 424.2 KiB | 00m00s [159/183] gdbm-libs-1:1.23-10.fc43.x86_ 100% | 3.5 MiB/s | 56.8 KiB | 00m00s [160/183] fedora-release-0:44-0.10.noar 100% | 844.1 KiB/s | 13.5 KiB | 00m00s [161/183] systemd-standalone-sysusers-0 100% | 9.4 MiB/s | 143.8 KiB | 00m00s [162/183] fedora-release-identity-basic 100% | 951.8 KiB/s | 14.3 KiB | 00m00s [163/183] xxhash-libs-0:0.8.3-3.fc43.x8 100% | 2.1 MiB/s | 38.5 KiB | 00m00s [164/183] gdb-minimal-0:16.3-6.fc44.x86 100% | 113.0 MiB/s | 4.4 MiB | 00m00s [165/183] libcurl-0:8.18.0~rc2-1.fc44.x 100% | 23.6 MiB/s | 435.1 KiB | 00m00s [166/183] policycoreutils-0:3.9-5.fc44. 100% | 11.6 MiB/s | 190.6 KiB | 00m00s [167/183] selinux-policy-0:42.19-1.fc44 100% | 4.3 MiB/s | 65.4 KiB | 00m00s [168/183] rpm-plugin-selinux-0:6.0.1-1. 100% | 1.3 MiB/s | 19.2 KiB | 00m00s [169/183] selinux-policy-targeted-0:42. 100% | 122.2 MiB/s | 6.6 MiB | 00m00s [170/183] libselinux-utils-0:3.9-5.fc44 100% | 5.1 MiB/s | 109.9 KiB | 00m00s [171/183] krb5-libs-0:1.21.3-10.fc44.x8 100% | 41.1 MiB/s | 757.0 KiB | 00m00s [172/183] libnghttp3-0:1.14.0-1.fc44.x8 100% | 23.0 MiB/s | 70.7 KiB | 00m00s [173/183] libnghttp2-0:1.68.0-2.fc44.x8 100% | 4.4 MiB/s | 72.9 KiB | 00m00s [174/183] libbrotli-0:1.2.0-1.fc44.x86_ 100% | 17.1 MiB/s | 349.2 KiB | 00m00s [175/183] libpsl-0:0.21.5-6.fc43.x86_64 100% | 4.2 MiB/s | 65.0 KiB | 00m00s [176/183] libssh-0:0.11.3-1.fc44.x86_64 100% | 14.2 MiB/s | 232.8 KiB | 00m00s [177/183] ngtcp2-0:1.18.0-1.fc44.x86_64 100% | 8.5 MiB/s | 147.1 KiB | 00m00s [178/183] ngtcp2-crypto-ossl-0:1.18.0-1 100% | 1.9 MiB/s | 26.7 KiB | 00m00s [179/183] keyutils-libs-0:1.6.3-6.fc43. 100% | 1.9 MiB/s | 31.4 KiB | 00m00s [180/183] libcom_err-0:1.47.3-3.fc44.x8 100% | 1.5 MiB/s | 26.9 KiB | 00m00s [181/183] libverto-0:0.3.2-11.fc43.x86_ 100% | 1.3 MiB/s | 20.7 KiB | 00m00s [182/183] libssh-config-0:0.11.3-1.fc44 100% | 650.8 KiB/s | 9.1 KiB | 00m00s [183/183] publicsuffix-list-dafsa-0:202 100% | 3.4 MiB/s | 59.2 KiB | 00m00s -------------------------------------------------------------------------------- [183/183] Total 100% | 46.1 MiB/s | 66.5 MiB | 00m01s Running transaction Importing OpenPGP key 0x6D9F90A6: UserID : "Fedora (44) " Fingerprint: 36F612DCF27F7D1A48A835E4DBFCF71C6D9F90A6 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-44-primary The key was successfully imported. Importing OpenPGP key 0x6D9F90A6: UserID : "Fedora (44) " Fingerprint: 36F612DCF27F7D1A48A835E4DBFCF71C6D9F90A6 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-44-primary The key was successfully imported. Importing OpenPGP key 0x31645531: UserID : "Fedora (43) " Fingerprint: C6E7F081CF80E13146676E88829B606631645531 From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-43-primary The key was successfully imported. Importing OpenPGP key 0xF577861E: UserID : "Fedora (45) " Fingerprint: 4F50A6114CD5C6976A7F1179655A4B02F577861E From : file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-45-primary The key was successfully imported. [ 1/185] Verify package files 100% | 690.0 B/s | 183.0 B | 00m00s >>> Running %pretrans scriptlet: filesystem-0:3.18-50.fc43.x86_64 >>> Finished %pretrans scriptlet: filesystem-0:3.18-50.fc43.x86_64 >>> [RPM] /var/lib/mock/fedora-rawhide-x86_64-1766684798.158760/root/var/cache/dnf/copr_base-a2b79860a4d039f2/packages/bash-5.3.0-2.fc44.x86_64.rpm: Header OpenPGP V4 RSA/SHA256 signature, key ID 52ac7d71d4a9769d: NOKEY [ 2/185] Prepare transaction 100% | 3.2 KiB/s | 183.0 B | 00m00s [ 3/185] Installing libgcc-0:16.0.0-0. 100% | 266.0 MiB/s | 272.4 KiB | 00m00s [ 4/185] Installing publicsuffix-list- 100% | 0.0 B/s | 69.8 KiB | 00m00s [ 5/185] Installing libssh-config-0:0. 100% | 0.0 B/s | 816.0 B | 00m00s [ 6/185] Installing fedora-release-ide 100% | 0.0 B/s | 920.0 B | 00m00s [ 7/185] Installing fedora-repos-rawhi 100% | 0.0 B/s | 2.4 KiB | 00m00s [ 8/185] Installing fedora-gpg-keys-0: 100% | 43.7 MiB/s | 179.0 KiB | 00m00s [ 9/185] Installing fedora-repos-0:44- 100% | 0.0 B/s | 5.7 KiB | 00m00s [ 10/185] Installing fedora-release-com 100% | 24.3 MiB/s | 24.9 KiB | 00m00s [ 11/185] Installing fedora-release-0:4 100% | 15.1 KiB/s | 124.0 B | 00m00s >>> Running sysusers scriptlet: setup-0:2.15.0-27.fc44.noarch >>> Finished sysusers scriptlet: setup-0:2.15.0-27.fc44.noarch >>> Scriptlet output: >>> Creating group 'adm' with GID 4. >>> Creating group 'audio' with GID 63. >>> Creating group 'cdrom' with GID 11. >>> Creating group 'clock' with GID 103. >>> Creating group 'dialout' with GID 18. >>> Creating group 'disk' with GID 6. >>> Creating group 'floppy' with GID 19. >>> Creating group 'ftp' with GID 50. >>> Creating group 'games' with GID 20. >>> Creating group 'input' with GID 104. >>> Creating group 'kmem' with GID 9. >>> Creating group 'kvm' with GID 36. >>> Creating group 'lock' with GID 54. >>> Creating group 'lp' with GID 7. >>> Creating group 'mail' with GID 12. >>> Creating group 'man' with GID 15. >>> Creating group 'mem' with GID 8. >>> Creating group 'nobody' with GID 65534. >>> Creating group 'render' with GID 105. >>> Creating group 'root' with GID 0. >>> Creating group 'sgx' with GID 106. >>> Creating group 'sys' with GID 3. >>> Creating group 'tape' with GID 33. >>> Creating group 'tty' with GID 5. >>> Creating group 'users' with GID 100. >>> Creating group 'utmp' with GID 22. >>> Creating group 'video' with GID 39. >>> Creating group 'wheel' with GID 10. >>> Creating user 'adm' (adm) with UID 3 and GID 4. >>> Creating group 'bin' with GID 1. >>> Creating user 'bin' (bin) with UID 1 and GID 1. >>> Creating group 'daemon' with GID 2. >>> Creating user 'daemon' (daemon) with UID 2 and GID 2. >>> Creating user 'ftp' (FTP User) with UID 14 and GID 50. >>> Creating user 'games' (games) with UID 12 and GID 100. >>> Creating user 'halt' (halt) with UID 7 and GID 0. >>> Creating user 'lp' (lp) with UID 4 and GID 7. >>> Creating user 'mail' (mail) with UID 8 and GID 12. >>> Creating user 'nobody' (Kernel Overflow User) with UID 65534 and GID 65534. >>> Creating user 'operator' (operator) with UID 11 and GID 0. >>> Creating user 'root' (Super User) with UID 0 and GID 0. >>> Creating user 'shutdown' (shutdown) with UID 6 and GID 0. >>> Creating user 'sync' (sync) with UID 5 and GID 0. >>> [ 12/185] Installing setup-0:2.15.0-27. 100% | 51.0 MiB/s | 730.6 KiB | 00m00s >>> [RPM] /etc/hosts created as /etc/hosts.rpmnew [ 13/185] Installing filesystem-0:3.18- 100% | 2.7 MiB/s | 212.8 KiB | 00m00s [ 14/185] Installing gnulib-l10n-0:2024 100% | 161.6 MiB/s | 661.9 KiB | 00m00s [ 15/185] Installing coreutils-common-0 100% | 374.3 MiB/s | 11.2 MiB | 00m00s [ 16/185] Installing pcre2-syntax-0:10. 100% | 277.7 MiB/s | 284.3 KiB | 00m00s [ 17/185] Installing ncurses-base-0:6.5 100% | 86.3 MiB/s | 353.5 KiB | 00m00s [ 18/185] Installing bash-0:5.3.0-2.fc4 100% | 264.8 MiB/s | 8.5 MiB | 00m00s [ 19/185] Installing glibc-common-0:2.4 100% | 60.3 MiB/s | 1.0 MiB | 00m00s [ 20/185] Installing glibc-gconv-extra- 100% | 260.2 MiB/s | 7.3 MiB | 00m00s [ 21/185] Installing glibc-0:2.42.9000- 100% | 175.6 MiB/s | 6.8 MiB | 00m00s [ 22/185] Installing ncurses-libs-0:6.5 100% | 232.7 MiB/s | 953.0 KiB | 00m00s [ 23/185] Installing glibc-minimal-lang 100% | 0.0 B/s | 124.0 B | 00m00s [ 24/185] Installing zlib-ng-compat-0:2 100% | 158.6 MiB/s | 162.4 KiB | 00m00s [ 25/185] Installing bzip2-libs-0:1.0.8 100% | 79.8 MiB/s | 81.7 KiB | 00m00s [ 26/185] Installing libgpg-error-0:1.5 100% | 61.7 MiB/s | 947.5 KiB | 00m00s [ 27/185] Installing libassuan-0:2.5.7- 100% | 161.7 MiB/s | 165.6 KiB | 00m00s [ 28/185] Installing libgcrypt-0:1.11.2 100% | 315.2 MiB/s | 1.6 MiB | 00m00s [ 29/185] Installing readline-0:8.3-2.f 100% | 250.9 MiB/s | 513.9 KiB | 00m00s [ 30/185] Installing xz-libs-1:5.8.1-4. 100% | 213.8 MiB/s | 218.9 KiB | 00m00s [ 31/185] Installing libuuid-0:2.41.3-8 100% | 0.0 B/s | 38.2 KiB | 00m00s [ 32/185] Installing gmp-1:6.3.0-4.fc44 100% | 266.1 MiB/s | 817.5 KiB | 00m00s [ 33/185] Installing popt-0:1.19-9.fc43 100% | 68.1 MiB/s | 139.4 KiB | 00m00s [ 34/185] Installing libzstd-0:1.5.7-3. 100% | 306.5 MiB/s | 941.6 KiB | 00m00s [ 35/185] Installing elfutils-libelf-0: 100% | 373.7 MiB/s | 1.1 MiB | 00m00s [ 36/185] Installing npth-0:1.8-3.fc43. 100% | 0.0 B/s | 50.7 KiB | 00m00s [ 37/185] Installing libblkid-0:2.41.3- 100% | 257.2 MiB/s | 263.4 KiB | 00m00s [ 38/185] Installing systemd-libs-0:259 100% | 334.3 MiB/s | 2.3 MiB | 00m00s [ 39/185] Installing libxcrypt-0:4.5.2- 100% | 281.3 MiB/s | 288.0 KiB | 00m00s [ 40/185] Installing libsepol-0:3.9-2.f 100% | 401.8 MiB/s | 822.9 KiB | 00m00s [ 41/185] Installing sqlite-libs-0:3.51 100% | 383.0 MiB/s | 1.5 MiB | 00m00s [ 42/185] Installing gnupg2-gpgconf-0:2 100% | 20.5 MiB/s | 252.0 KiB | 00m00s [ 43/185] Installing libattr-0:2.5.2-6. 100% | 24.8 MiB/s | 25.4 KiB | 00m00s [ 44/185] Installing libacl-0:2.3.2-4.f 100% | 0.0 B/s | 36.6 KiB | 00m00s [ 45/185] Installing pcre2-0:10.47-1.fc 100% | 343.8 MiB/s | 704.1 KiB | 00m00s [ 46/185] Installing libselinux-0:3.9-5 100% | 189.8 MiB/s | 194.4 KiB | 00m00s [ 47/185] Installing grep-0:3.12-2.fc43 100% | 62.7 MiB/s | 1.0 MiB | 00m00s [ 48/185] Installing sed-0:4.9-6.fc44.x 100% | 56.3 MiB/s | 865.5 KiB | 00m00s [ 49/185] Installing findutils-1:4.10.0 100% | 103.2 MiB/s | 1.9 MiB | 00m00s [ 50/185] Installing libtasn1-0:4.20.0- 100% | 173.9 MiB/s | 178.1 KiB | 00m00s [ 51/185] Installing libunistring-0:1.1 100% | 345.3 MiB/s | 1.7 MiB | 00m00s [ 52/185] Installing libidn2-0:2.3.8-2. 100% | 54.6 MiB/s | 558.7 KiB | 00m00s [ 53/185] Installing crypto-policies-0: 100% | 38.5 MiB/s | 157.7 KiB | 00m00s [ 54/185] Installing xz-1:5.8.1-4.fc44. 100% | 74.0 MiB/s | 1.3 MiB | 00m00s [ 55/185] Installing libmount-0:2.41.3- 100% | 182.4 MiB/s | 373.6 KiB | 00m00s [ 56/185] Installing gnupg2-verify-0:2. 100% | 26.3 MiB/s | 349.9 KiB | 00m00s [ 57/185] Installing dwz-0:0.16-2.fc43. 100% | 23.5 MiB/s | 288.5 KiB | 00m00s [ 58/185] Installing mpfr-0:4.2.2-2.fc4 100% | 271.6 MiB/s | 834.4 KiB | 00m00s [ 59/185] Installing gawk-0:5.3.2-2.fc4 100% | 106.8 MiB/s | 1.8 MiB | 00m00s [ 60/185] Installing libksba-0:1.6.7-4. 100% | 195.8 MiB/s | 401.1 KiB | 00m00s [ 61/185] Installing unzip-0:6.0-68.fc4 100% | 29.6 MiB/s | 393.8 KiB | 00m00s [ 62/185] Installing file-libs-0:5.46-8 100% | 624.1 MiB/s | 11.9 MiB | 00m00s [ 63/185] Installing file-0:5.46-8.fc44 100% | 8.3 MiB/s | 101.7 KiB | 00m00s [ 64/185] Installing diffutils-0:3.12-3 100% | 97.6 MiB/s | 1.6 MiB | 00m00s [ 65/185] Installing libcap-ng-0:0.8.5- 100% | 69.2 MiB/s | 70.8 KiB | 00m00s [ 66/185] Installing audit-libs-0:4.1.2 100% | 191.9 MiB/s | 393.1 KiB | 00m00s [ 67/185] Installing libsemanage-0:3.9- 100% | 303.0 MiB/s | 310.2 KiB | 00m00s [ 68/185] Installing libsmartcols-0:2.4 100% | 177.1 MiB/s | 181.4 KiB | 00m00s [ 69/185] Installing libeconf-0:0.7.9-2 100% | 65.0 MiB/s | 66.5 KiB | 00m00s [ 70/185] Installing pam-libs-0:1.7.1-3 100% | 126.0 MiB/s | 129.0 KiB | 00m00s [ 71/185] Installing libcap-0:2.77-1.fc 100% | 16.1 MiB/s | 214.3 KiB | 00m00s [ 72/185] Installing alternatives-0:1.3 100% | 5.7 MiB/s | 63.8 KiB | 00m00s [ 73/185] Installing lua-libs-0:5.4.8-4 100% | 276.7 MiB/s | 283.3 KiB | 00m00s [ 74/185] Installing json-c-0:0.18-7.fc 100% | 82.0 MiB/s | 84.0 KiB | 00m00s [ 75/185] Installing libffi-0:3.5.2-1.f 100% | 83.2 MiB/s | 85.2 KiB | 00m00s [ 76/185] Installing p11-kit-0:0.25.8-1 100% | 120.5 MiB/s | 2.3 MiB | 00m00s [ 77/185] Installing p11-kit-trust-0:0. 100% | 20.8 MiB/s | 448.3 KiB | 00m00s [ 78/185] Installing ngtcp2-0:1.18.0-1. 100% | 154.2 MiB/s | 315.8 KiB | 00m00s [ 79/185] Installing openssl-libs-1:3.5 100% | 342.7 MiB/s | 8.9 MiB | 00m00s [ 80/185] Installing coreutils-0:9.9-1. 100% | 156.8 MiB/s | 5.5 MiB | 00m00s [ 81/185] Installing ca-certificates-0: 100% | 2.0 MiB/s | 2.5 MiB | 00m01s [ 82/185] Installing gzip-0:1.14-1.fc44 100% | 28.1 MiB/s | 403.3 KiB | 00m00s [ 83/185] Installing rpm-sequoia-0:1.10 100% | 352.3 MiB/s | 2.5 MiB | 00m00s [ 84/185] Installing libfsverity-0:1.6- 100% | 0.0 B/s | 29.5 KiB | 00m00s [ 85/185] Installing libevent-0:2.1.12- 100% | 288.7 MiB/s | 886.8 KiB | 00m00s [ 86/185] Installing ngtcp2-crypto-ossl 100% | 51.3 MiB/s | 52.6 KiB | 00m00s [ 87/185] Installing util-linux-core-0: 100% | 82.0 MiB/s | 1.5 MiB | 00m00s [ 88/185] Installing zip-0:3.0-44.fc43. 100% | 48.7 MiB/s | 698.4 KiB | 00m00s [ 89/185] Installing gnupg2-keyboxd-0:2 100% | 28.3 MiB/s | 202.7 KiB | 00m00s [ 90/185] Installing libpsl-0:0.21.5-6. 100% | 75.7 MiB/s | 77.5 KiB | 00m00s [ 91/185] Installing tar-2:1.35-6.fc43. 100% | 134.5 MiB/s | 3.0 MiB | 00m00s [ 92/185] Installing linkdupes-0:0.7.2- 100% | 54.7 MiB/s | 840.1 KiB | 00m00s [ 93/185] Installing libselinux-utils-0 100% | 22.6 MiB/s | 323.4 KiB | 00m00s [ 94/185] Installing liblastlog2-0:2.41 100% | 5.0 MiB/s | 35.8 KiB | 00m00s [ 95/185] Installing systemd-standalone 100% | 20.5 MiB/s | 294.2 KiB | 00m00s [ 96/185] Installing libusb1-0:1.0.29-4 100% | 21.1 MiB/s | 172.9 KiB | 00m00s >>> Running sysusers scriptlet: tpm2-tss-0:4.1.3-8.fc43.x86_64 >>> Finished sysusers scriptlet: tpm2-tss-0:4.1.3-8.fc43.x86_64 >>> Scriptlet output: >>> Creating group 'tss' with GID 59. >>> Creating user 'tss' (Account used for TPM access) with UID 59 and GID 59. >>> [ 97/185] Installing tpm2-tss-0:4.1.3-8 100% | 262.0 MiB/s | 1.6 MiB | 00m00s [ 98/185] Installing ima-evm-utils-libs 100% | 60.5 MiB/s | 62.0 KiB | 00m00s [ 99/185] Installing gnupg2-gpg-agent-0 100% | 30.0 MiB/s | 675.4 KiB | 00m00s [100/185] Installing libfdisk-0:2.41.3- 100% | 124.1 MiB/s | 381.3 KiB | 00m00s [101/185] Installing util-linux-0:2.41. 100% | 96.3 MiB/s | 3.6 MiB | 00m00s [102/185] Installing policycoreutils-0: 100% | 26.7 MiB/s | 711.8 KiB | 00m00s [103/185] Installing selinux-policy-0:4 100% | 1.6 MiB/s | 33.6 KiB | 00m00s [104/185] Installing selinux-policy-tar 100% | 162.1 MiB/s | 14.9 MiB | 00m00s [105/185] Installing nettle-0:3.10.1-2. 100% | 193.8 MiB/s | 793.7 KiB | 00m00s [106/185] Installing gnutls-0:3.8.11-6. 100% | 331.7 MiB/s | 3.6 MiB | 00m00s [107/185] Installing libxml2-0:2.12.10- 100% | 89.7 MiB/s | 1.7 MiB | 00m00s [108/185] Installing bzip2-0:1.0.8-21.f 100% | 8.1 MiB/s | 99.8 KiB | 00m00s [109/185] Installing add-determinism-0: 100% | 135.6 MiB/s | 2.3 MiB | 00m00s [110/185] Installing build-reproducibil 100% | 0.0 B/s | 1.5 KiB | 00m00s [111/185] Installing cpio-0:2.15-6.fc43 100% | 73.3 MiB/s | 1.1 MiB | 00m00s [112/185] Installing libpkgconf-0:2.3.0 100% | 77.4 MiB/s | 79.2 KiB | 00m00s [113/185] Installing pkgconf-0:2.3.0-3. 100% | 7.4 MiB/s | 91.0 KiB | 00m00s [114/185] Installing ed-0:1.22.3-1.fc44 100% | 12.3 MiB/s | 151.2 KiB | 00m00s [115/185] Installing patch-0:2.8-3.fc44 100% | 18.6 MiB/s | 228.2 KiB | 00m00s [116/185] Installing lz4-libs-0:1.10.0- 100% | 158.6 MiB/s | 162.5 KiB | 00m00s [117/185] Installing libarchive-0:3.8.4 100% | 311.6 MiB/s | 957.2 KiB | 00m00s [118/185] Installing libatomic-0:16.0.0 100% | 0.0 B/s | 37.5 KiB | 00m00s [119/185] Installing libstdc++-0:16.0.0 100% | 364.8 MiB/s | 2.9 MiB | 00m00s [120/185] Installing rpm-libs-0:6.0.1-1 100% | 304.5 MiB/s | 935.3 KiB | 00m00s [121/185] Installing zstd-0:1.5.7-3.fc4 100% | 35.6 MiB/s | 509.8 KiB | 00m00s [122/185] Installing jansson-0:2.14-3.f 100% | 88.3 MiB/s | 90.5 KiB | 00m00s [123/185] Installing libgomp-0:16.0.0-0 100% | 279.4 MiB/s | 572.3 KiB | 00m00s [124/185] Installing libtool-ltdl-0:2.5 100% | 69.5 MiB/s | 71.1 KiB | 00m00s [125/185] Installing gdbm-libs-1:1.23-1 100% | 128.5 MiB/s | 131.6 KiB | 00m00s [126/185] Installing cyrus-sasl-lib-0:2 100% | 127.8 MiB/s | 2.3 MiB | 00m00s [127/185] Installing openldap-0:2.6.10- 100% | 216.0 MiB/s | 663.6 KiB | 00m00s [128/185] Installing gnupg2-dirmngr-0:2 100% | 27.6 MiB/s | 621.1 KiB | 00m00s [129/185] Installing gnupg2-0:2.4.8-4.f 100% | 204.7 MiB/s | 6.6 MiB | 00m00s [130/185] Installing rpm-sign-libs-0:6. 100% | 39.6 MiB/s | 40.6 KiB | 00m00s [131/185] Installing gpgverify-0:2.2-3. 100% | 0.0 B/s | 9.4 KiB | 00m00s [132/185] Installing xxhash-libs-0:0.8. 100% | 89.4 MiB/s | 91.6 KiB | 00m00s [133/185] Installing libbrotli-0:1.2.0- 100% | 282.4 MiB/s | 867.7 KiB | 00m00s [134/185] Installing libnghttp2-0:1.68. 100% | 159.5 MiB/s | 163.4 KiB | 00m00s [135/185] Installing libnghttp3-0:1.14. 100% | 152.9 MiB/s | 156.6 KiB | 00m00s [136/185] Installing keyutils-libs-0:1. 100% | 54.4 MiB/s | 55.7 KiB | 00m00s [137/185] Installing libcom_err-0:1.47. 100% | 62.7 MiB/s | 64.2 KiB | 00m00s [138/185] Installing libverto-0:0.3.2-1 100% | 26.6 MiB/s | 27.2 KiB | 00m00s [139/185] Installing krb5-libs-0:1.21.3 100% | 287.5 MiB/s | 2.3 MiB | 00m00s [140/185] Installing libssh-0:0.11.3-1. 100% | 277.9 MiB/s | 569.2 KiB | 00m00s [141/185] Installing libcurl-0:8.18.0~r 100% | 320.9 MiB/s | 985.8 KiB | 00m00s [142/185] Installing curl-0:8.18.0~rc2- 100% | 16.0 MiB/s | 474.1 KiB | 00m00s [143/185] Installing rpm-0:6.0.1-1.fc44 100% | 72.9 MiB/s | 2.6 MiB | 00m00s [144/185] Installing cmake-srpm-macros- 100% | 0.0 B/s | 804.0 B | 00m00s [145/185] Installing efi-srpm-macros-0: 100% | 0.0 B/s | 41.2 KiB | 00m00s [146/185] Installing java-srpm-macros-0 100% | 0.0 B/s | 1.1 KiB | 00m00s [147/185] Installing lua-srpm-macros-0: 100% | 0.0 B/s | 1.9 KiB | 00m00s [148/185] Installing tree-sitter-srpm-m 100% | 0.0 B/s | 9.3 KiB | 00m00s [149/185] Installing zig-srpm-macros-0: 100% | 0.0 B/s | 1.7 KiB | 00m00s [150/185] Installing filesystem-srpm-ma 100% | 0.0 B/s | 38.9 KiB | 00m00s [151/185] Installing elfutils-default-y 100% | 408.6 KiB/s | 2.0 KiB | 00m00s [152/185] Installing elfutils-libs-0:0. 100% | 224.4 MiB/s | 689.3 KiB | 00m00s [153/185] Installing elfutils-debuginfo 100% | 6.0 MiB/s | 86.3 KiB | 00m00s [154/185] Installing binutils-0:2.45.50 100% | 315.5 MiB/s | 27.4 MiB | 00m00s [155/185] Installing elfutils-0:0.194-2 100% | 146.5 MiB/s | 2.9 MiB | 00m00s [156/185] Installing gdb-minimal-0:16.3 100% | 276.2 MiB/s | 13.3 MiB | 00m00s [157/185] Installing debugedit-0:5.2-3. 100% | 16.3 MiB/s | 217.3 KiB | 00m00s [158/185] Installing rpm-build-libs-0:6 100% | 259.0 MiB/s | 265.2 KiB | 00m00s [159/185] Installing pkgconf-m4-0:2.3.0 100% | 0.0 B/s | 14.8 KiB | 00m00s [160/185] Installing pkgconf-pkg-config 100% | 161.2 KiB/s | 1.8 KiB | 00m00s [161/185] Installing rust-srpm-macros-0 100% | 0.0 B/s | 6.4 KiB | 00m00s [162/185] Installing qt6-srpm-macros-0: 100% | 0.0 B/s | 740.0 B | 00m00s [163/185] Installing qt5-srpm-macros-0: 100% | 0.0 B/s | 776.0 B | 00m00s [164/185] Installing perl-srpm-macros-0 100% | 0.0 B/s | 1.1 KiB | 00m00s [165/185] Installing package-notes-srpm 100% | 0.0 B/s | 2.0 KiB | 00m00s [166/185] Installing openblas-srpm-macr 100% | 0.0 B/s | 392.0 B | 00m00s [167/185] Installing ocaml-srpm-macros- 100% | 0.0 B/s | 2.1 KiB | 00m00s [168/185] Installing kernel-srpm-macros 100% | 0.0 B/s | 2.3 KiB | 00m00s [169/185] Installing gnat-srpm-macros-0 100% | 0.0 B/s | 1.3 KiB | 00m00s [170/185] Installing ghc-srpm-macros-0: 100% | 0.0 B/s | 1.0 KiB | 00m00s [171/185] Installing gap-srpm-macros-0: 100% | 0.0 B/s | 2.7 KiB | 00m00s [172/185] Installing fpc-srpm-macros-0: 100% | 0.0 B/s | 420.0 B | 00m00s [173/185] Installing ansible-srpm-macro 100% | 0.0 B/s | 36.2 KiB | 00m00s [174/185] Installing redhat-rpm-config- 100% | 92.7 MiB/s | 189.9 KiB | 00m00s [175/185] Installing forge-srpm-macros- 100% | 0.0 B/s | 40.3 KiB | 00m00s [176/185] Installing fonts-srpm-macros- 100% | 0.0 B/s | 57.0 KiB | 00m00s [177/185] Installing go-srpm-macros-0:3 100% | 61.6 MiB/s | 63.0 KiB | 00m00s [178/185] Installing rpm-build-0:6.0.1- 100% | 20.7 MiB/s | 296.6 KiB | 00m00s [179/185] Installing pyproject-srpm-mac 100% | 0.0 B/s | 2.5 KiB | 00m00s [180/185] Installing R-srpm-macros-0:1. 100% | 0.0 B/s | 4.0 KiB | 00m00s [181/185] Installing python-srpm-macros 100% | 12.9 MiB/s | 52.9 KiB | 00m00s [182/185] Installing rpm-plugin-selinux 100% | 0.0 B/s | 13.0 KiB | 00m00s [183/185] Installing which-0:2.23-3.fc4 100% | 6.0 MiB/s | 85.7 KiB | 00m00s [184/185] Installing shadow-utils-2:4.1 100% | 137.0 MiB/s | 4.0 MiB | 00m00s [185/185] Installing info-0:7.2-7.fc44. 100% | 47.1 KiB/s | 358.3 KiB | 00m08s Warning: skipped OpenPGP checks for 178 packages from repositories: copr_base, https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch Complete! Finish: installing minimal buildroot with dnf5 Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: R-srpm-macros-1.3.0-1.fc44.noarch add-determinism-0.7.2-2.fc44.x86_64 alternatives-1.33-3.fc44.x86_64 ansible-srpm-macros-1-18.1.fc43.noarch audit-libs-4.1.2-2.fc44.x86_64 bash-5.3.0-2.fc44.x86_64 binutils-2.45.50-12.fc44.x86_64 build-reproducibility-srpm-macros-0.7.2-2.fc44.noarch bzip2-1.0.8-21.fc43.x86_64 bzip2-libs-1.0.8-21.fc43.x86_64 ca-certificates-2025.2.80_v9.0.304-2.fc44.noarch cmake-srpm-macros-3.31.10-3.fc44.noarch coreutils-9.9-1.fc44.x86_64 coreutils-common-9.9-1.fc44.x86_64 cpio-2.15-6.fc43.x86_64 crypto-policies-20251128-1.git19878fe.fc44.noarch curl-8.18.0~rc2-1.fc44.x86_64 cyrus-sasl-lib-2.1.28-33.fc44.x86_64 debugedit-5.2-3.fc44.x86_64 diffutils-3.12-3.fc43.x86_64 dwz-0.16-2.fc43.x86_64 ed-1.22.3-1.fc44.x86_64 efi-srpm-macros-6-5.fc44.noarch elfutils-0.194-2.fc44.x86_64 elfutils-debuginfod-client-0.194-2.fc44.x86_64 elfutils-default-yama-scope-0.194-2.fc44.noarch elfutils-libelf-0.194-2.fc44.x86_64 elfutils-libs-0.194-2.fc44.x86_64 fedora-gpg-keys-44-0.1.noarch fedora-release-44-0.10.noarch fedora-release-common-44-0.10.noarch fedora-release-identity-basic-44-0.10.noarch fedora-repos-44-0.1.noarch fedora-repos-rawhide-44-0.1.noarch file-5.46-8.fc44.x86_64 file-libs-5.46-8.fc44.x86_64 filesystem-3.18-50.fc43.x86_64 filesystem-srpm-macros-3.18-50.fc43.noarch findutils-4.10.0-6.fc43.x86_64 fonts-srpm-macros-5.0.0-1.fc44.noarch forge-srpm-macros-0.4.0-3.fc43.noarch fpc-srpm-macros-1.3-15.fc43.noarch gap-srpm-macros-2-1.fc44.noarch gawk-5.3.2-2.fc43.x86_64 gdb-minimal-16.3-6.fc44.x86_64 gdbm-libs-1.23-10.fc43.x86_64 ghc-srpm-macros-1.9.2-3.fc43.noarch glibc-2.42.9000-17.fc44.x86_64 glibc-common-2.42.9000-17.fc44.x86_64 glibc-gconv-extra-2.42.9000-17.fc44.x86_64 glibc-minimal-langpack-2.42.9000-17.fc44.x86_64 gmp-6.3.0-4.fc44.x86_64 gnat-srpm-macros-6-8.fc43.noarch gnulib-l10n-20241231-1.fc44.noarch gnupg2-2.4.8-4.fc43.x86_64 gnupg2-dirmngr-2.4.8-4.fc43.x86_64 gnupg2-gpg-agent-2.4.8-4.fc43.x86_64 gnupg2-gpgconf-2.4.8-4.fc43.x86_64 gnupg2-keyboxd-2.4.8-4.fc43.x86_64 gnupg2-verify-2.4.8-4.fc43.x86_64 gnutls-3.8.11-6.fc44.x86_64 go-srpm-macros-3.8.0-1.fc44.noarch gpg-pubkey-36f612dcf27f7d1a48a835e4dbfcf71c6d9f90a6-6786af3b gpg-pubkey-4f50a6114cd5c6976a7f1179655a4b02f577861e-6888bc98 gpg-pubkey-c6e7f081cf80e13146676e88829b606631645531-66b6dccf gpgverify-2.2-3.fc43.noarch grep-3.12-2.fc43.x86_64 gzip-1.14-1.fc44.x86_64 ima-evm-utils-libs-1.6.2-7.fc44.x86_64 info-7.2-7.fc44.x86_64 jansson-2.14-3.fc43.x86_64 java-srpm-macros-1-7.fc43.noarch json-c-0.18-7.fc43.x86_64 kernel-srpm-macros-1.0-27.fc43.noarch keyutils-libs-1.6.3-6.fc43.x86_64 krb5-libs-1.21.3-10.fc44.x86_64 libacl-2.3.2-4.fc44.x86_64 libarchive-3.8.4-1.fc44.x86_64 libassuan-2.5.7-4.fc43.x86_64 libatomic-16.0.0-0.3.fc44.x86_64 libattr-2.5.2-6.fc43.x86_64 libblkid-2.41.3-8.fc44.x86_64 libbrotli-1.2.0-1.fc44.x86_64 libcap-2.77-1.fc44.x86_64 libcap-ng-0.8.5-8.fc44.x86_64 libcom_err-1.47.3-3.fc44.x86_64 libcurl-8.18.0~rc2-1.fc44.x86_64 libeconf-0.7.9-2.fc43.x86_64 libevent-2.1.12-16.fc43.x86_64 libfdisk-2.41.3-8.fc44.x86_64 libffi-3.5.2-1.fc44.x86_64 libfsverity-1.6-3.fc43.x86_64 libgcc-16.0.0-0.3.fc44.x86_64 libgcrypt-1.11.2-1.fc44.x86_64 libgomp-16.0.0-0.3.fc44.x86_64 libgpg-error-1.58-1.fc44.x86_64 libidn2-2.3.8-2.fc43.x86_64 libksba-1.6.7-4.fc43.x86_64 liblastlog2-2.41.3-8.fc44.x86_64 libmount-2.41.3-8.fc44.x86_64 libnghttp2-1.68.0-2.fc44.x86_64 libnghttp3-1.14.0-1.fc44.x86_64 libpkgconf-2.3.0-3.fc43.x86_64 libpsl-0.21.5-6.fc43.x86_64 libselinux-3.9-5.fc44.x86_64 libselinux-utils-3.9-5.fc44.x86_64 libsemanage-3.9-4.fc44.x86_64 libsepol-3.9-2.fc43.x86_64 libsmartcols-2.41.3-8.fc44.x86_64 libssh-0.11.3-1.fc44.x86_64 libssh-config-0.11.3-1.fc44.noarch libstdc++-16.0.0-0.3.fc44.x86_64 libtasn1-4.20.0-2.fc43.x86_64 libtool-ltdl-2.5.4-9.fc44.x86_64 libunistring-1.1-10.fc43.x86_64 libusb1-1.0.29-4.fc44.x86_64 libuuid-2.41.3-8.fc44.x86_64 libverto-0.3.2-11.fc43.x86_64 libxcrypt-4.5.2-2.fc44.x86_64 libxml2-2.12.10-5.fc44.x86_64 libzstd-1.5.7-3.fc44.x86_64 linkdupes-0.7.2-2.fc44.x86_64 lua-libs-5.4.8-4.fc44.x86_64 lua-srpm-macros-1-16.fc43.noarch lz4-libs-1.10.0-3.fc43.x86_64 mpfr-4.2.2-2.fc43.x86_64 ncurses-base-6.5-8.20250614.fc44.noarch ncurses-libs-6.5-8.20250614.fc44.x86_64 nettle-3.10.1-2.fc43.x86_64 ngtcp2-1.18.0-1.fc44.x86_64 ngtcp2-crypto-ossl-1.18.0-1.fc44.x86_64 npth-1.8-3.fc43.x86_64 ocaml-srpm-macros-11-2.fc43.noarch openblas-srpm-macros-2-20.fc43.noarch openldap-2.6.10-4.fc44.x86_64 openssl-libs-3.5.4-1.fc44.x86_64 p11-kit-0.25.8-1.fc44.x86_64 p11-kit-trust-0.25.8-1.fc44.x86_64 package-notes-srpm-macros-0.5-14.fc43.noarch pam-libs-1.7.1-3.fc43.x86_64 patch-2.8-3.fc44.x86_64 pcre2-10.47-1.fc44.x86_64 pcre2-syntax-10.47-1.fc44.noarch perl-srpm-macros-1-60.fc43.noarch pkgconf-2.3.0-3.fc43.x86_64 pkgconf-m4-2.3.0-3.fc43.noarch pkgconf-pkg-config-2.3.0-3.fc43.x86_64 policycoreutils-3.9-5.fc44.x86_64 popt-1.19-9.fc43.x86_64 publicsuffix-list-dafsa-20250616-2.fc43.noarch pyproject-srpm-macros-1.18.6-1.fc44.noarch python-srpm-macros-3.14-9.fc44.noarch qt5-srpm-macros-5.15.18-1.fc44.noarch qt6-srpm-macros-6.10.1-1.fc44.noarch readline-8.3-2.fc43.x86_64 redhat-rpm-config-343-19.fc44.noarch rpm-6.0.1-1.fc44.x86_64 rpm-build-6.0.1-1.fc44.x86_64 rpm-build-libs-6.0.1-1.fc44.x86_64 rpm-libs-6.0.1-1.fc44.x86_64 rpm-plugin-selinux-6.0.1-1.fc44.x86_64 rpm-sequoia-1.10.0-1.fc44.x86_64 rpm-sign-libs-6.0.1-1.fc44.x86_64 rust-srpm-macros-28.4-1.fc44.noarch sed-4.9-6.fc44.x86_64 selinux-policy-42.19-1.fc44.noarch selinux-policy-targeted-42.19-1.fc44.noarch setup-2.15.0-27.fc44.noarch shadow-utils-4.18.0-7.fc44.x86_64 sqlite-libs-3.51.0-1.fc44.x86_64 systemd-libs-259-1.fc44.x86_64 systemd-standalone-sysusers-259-1.fc44.x86_64 tar-1.35-6.fc43.x86_64 tpm2-tss-4.1.3-8.fc43.x86_64 tree-sitter-srpm-macros-0.4.2-1.fc43.noarch unzip-6.0-68.fc44.x86_64 util-linux-2.41.3-8.fc44.x86_64 util-linux-core-2.41.3-8.fc44.x86_64 which-2.23-3.fc43.x86_64 xxhash-libs-0.8.3-3.fc43.x86_64 xz-5.8.1-4.fc44.x86_64 xz-libs-5.8.1-4.fc44.x86_64 zig-srpm-macros-1-5.fc43.noarch zip-3.0-44.fc43.x86_64 zlib-ng-compat-2.3.2-2.fc44.x86_64 zstd-1.5.7-3.fc44.x86_64 Start: buildsrpm Start: rpmbuild -bs Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1753228800 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-8.fc44.src.rpm Finish: rpmbuild -bs INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-x86_64-1766684798.158760/root/var/log/dnf5.log INFO: chroot_scan: creating tarball /var/lib/copr-rpmbuild/results/chroot_scan.tar.gz /bin/tar: Removing leading `/' from member names Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-2hry9y72/bowtie/bowtie.spec) Config(child) 0 minutes 26 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-8.fc44.src.rpm) Config(fedora-rawhide-x86_64) Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1766684798.158760/root. INFO: reusing tmpfs at /var/lib/mock/fedora-rawhide-x86_64-bootstrap-1766684798.158760/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-x86_64-1766684798.158760/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-6.0.1-1.fc44.x86_64 rpm-sequoia-1.10.0-1.fc44.x86_64 dnf5-5.3.0.0-3.fc44.x86_64 dnf5-plugins-5.3.0.0-3.fc44.x86_64 Finish: chroot init Start: build phase for bowtie-1.3.1-8.fc44.src.rpm Start: build setup for bowtie-1.3.1-8.fc44.src.rpm Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1753228800 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-8.fc44.src.rpm Updating and loading repositories: Additional repo https_kojipkgs_fedorap 100% | 3.9 KiB/s | 3.5 KiB | 00m01s Copr repository 100% | 1.7 KiB/s | 1.5 KiB | 00m01s fedora 100% | 25.6 KiB/s | 25.7 KiB | 00m01s Repositories loaded. Package Arch Version Repository Size Installing: gcc-c++ x86_64 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 48.3 MiB hostname x86_64 0:3.25-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 41.4 KiB make x86_64 1:4.4.1-11.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.8 MiB perl-Clone x86_64 0:0.47-4.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 32.4 KiB perl-Data-Dumper x86_64 0:2.191-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 115.6 KiB perl-FindBin noarch 0:1.54-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.8 KiB perl-Getopt-Long noarch 1:2.58-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 144.5 KiB perl-Test-Deep noarch 0:1.205-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 265.7 KiB perl-interpreter x86_64 4:5.42.0-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 118.6 KiB perl-lib x86_64 0:0.65-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.5 KiB python3 x86_64 0:3.14.2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 28.9 KiB tbb-devel x86_64 0:2022.3.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.4 MiB zlib-ng-compat-devel x86_64 0:2.3.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 107.0 KiB Installing dependencies: annobin-docs noarch 0:13.04-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 99.2 KiB annobin-plugin-gcc x86_64 0:13.04-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 695.6 KiB cmake-filesystem x86_64 0:3.31.10-3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 0.0 B cpp x86_64 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 43.6 MiB expat x86_64 0:2.7.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 301.1 KiB gcc x86_64 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 126.0 MiB gcc-plugin-annobin x86_64 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 57.2 KiB glibc-devel x86_64 0:2.42.9000-17.fc44 fedora 2.3 MiB groff-base x86_64 0:1.23.0-11.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.8 MiB hwloc-libs x86_64 0:2.12.0-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.9 MiB kernel-headers x86_64 0:6.19.0-0.rc2.20.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.9 MiB libmpc x86_64 0:1.3.1-8.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 160.6 KiB libstdc++-devel x86_64 0:16.0.0-0.3.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 38.7 MiB libxcrypt-devel x86_64 0:4.5.2-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 31.0 KiB mpdecimal x86_64 0:4.0.1-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 217.2 KiB ncurses x86_64 0:6.5-8.20250614.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 609.8 KiB perl-AutoLoader noarch 0:5.74-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 20.6 KiB perl-B x86_64 0:1.89-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 501.3 KiB perl-Carp noarch 0:1.54-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 46.6 KiB perl-Class-Struct noarch 0:0.68-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 25.4 KiB perl-Digest noarch 0:1.20-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 35.3 KiB perl-Digest-MD5 x86_64 0:2.59-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 59.7 KiB perl-DynaLoader x86_64 0:1.57-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 32.1 KiB perl-Encode x86_64 4:3.21-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.7 MiB perl-Errno x86_64 0:1.38-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 8.4 KiB perl-Exporter noarch 0:5.79-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 54.3 KiB perl-Fcntl x86_64 0:1.20-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 48.8 KiB perl-File-Basename noarch 0:2.86-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 14.0 KiB perl-File-Path noarch 0:2.18-521.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 63.5 KiB perl-File-Temp noarch 1:0.231.200-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 163.7 KiB perl-File-stat noarch 0:1.14-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 12.5 KiB perl-FileHandle noarch 0:2.05-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 9.4 KiB perl-Getopt-Std noarch 0:1.14-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 11.2 KiB perl-HTTP-Tiny noarch 0:0.090-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 154.4 KiB perl-IO x86_64 0:1.55-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 147.4 KiB perl-IO-Socket-IP noarch 0:0.43-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 100.3 KiB perl-IO-Socket-SSL noarch 0:2.095-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 714.5 KiB perl-IPC-Open3 noarch 0:1.24-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 27.7 KiB perl-JSON-PP noarch 1:4.16-522.fc44 fedora 141.9 KiB perl-MIME-Base32 noarch 0:1.303-24.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 30.7 KiB perl-MIME-Base64 x86_64 0:3.16-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 42.0 KiB perl-Math-BigInt noarch 1:2.0050.03-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.1 MiB perl-Math-Complex noarch 0:1.63-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 85.1 KiB perl-Net-SSLeay x86_64 0:1.94-11.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.3 MiB perl-POSIX x86_64 0:2.23-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 231.4 KiB perl-PathTools x86_64 0:3.94-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 180.0 KiB perl-Pod-Escapes noarch 1:1.07-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 24.9 KiB perl-Pod-Perldoc noarch 0:3.28.01-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 163.7 KiB perl-Pod-Simple noarch 1:3.47-3.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 565.3 KiB perl-Pod-Usage noarch 4:2.05-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 86.3 KiB perl-Scalar-List-Utils x86_64 5:1.70-1.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 144.9 KiB perl-SelectSaver noarch 0:1.02-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 2.2 KiB perl-Socket x86_64 4:2.040-2.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 120.3 KiB perl-Storable x86_64 1:3.37-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 231.2 KiB perl-Symbol noarch 0:1.09-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.8 KiB perl-Term-ANSIColor noarch 0:5.01-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 97.5 KiB perl-Term-Cap noarch 0:1.18-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 29.3 KiB perl-Term-Table noarch 0:0.025-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 78.0 KiB perl-Test-Simple noarch 3:1.302219-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.8 MiB perl-Text-ParseWords noarch 0:3.31-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 13.6 KiB perl-Text-Tabs+Wrap noarch 0:2024.001-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 22.6 KiB perl-Time-HiRes x86_64 4:1.9778-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 115.8 KiB perl-Time-Local noarch 2:1.350-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 69.0 KiB perl-URI noarch 0:5.34-2.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 268.0 KiB perl-base noarch 0:2.27-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 12.6 KiB perl-constant noarch 0:1.33-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 26.2 KiB perl-if noarch 0:0.61.000-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 5.8 KiB perl-libnet noarch 0:3.15-521.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 289.4 KiB perl-libs x86_64 4:5.42.0-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 11.5 MiB perl-locale noarch 0:1.13-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 6.1 KiB perl-mro x86_64 0:1.29-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 41.6 KiB perl-overload noarch 0:1.40-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 71.6 KiB perl-overloading noarch 0:0.02-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 4.9 KiB perl-parent noarch 1:0.244-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 10.3 KiB perl-podlators noarch 1:6.0.2-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 317.5 KiB perl-threads x86_64 1:2.43-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 115.1 KiB perl-vars noarch 0:1.05-520.fc43 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 3.9 KiB python-pip-wheel noarch 0:25.3-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB python3-libs x86_64 0:3.14.2-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 43.1 MiB tbb x86_64 0:2022.3.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 421.8 KiB tbb-bind x86_64 0:2022.3.0-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 19.8 KiB tzdata noarch 0:2025c-1.fc44 https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch 1.2 MiB Transaction Summary: Installing: 95 packages Total size of inbound packages is 108 MiB. Need to download 108 MiB. After this operation, 351 MiB extra will be used (install 351 MiB, remove 0 B). [ 1/95] hostname-0:3.25-3.fc43.x86_64 100% | 443.7 KiB/s | 27.5 KiB | 00m00s [ 2/95] perl-Clone-0:0.47-4.fc43.x86_64 100% | 1.3 MiB/s | 21.8 KiB | 00m00s [ 3/95] perl-Data-Dumper-0:2.191-521.fc 100% | 3.7 MiB/s | 56.3 KiB | 00m00s [ 4/95] perl-FindBin-0:1.54-520.fc43.no 100% | 948.7 KiB/s | 14.2 KiB | 00m00s [ 5/95] make-1:4.4.1-11.fc43.x86_64 100% | 4.6 MiB/s | 578.1 KiB | 00m00s [ 6/95] perl-Getopt-Long-1:2.58-520.fc4 100% | 4.1 MiB/s | 63.6 KiB | 00m00s [ 7/95] perl-Test-Deep-0:1.205-2.fc43.n 100% | 6.9 MiB/s | 105.8 KiB | 00m00s [ 8/95] perl-lib-0:0.65-520.fc43.x86_64 100% | 996.7 KiB/s | 15.0 KiB | 00m00s [ 9/95] perl-interpreter-4:5.42.0-520.f 100% | 3.5 MiB/s | 72.4 KiB | 00m00s [10/95] python3-0:3.14.2-1.fc44.x86_64 100% | 1.4 MiB/s | 27.8 KiB | 00m00s [11/95] zlib-ng-compat-devel-0:2.3.2-2. 100% | 2.5 MiB/s | 38.2 KiB | 00m00s [12/95] tbb-devel-0:2022.3.0-1.fc44.x86 100% | 8.5 MiB/s | 225.9 KiB | 00m00s [13/95] cmake-filesystem-0:3.31.10-3.fc 100% | 924.6 KiB/s | 13.9 KiB | 00m00s [14/95] tbb-0:2022.3.0-1.fc44.x86_64 100% | 11.4 MiB/s | 163.7 KiB | 00m00s [15/95] tbb-bind-0:2022.3.0-1.fc44.x86_ 100% | 1.2 MiB/s | 19.0 KiB | 00m00s [16/95] hwloc-libs-0:2.12.0-2.fc43.x86_ 100% | 33.4 MiB/s | 2.1 MiB | 00m00s [17/95] perl-Carp-0:1.54-520.fc43.noarc 100% | 1.6 MiB/s | 28.7 KiB | 00m00s [18/95] perl-libs-4:5.42.0-520.fc43.x86 100% | 61.3 MiB/s | 2.5 MiB | 00m00s [19/95] gcc-c++-0:16.0.0-0.3.fc44.x86_6 100% | 50.5 MiB/s | 17.3 MiB | 00m00s [20/95] perl-Exporter-0:5.79-520.fc43.n 100% | 1.7 MiB/s | 30.9 KiB | 00m00s [21/95] perl-Test-Simple-3:1.302219-1.f 100% | 47.1 MiB/s | 820.8 KiB | 00m00s [22/95] perl-Scalar-List-Utils-5:1.70-1 100% | 4.1 MiB/s | 75.0 KiB | 00m00s [23/95] perl-base-0:2.27-520.fc43.noarc 100% | 1.1 MiB/s | 16.2 KiB | 00m00s [24/95] perl-overload-0:1.40-520.fc43.n 100% | 2.5 MiB/s | 45.6 KiB | 00m00s [25/95] perl-Pod-Usage-4:2.05-520.fc43. 100% | 2.8 MiB/s | 40.5 KiB | 00m00s [26/95] perl-Text-ParseWords-0:3.31-520 100% | 1.1 MiB/s | 16.3 KiB | 00m00s [27/95] perl-constant-0:1.33-521.fc43.n 100% | 1.6 MiB/s | 22.8 KiB | 00m00s [28/95] perl-File-Basename-0:2.86-520.f 100% | 1.0 MiB/s | 17.2 KiB | 00m00s [29/95] perl-PathTools-0:3.94-520.fc43. 100% | 5.4 MiB/s | 83.2 KiB | 00m00s [30/95] perl-B-0:1.89-520.fc43.x86_64 100% | 9.6 MiB/s | 177.7 KiB | 00m00s [31/95] perl-AutoLoader-0:5.74-520.fc43 100% | 1.6 MiB/s | 21.2 KiB | 00m00s [32/95] python3-libs-0:3.14.2-1.fc44.x8 100% | 40.3 MiB/s | 9.5 MiB | 00m00s [33/95] perl-if-0:0.61.000-520.fc43.noa 100% | 875.2 KiB/s | 14.0 KiB | 00m00s [34/95] perl-overloading-0:0.02-520.fc4 100% | 922.1 KiB/s | 12.9 KiB | 00m00s [35/95] libmpc-0:1.3.1-8.fc43.x86_64 100% | 3.8 MiB/s | 70.4 KiB | 00m00s [36/95] libstdc++-devel-0:16.0.0-0.3.fc 100% | 116.9 MiB/s | 5.4 MiB | 00m00s [37/95] glibc-devel-0:2.42.9000-17.fc44 100% | 39.6 MiB/s | 608.1 KiB | 00m00s [38/95] kernel-headers-0:6.19.0-0.rc2.2 100% | 60.4 MiB/s | 1.6 MiB | 00m00s [39/95] cpp-0:16.0.0-0.3.fc44.x86_64 100% | 152.4 MiB/s | 14.6 MiB | 00m00s [40/95] libxcrypt-devel-0:4.5.2-2.fc44. 100% | 1.2 MiB/s | 30.1 KiB | 00m00s [41/95] mpdecimal-0:4.0.1-2.fc43.x86_64 100% | 5.9 MiB/s | 97.1 KiB | 00m00s [42/95] expat-0:2.7.3-1.fc44.x86_64 100% | 6.5 MiB/s | 119.9 KiB | 00m00s [43/95] python-pip-wheel-0:25.3-1.fc44. 100% | 56.6 MiB/s | 1.1 MiB | 00m00s [44/95] tzdata-0:2025c-1.fc44.noarch 100% | 21.0 MiB/s | 429.7 KiB | 00m00s [45/95] perl-mro-0:1.29-520.fc43.x86_64 100% | 2.1 MiB/s | 29.9 KiB | 00m00s [46/95] perl-DynaLoader-0:1.57-520.fc43 100% | 1.7 MiB/s | 26.0 KiB | 00m00s [47/95] perl-File-Temp-1:0.231.200-1.fc 100% | 3.6 MiB/s | 59.5 KiB | 00m00s [48/95] perl-Encode-4:3.21-520.fc43.x86 100% | 49.6 MiB/s | 1.0 MiB | 00m00s [49/95] perl-JSON-PP-1:4.16-522.fc44.no 100% | 16.0 MiB/s | 65.6 KiB | 00m00s [50/95] gcc-0:16.0.0-0.3.fc44.x86_64 100% | 179.4 MiB/s | 43.6 MiB | 00m00s [51/95] perl-POSIX-0:2.23-520.fc43.x86_ 100% | 1.8 MiB/s | 97.8 KiB | 00m00s [52/95] perl-Storable-1:3.37-521.fc43.x 100% | 1.9 MiB/s | 98.5 KiB | 00m00s [53/95] perl-Symbol-0:1.09-520.fc43.noa 100% | 946.9 KiB/s | 14.2 KiB | 00m00s [54/95] perl-Term-Table-0:0.025-1.fc44. 100% | 2.8 MiB/s | 43.2 KiB | 00m00s [55/95] perl-Term-ANSIColor-0:5.01-521. 100% | 2.7 MiB/s | 47.6 KiB | 00m00s [56/95] perl-parent-1:0.244-520.fc43.no 100% | 1.0 MiB/s | 14.8 KiB | 00m00s [57/95] perl-Time-HiRes-4:1.9778-520.fc 100% | 3.7 MiB/s | 57.1 KiB | 00m00s [58/95] perl-threads-1:2.43-520.fc43.x8 100% | 3.5 MiB/s | 57.9 KiB | 00m00s [59/95] perl-Fcntl-0:1.20-520.fc43.x86_ 100% | 2.1 MiB/s | 29.8 KiB | 00m00s [60/95] perl-IO-0:1.55-520.fc43.x86_64 100% | 4.8 MiB/s | 78.0 KiB | 00m00s [61/95] perl-Pod-Perldoc-0:3.28.01-521. 100% | 4.5 MiB/s | 78.7 KiB | 00m00s [62/95] perl-podlators-1:6.0.2-520.fc43 100% | 8.7 MiB/s | 124.3 KiB | 00m00s [63/95] groff-base-0:1.23.0-11.fc44.x86 100% | 56.4 MiB/s | 1.1 MiB | 00m00s [64/95] perl-HTTP-Tiny-0:0.090-521.fc43 100% | 3.4 MiB/s | 56.3 KiB | 00m00s [65/95] perl-IPC-Open3-0:1.24-520.fc43. 100% | 1.6 MiB/s | 23.9 KiB | 00m00s [66/95] perl-Pod-Simple-1:3.47-3.fc43.n 100% | 12.8 MiB/s | 210.5 KiB | 00m00s [67/95] perl-vars-0:1.05-520.fc43.noarc 100% | 865.9 KiB/s | 13.0 KiB | 00m00s [68/95] perl-Errno-0:1.38-520.fc43.x86_ 100% | 1.1 MiB/s | 14.9 KiB | 00m00s [69/95] perl-locale-0:1.13-520.fc43.noa 100% | 964.6 KiB/s | 13.5 KiB | 00m00s [70/95] perl-File-stat-0:1.14-520.fc43. 100% | 1.1 MiB/s | 17.1 KiB | 00m00s [71/95] perl-SelectSaver-0:1.02-520.fc4 100% | 837.3 KiB/s | 11.7 KiB | 00m00s [72/95] perl-Socket-4:2.040-2.fc43.x86_ 100% | 3.6 MiB/s | 54.9 KiB | 00m00s [73/95] perl-MIME-Base64-0:3.16-520.fc4 100% | 2.1 MiB/s | 29.7 KiB | 00m00s [74/95] perl-IO-Socket-SSL-0:2.095-2.fc 100% | 12.6 MiB/s | 231.5 KiB | 00m00s [75/95] perl-Net-SSLeay-0:1.94-11.fc43. 100% | 21.8 MiB/s | 356.8 KiB | 00m00s [76/95] perl-Time-Local-2:1.350-520.fc4 100% | 2.4 MiB/s | 34.4 KiB | 00m00s [77/95] perl-Class-Struct-0:0.68-520.fc 100% | 1.4 MiB/s | 22.1 KiB | 00m00s [78/95] perl-File-Path-0:2.18-521.fc44. 100% | 2.1 MiB/s | 35.0 KiB | 00m00s [79/95] perl-Getopt-Std-0:1.14-520.fc43 100% | 1.0 MiB/s | 15.7 KiB | 00m00s [80/95] perl-Math-BigInt-1:2.0050.03-3. 100% | 13.5 MiB/s | 234.5 KiB | 00m00s [81/95] perl-Term-Cap-0:1.18-520.fc43.n 100% | 1.4 MiB/s | 21.9 KiB | 00m00s [82/95] ncurses-0:6.5-8.20250614.fc44.x 100% | 27.4 MiB/s | 421.4 KiB | 00m00s [83/95] perl-Pod-Escapes-1:1.07-520.fc4 100% | 1.3 MiB/s | 19.8 KiB | 00m00s [84/95] perl-Text-Tabs+Wrap-0:2024.001- 100% | 1.4 MiB/s | 21.6 KiB | 00m00s [85/95] perl-Math-Complex-0:1.63-520.fc 100% | 3.2 MiB/s | 46.2 KiB | 00m00s [86/95] perl-IO-Socket-IP-0:0.43-521.fc 100% | 2.6 MiB/s | 42.1 KiB | 00m00s [87/95] perl-MIME-Base32-0:1.303-24.fc4 100% | 1.4 MiB/s | 20.4 KiB | 00m00s [88/95] perl-URI-0:5.34-2.fc44.noarch 100% | 8.8 MiB/s | 134.5 KiB | 00m00s [89/95] perl-libnet-0:3.15-521.fc43.noa 100% | 7.5 MiB/s | 122.8 KiB | 00m00s [90/95] perl-Digest-MD5-0:2.59-520.fc43 100% | 2.5 MiB/s | 35.8 KiB | 00m00s [91/95] perl-FileHandle-0:2.05-520.fc43 100% | 1.0 MiB/s | 15.5 KiB | 00m00s [92/95] perl-Digest-0:1.20-520.fc43.noa 100% | 1.4 MiB/s | 24.8 KiB | 00m00s [93/95] gcc-plugin-annobin-0:16.0.0-0.3 100% | 2.4 MiB/s | 33.8 KiB | 00m00s [94/95] annobin-plugin-gcc-0:13.04-3.fc 100% | 39.3 MiB/s | 683.3 KiB | 00m00s [95/95] annobin-docs-0:13.04-3.fc44.noa 100% | 4.8 MiB/s | 89.2 KiB | 00m00s -------------------------------------------------------------------------------- [95/95] Total 100% | 115.8 MiB/s | 107.9 MiB | 00m01s Running transaction [ 1/97] Verify package files 100% | 238.0 B/s | 95.0 B | 00m00s [ 2/97] Prepare transaction 100% | 1.8 KiB/s | 95.0 B | 00m00s [ 3/97] Installing libmpc-0:1.3.1-8.fc4 100% | 158.3 MiB/s | 162.1 KiB | 00m00s [ 4/97] Installing tbb-0:2022.3.0-1.fc4 100% | 207.4 MiB/s | 424.8 KiB | 00m00s [ 5/97] Installing cmake-filesystem-0:3 100% | 7.4 MiB/s | 7.6 KiB | 00m00s [ 6/97] Installing cpp-0:16.0.0-0.3.fc4 100% | 296.9 MiB/s | 43.7 MiB | 00m00s [ 7/97] Installing annobin-docs-0:13.04 100% | 98.0 MiB/s | 100.3 KiB | 00m00s [ 8/97] Installing ncurses-0:6.5-8.2025 100% | 28.7 MiB/s | 616.4 KiB | 00m00s [ 9/97] Installing groff-base-0:1.23.0- 100% | 109.9 MiB/s | 3.8 MiB | 00m00s [10/97] Installing perl-Digest-0:1.20-5 100% | 36.2 MiB/s | 37.1 KiB | 00m00s [11/97] Installing perl-Digest-MD5-0:2. 100% | 60.1 MiB/s | 61.6 KiB | 00m00s [12/97] Installing perl-FileHandle-0:2. 100% | 0.0 B/s | 9.8 KiB | 00m00s [13/97] Installing perl-B-0:1.89-520.fc 100% | 246.4 MiB/s | 504.7 KiB | 00m00s [14/97] Installing perl-Data-Dumper-0:2 100% | 114.8 MiB/s | 117.5 KiB | 00m00s [15/97] Installing perl-libnet-0:3.15-5 100% | 287.8 MiB/s | 294.7 KiB | 00m00s [16/97] Installing perl-MIME-Base32-0:1 100% | 31.4 MiB/s | 32.2 KiB | 00m00s [17/97] Installing perl-URI-0:5.34-2.fc 100% | 91.7 MiB/s | 281.8 KiB | 00m00s [18/97] Installing perl-IO-Socket-IP-0: 100% | 99.8 MiB/s | 102.2 KiB | 00m00s [19/97] Installing perl-AutoLoader-0:5. 100% | 0.0 B/s | 21.0 KiB | 00m00s [20/97] Installing perl-IO-Socket-SSL-0 100% | 350.9 MiB/s | 718.6 KiB | 00m00s [21/97] Installing perl-Text-Tabs+Wrap- 100% | 0.0 B/s | 23.9 KiB | 00m00s [22/97] Installing perl-Pod-Escapes-1:1 100% | 0.0 B/s | 25.9 KiB | 00m00s [23/97] Installing perl-File-Path-0:2.1 100% | 0.0 B/s | 64.5 KiB | 00m00s [24/97] Installing perl-Time-Local-2:1. 100% | 68.9 MiB/s | 70.6 KiB | 00m00s [25/97] Installing perl-Net-SSLeay-0:1. 100% | 271.7 MiB/s | 1.4 MiB | 00m00s [26/97] Installing perl-locale-0:1.13-5 100% | 0.0 B/s | 6.5 KiB | 00m00s [27/97] Installing perl-if-0:0.61.000-5 100% | 0.0 B/s | 6.2 KiB | 00m00s [28/97] Installing perl-HTTP-Tiny-0:0.0 100% | 152.8 MiB/s | 156.4 KiB | 00m00s [29/97] Installing perl-Pod-Simple-1:3. 100% | 280.7 MiB/s | 574.9 KiB | 00m00s [30/97] Installing perl-Term-Cap-0:1.18 100% | 0.0 B/s | 30.6 KiB | 00m00s [31/97] Installing perl-File-Temp-1:0.2 100% | 161.6 MiB/s | 165.5 KiB | 00m00s [32/97] Installing perl-Class-Struct-0: 100% | 0.0 B/s | 25.9 KiB | 00m00s [33/97] Installing perl-IPC-Open3-0:1.2 100% | 0.0 B/s | 28.5 KiB | 00m00s [34/97] Installing perl-POSIX-0:2.23-52 100% | 227.2 MiB/s | 232.6 KiB | 00m00s [35/97] Installing perl-Term-ANSIColor- 100% | 96.9 MiB/s | 99.2 KiB | 00m00s [36/97] Installing perl-Pod-Perldoc-0:3 100% | 12.7 MiB/s | 169.2 KiB | 00m00s [37/97] Installing perl-podlators-1:6.0 100% | 24.1 MiB/s | 321.4 KiB | 00m00s [38/97] Installing perl-File-stat-0:1.1 100% | 0.0 B/s | 13.1 KiB | 00m00s [39/97] Installing perl-Socket-4:2.040- 100% | 119.4 MiB/s | 122.3 KiB | 00m00s [40/97] Installing perl-SelectSaver-0:1 100% | 0.0 B/s | 2.6 KiB | 00m00s [41/97] Installing perl-Symbol-0:1.09-5 100% | 0.0 B/s | 7.3 KiB | 00m00s [42/97] Installing perl-Pod-Usage-4:2.0 100% | 7.2 MiB/s | 87.9 KiB | 00m00s [43/97] Installing perl-IO-0:1.55-520.f 100% | 148.1 MiB/s | 151.7 KiB | 00m00s [44/97] Installing perl-Fcntl-0:1.20-52 100% | 0.0 B/s | 49.9 KiB | 00m00s [45/97] Installing perl-mro-0:1.29-520. 100% | 0.0 B/s | 42.7 KiB | 00m00s [46/97] Installing perl-overloading-0:0 100% | 0.0 B/s | 5.6 KiB | 00m00s [47/97] Installing perl-Text-ParseWords 100% | 0.0 B/s | 14.6 KiB | 00m00s [48/97] Installing perl-base-0:2.27-520 100% | 0.0 B/s | 13.0 KiB | 00m00s [49/97] Installing perl-Getopt-Long-1:2 100% | 143.8 MiB/s | 147.2 KiB | 00m00s [50/97] Installing perl-Getopt-Std-0:1. 100% | 0.0 B/s | 11.8 KiB | 00m00s [51/97] Installing perl-Storable-1:3.37 100% | 227.4 MiB/s | 232.8 KiB | 00m00s [52/97] Installing perl-MIME-Base64-0:3 100% | 43.2 MiB/s | 44.3 KiB | 00m00s [53/97] Installing perl-Errno-0:1.38-52 100% | 0.0 B/s | 8.8 KiB | 00m00s [54/97] Installing perl-vars-0:1.05-520 100% | 0.0 B/s | 4.3 KiB | 00m00s [55/97] Installing perl-parent-1:0.244- 100% | 0.0 B/s | 11.0 KiB | 00m00s [56/97] Installing perl-overload-0:1.40 100% | 0.0 B/s | 72.0 KiB | 00m00s [57/97] Installing perl-File-Basename-0 100% | 0.0 B/s | 14.6 KiB | 00m00s [58/97] Installing perl-constant-0:1.33 100% | 0.0 B/s | 27.4 KiB | 00m00s [59/97] Installing perl-Scalar-List-Uti 100% | 145.2 MiB/s | 148.7 KiB | 00m00s [60/97] Installing perl-Encode-4:3.21-5 100% | 195.6 MiB/s | 4.7 MiB | 00m00s [61/97] Installing perl-PathTools-0:3.9 100% | 90.1 MiB/s | 184.6 KiB | 00m00s [62/97] Installing perl-DynaLoader-0:1. 100% | 0.0 B/s | 32.5 KiB | 00m00s [63/97] Installing perl-Exporter-0:5.79 100% | 0.0 B/s | 55.6 KiB | 00m00s [64/97] Installing perl-Carp-0:1.54-520 100% | 23.3 MiB/s | 47.7 KiB | 00m00s [65/97] Installing perl-libs-4:5.42.0-5 100% | 277.3 MiB/s | 11.6 MiB | 00m00s [66/97] Installing perl-interpreter-4:5 100% | 9.0 MiB/s | 120.3 KiB | 00m00s [67/97] Installing perl-Term-Table-0:0. 100% | 79.3 MiB/s | 81.2 KiB | 00m00s [68/97] Installing perl-Time-HiRes-4:1. 100% | 115.1 MiB/s | 117.8 KiB | 00m00s [69/97] Installing perl-threads-1:2.43- 100% | 114.4 MiB/s | 117.1 KiB | 00m00s [70/97] Installing perl-Math-Complex-0: 100% | 0.0 B/s | 86.0 KiB | 00m00s [71/97] Installing perl-Math-BigInt-1:2 100% | 354.7 MiB/s | 1.1 MiB | 00m00s [72/97] Installing perl-JSON-PP-1:4.16- 100% | 10.8 MiB/s | 143.6 KiB | 00m00s [73/97] Installing perl-Test-Simple-3:1 100% | 130.1 MiB/s | 1.8 MiB | 00m00s [74/97] Installing tzdata-0:2025c-1.fc4 100% | 47.2 MiB/s | 1.5 MiB | 00m00s [75/97] Installing python-pip-wheel-0:2 100% | 602.0 MiB/s | 1.2 MiB | 00m00s [76/97] Installing mpdecimal-0:4.0.1-2. 100% | 213.7 MiB/s | 218.8 KiB | 00m00s [77/97] Installing expat-0:2.7.3-1.fc44 100% | 18.5 MiB/s | 303.2 KiB | 00m00s [78/97] Installing python3-libs-0:3.14. 100% | 308.4 MiB/s | 43.5 MiB | 00m00s [79/97] Installing kernel-headers-0:6.1 100% | 195.2 MiB/s | 7.0 MiB | 00m00s [80/97] Installing glibc-devel-0:2.42.9 100% | 170.4 MiB/s | 2.4 MiB | 00m00s [81/97] Installing libxcrypt-devel-0:4. 100% | 16.3 MiB/s | 33.3 KiB | 00m00s [82/97] Installing libstdc++-devel-0:16 100% | 446.5 MiB/s | 38.8 MiB | 00m00s [83/97] Installing hwloc-libs-0:2.12.0- 100% | 480.4 MiB/s | 2.9 MiB | 00m00s [84/97] Installing tbb-bind-0:2022.3.0- 100% | 20.1 MiB/s | 20.6 KiB | 00m00s [85/97] Installing make-1:4.4.1-11.fc43 100% | 94.7 MiB/s | 1.8 MiB | 00m00s [86/97] Installing gcc-0:16.0.0-0.3.fc4 100% | 368.6 MiB/s | 126.1 MiB | 00m00s [87/97] Installing gcc-c++-0:16.0.0-0.3 100% | 333.3 MiB/s | 48.3 MiB | 00m00s [88/97] Installing annobin-plugin-gcc-0 100% | 48.6 MiB/s | 697.2 KiB | 00m00s [89/97] Installing gcc-plugin-annobin-0 100% | 4.1 MiB/s | 58.8 KiB | 00m00s [90/97] Installing tbb-devel-0:2022.3.0 100% | 238.8 MiB/s | 1.4 MiB | 00m00s [91/97] Installing python3-0:3.14.2-1.f 100% | 2.1 MiB/s | 30.6 KiB | 00m00s [92/97] Installing perl-Test-Deep-0:1.2 100% | 91.4 MiB/s | 280.8 KiB | 00m00s [93/97] Installing perl-Clone-0:0.47-4. 100% | 33.4 MiB/s | 34.2 KiB | 00m00s [94/97] Installing perl-FindBin-0:1.54- 100% | 0.0 B/s | 7.2 KiB | 00m00s [95/97] Installing perl-lib-0:0.65-520. 100% | 0.0 B/s | 8.9 KiB | 00m00s [96/97] Installing zlib-ng-compat-devel 100% | 106.0 MiB/s | 108.6 KiB | 00m00s [97/97] Installing hostname-0:3.25-3.fc 100% | 349.3 KiB/s | 44.4 KiB | 00m00s Warning: skipped OpenPGP checks for 93 packages from repository: https_kojipkgs_fedoraproject_org_repos_f44_build_side_124978_latest_basearch Complete! Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1753228800 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-8.fc44.src.rpm Updating and loading repositories: Additional repo https_kojipkgs_fedorap 100% | 74.4 KiB/s | 3.5 KiB | 00m00s Copr repository 100% | 32.6 KiB/s | 1.5 KiB | 00m00s fedora 100% | 233.9 KiB/s | 25.7 KiB | 00m00s Repositories loaded. Nothing to do. Package "gcc-c++-16.0.0-0.3.fc44.x86_64" is already installed. Package "hostname-3.25-3.fc43.x86_64" is already installed. Package "make-1:4.4.1-11.fc43.x86_64" is already installed. Package "perl-Clone-0.47-4.fc43.x86_64" is already installed. Package "perl-Data-Dumper-2.191-521.fc43.x86_64" is already installed. Package "perl-FindBin-1.54-520.fc43.noarch" is already installed. Package "perl-Getopt-Long-1:2.58-520.fc43.noarch" is already installed. Package "perl-Test-Deep-1.205-2.fc43.noarch" is already installed. Package "perl-lib-0.65-520.fc43.x86_64" is already installed. Package "perl-interpreter-4:5.42.0-520.fc43.x86_64" is already installed. Package "python3-3.14.2-1.fc44.x86_64" is already installed. Package "tbb-devel-2022.3.0-1.fc44.x86_64" is already installed. Package "zlib-ng-compat-devel-2.3.2-2.fc44.x86_64" is already installed. Finish: build setup for bowtie-1.3.1-8.fc44.src.rpm Start: rpmbuild bowtie-1.3.1-8.fc44.src.rpm Building target platforms: x86_64 Building for target x86_64 setting SOURCE_DATE_EPOCH=1753228800 Executing(%mkbuilddir): /bin/sh -e /var/tmp/rpm-tmp.XKdQCH Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.WSvEKR + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd /builddir/build/BUILD/bowtie-1.3.1-build + rm -rf bowtie-1.3.1-src + /usr/lib/rpm/rpmuncompress -x /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-inspect + RPM_EC=0 ++ jobs -p + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.wEIaF6 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + /usr/bin/make -O -j4 V=1 VERBOSE=1 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_build.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from ebwt_build.cpp:10: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt_search_backtrack.h:8, from ebwt.h:1525: ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::hhCheckTop(uint32_t, uint32_t, uint32_t, const EList&, uint64_t)’: ebwt_search_backtrack.h:1245:52: warning: variable ‘hiHalfMms’ set but not used [-Wunused-but-set-variable=] 1245 | int loHalfMms = 0, hiHalfMms = 0; | ^~~~~~~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::sanityCheckEligibility(uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, TIndexOffU*, uint8_t*)’: ebwt_search_backtrack.h:1675:26: warning: variable ‘eligiblesVisited’ set but not used [-Wunused-but-set-variable=] 1675 | uint32_t eligiblesVisited = 0; | ^~~~~~~~~~~~~~~~ ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In member function ‘void Ebwt::checkOrigs(const EList >&, bool) const’: ebwt.h:2791:20: warning: variable ‘restOff’ set but not used [-Wunused-but-set-variable=] 2791 | TIndexOffU restOff = 0; | ^~~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h:3882:20: warning: variable ‘seqsRead’ set but not used [-Wunused-but-set-variable=] 3882 | TIndexOffU seqsRead = 0; | ^~~~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h:3882:20: warning: variable ‘seqsRead’ set but not used [-Wunused-but-set-variable=] 3882 | TIndexOffU seqsRead = 0; | ^~~~~~~~ In file included from blockwise_sa.h:17, from ebwt.h:25: diff_sample.h: In instantiation of ‘EList getDeltaMap(T, const EList&) [with T = unsigned int]’: required from ‘DifferenceCoverSample::DifferenceCoverSample(const TStr&, uint32_t, bool, bool, std::ostream&) [with TStr = SString; uint32_t = unsigned int; std::ostream = std::basic_ostream]’ diff_sample.h:534:20: 534 | _dmap(getDeltaMap(_v, _ds)), | ~~~~~~~~~~~^~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:378:10: 378 | _dc = new TDC(this->text(), _dcV, this->verbose(), this->sanityCheck()); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:464:16: warning: variable ‘amapEnts’ set but not used [-Wunused-but-set-variable=] 464 | size_t amapEnts = 1; | ^~~~~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::buildSPrime(EList&, size_t) [with TStr = SString; size_t = long unsigned int]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = SString]’ diff_sample.h:839:2: 839 | buildSPrime(sPrime, padding); | ^~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:738:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 738 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::doBuiltSanityCheck() const [with TStr = SString]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = SString]’ diff_sample.h:994:26: 994 | if(this->sanityCheck()) doBuiltSanityCheck(); | ^~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:669:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 669 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::buildSPrime(EList&, size_t) [with TStr = S2bDnaString; size_t = long unsigned int]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = S2bDnaString]’ diff_sample.h:839:2: 839 | buildSPrime(sPrime, padding); | ^~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = S2bDnaString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = S2bDnaString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:738:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 738 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::doBuiltSanityCheck() const [with TStr = S2bDnaString]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = S2bDnaString]’ diff_sample.h:994:26: 994 | if(this->sanityCheck()) doBuiltSanityCheck(); | ^~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = S2bDnaString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = S2bDnaString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:669:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 669 | TIndexOffU added = 0; | ^~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_build_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_build.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from ebwt_build.cpp:10: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt_search_backtrack.h:8, from ebwt.h:1525: ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::hhCheckTop(uint32_t, uint32_t, uint32_t, const EList&, uint64_t)’: ebwt_search_backtrack.h:1245:52: warning: variable ‘hiHalfMms’ set but not used [-Wunused-but-set-variable=] 1245 | int loHalfMms = 0, hiHalfMms = 0; | ^~~~~~~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::sanityCheckEligibility(uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, TIndexOffU*, uint8_t*)’: ebwt_search_backtrack.h:1674:26: warning: variable ‘cumSz’ set but not used [-Wunused-but-set-variable=] 1674 | uint32_t cumSz = 0; | ^~~~~ ebwt_search_backtrack.h:1675:26: warning: variable ‘eligiblesVisited’ set but not used [-Wunused-but-set-variable=] 1675 | uint32_t eligiblesVisited = 0; | ^~~~~~~~~~~~~~~~ ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In member function ‘void Ebwt::checkOrigs(const EList >&, bool) const’: ebwt.h:2791:20: warning: variable ‘restOff’ set but not used [-Wunused-but-set-variable=] 2791 | TIndexOffU restOff = 0; | ^~~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h:3882:20: warning: variable ‘seqsRead’ set but not used [-Wunused-but-set-variable=] 3882 | TIndexOffU seqsRead = 0; | ^~~~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h:3882:20: warning: variable ‘seqsRead’ set but not used [-Wunused-but-set-variable=] 3882 | TIndexOffU seqsRead = 0; | ^~~~~~~~ In file included from blockwise_sa.h:17, from ebwt.h:25: diff_sample.h: In instantiation of ‘EList getDeltaMap(T, const EList&) [with T = unsigned int]’: required from ‘DifferenceCoverSample::DifferenceCoverSample(const TStr&, uint32_t, bool, bool, std::ostream&) [with TStr = SString; uint32_t = unsigned int; std::ostream = std::basic_ostream]’ diff_sample.h:534:20: 534 | _dmap(getDeltaMap(_v, _ds)), | ~~~~~~~~~~~^~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:378:10: 378 | _dc = new TDC(this->text(), _dcV, this->verbose(), this->sanityCheck()); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:464:16: warning: variable ‘amapEnts’ set but not used [-Wunused-but-set-variable=] 464 | size_t amapEnts = 1; | ^~~~~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::buildSPrime(EList&, size_t) [with TStr = SString; size_t = long unsigned int]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = SString]’ diff_sample.h:839:2: 839 | buildSPrime(sPrime, padding); | ^~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:738:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 738 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::doBuiltSanityCheck() const [with TStr = SString]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = SString]’ diff_sample.h:994:26: 994 | if(this->sanityCheck()) doBuiltSanityCheck(); | ^~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:669:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 669 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::buildSPrime(EList&, size_t) [with TStr = S2bDnaString; size_t = long unsigned int]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = S2bDnaString]’ diff_sample.h:839:2: 839 | buildSPrime(sPrime, padding); | ^~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = S2bDnaString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = S2bDnaString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = S2bDnaString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:738:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 738 | TIndexOffU added = 0; | ^~~~~ diff_sample.h: In instantiation of ‘void DifferenceCoverSample::doBuiltSanityCheck() const [with TStr = S2bDnaString]’: required from ‘void DifferenceCoverSample::build(int) [with TStr = S2bDnaString]’ diff_sample.h:994:26: 994 | if(this->sanityCheck()) doBuiltSanityCheck(); | ^~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = S2bDnaString]’ blockwise_sa.h:379:14: 379 | _dc->build(this->_nthreads); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = S2bDnaString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = S2bDnaString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:669:20: warning: variable ‘added’ set but not used [-Wunused-but-set-variable=] 669 | TIndexOffU added = 0; | ^~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_build_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_inspect.cpp:7: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from bowtie_inspect.cpp:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_inspect.cpp:7: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from bowtie_inspect.cpp:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from aligner.h:17, from ebwt_search.cpp:17: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from aligner.h:18: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt_search_backtrack.h:8, from ebwt.h:1525: ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::hhCheckTop(uint32_t, uint32_t, uint32_t, const EList&, uint64_t)’: ebwt_search_backtrack.h:1245:52: warning: variable ‘hiHalfMms’ set but not used [-Wunused-but-set-variable=] 1245 | int loHalfMms = 0, hiHalfMms = 0; | ^~~~~~~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::sanityCheckEligibility(uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, TIndexOffU*, uint8_t*)’: ebwt_search_backtrack.h:1674:26: warning: variable ‘cumSz’ set but not used [-Wunused-but-set-variable=] 1674 | uint32_t cumSz = 0; | ^~~~~ ebwt_search_backtrack.h:1675:26: warning: variable ‘eligiblesVisited’ set but not used [-Wunused-but-set-variable=] 1675 | uint32_t eligiblesVisited = 0; | ^~~~~~~~~~~~~~~~ ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In member function ‘void Ebwt::checkOrigs(const EList >&, bool) const’: ebwt.h:2791:20: warning: variable ‘restOff’ set but not used [-Wunused-but-set-variable=] 2791 | TIndexOffU restOff = 0; | ^~~~~~~ ebwt_search.cpp: In function ‘void exactSearch(PatternComposer&, HitSink&, Ebwt&, EList >&)’: ebwt_search.cpp:1426:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1426 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void mismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:1807:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1807 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void twoOrThreeMismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&, bool)’: ebwt_search.cpp:2303:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2303 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void seededQualCutoffSearchFull(int, int, int, PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:2849:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2849 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from pat.h:17, from pat.cpp:10: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ pat.cpp: In member function ‘virtual std::pair SoloPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:148:33: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 148 | cur_++; | ^~~~ pat.cpp: In member function ‘virtual std::pair DualPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:176:52: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 176 | if(cur + 1 > cur_) cur_++; | ^~~~ pat.cpp:205:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 205 | cur_++; | ^~~~ ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_search_util.h:8, from ebwt_search_util.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt_search_util.h:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from log.h:5, from log.cpp:5: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit_set.cpp:11: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from bitset.h:10, from hit.h:15, from sam.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from hit.cpp:2: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from aligner.h:17, from ebwt_search.cpp:17: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from aligner.h:18: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt_search_backtrack.h:8, from ebwt.h:1525: ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::hhCheckTop(uint32_t, uint32_t, uint32_t, const EList&, uint64_t)’: ebwt_search_backtrack.h:1245:52: warning: variable ‘hiHalfMms’ set but not used [-Wunused-but-set-variable=] 1245 | int loHalfMms = 0, hiHalfMms = 0; | ^~~~~~~~~ ebwt_search_backtrack.h: In member function ‘bool GreedyDFSRangeSource::sanityCheckEligibility(uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, uint32_t, TIndexOffU*, uint8_t*)’: ebwt_search_backtrack.h:1675:26: warning: variable ‘eligiblesVisited’ set but not used [-Wunused-but-set-variable=] 1675 | uint32_t eligiblesVisited = 0; | ^~~~~~~~~~~~~~~~ ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In member function ‘void Ebwt::checkOrigs(const EList >&, bool) const’: ebwt.h:2791:20: warning: variable ‘restOff’ set but not used [-Wunused-but-set-variable=] 2791 | TIndexOffU restOff = 0; | ^~~~~~~ ebwt_search.cpp: In function ‘void exactSearch(PatternComposer&, HitSink&, Ebwt&, EList >&)’: ebwt_search.cpp:1426:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1426 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void mismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:1807:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1807 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void twoOrThreeMismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&, bool)’: ebwt_search.cpp:2303:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2303 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void seededQualCutoffSearchFull(int, int, int, PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:2849:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2849 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from pat.h:17, from pat.cpp:10: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ pat.cpp: In member function ‘virtual std::pair SoloPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:148:33: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 148 | cur_++; | ^~~~ pat.cpp: In member function ‘virtual std::pair DualPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:176:52: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 176 | if(cur + 1 > cur_) cur_++; | ^~~~ pat.cpp:205:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 205 | cur_++; | ^~~~ ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_search_util.h:8, from ebwt_search_util.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt_search_util.h:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ ebwt_search_util.h: In member function ‘bool PartialAlignment::repOk(uint32_t, uint32_t, const BTString&, bool)’: ebwt_search_util.h:70:26: warning: variable ‘qual’ set but not used [-Wunused-but-set-variable=] 70 | uint32_t qual = 0; | ^~~~ ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from log.h:5, from log.cpp:5: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit_set.cpp:11: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from bitset.h:10, from hit.h:15, from sam.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from hit.cpp:2: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_build.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from ebwt_build.cpp:10: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ In file included from blockwise_sa.h:17, from ebwt.h:25: diff_sample.h: In instantiation of ‘EList getDeltaMap(T, const EList&) [with T = unsigned int]’: required from ‘DifferenceCoverSample::DifferenceCoverSample(const TStr&, uint32_t, bool, bool, std::ostream&) [with TStr = SString; uint32_t = unsigned int; std::ostream = std::basic_ostream]’ diff_sample.h:534:20: 534 | _dmap(getDeltaMap(_v, _ds)), | ~~~~~~~~~~~^~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:378:10: 378 | _dc = new TDC(this->text(), _dcV, this->verbose(), this->sanityCheck()); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:464:16: warning: variable ‘amapEnts’ set but not used [-Wunused-but-set-variable=] 464 | size_t amapEnts = 1; | ^~~~~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned int, unsigned int, unsigned int, int, EList&, EList&, EList&, unsigned int, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_build_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_build.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from ebwt_build.cpp:10: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ ebwt.h: In instantiation of ‘void Ebwt::joinToDisk(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, TStr&, std::ostream&, std::ostream&, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ostream = std::basic_ostream; uint32_t = unsigned int]’: required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = S2bDnaString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:656:16: 656 | joinToDisk(is, szs, plens, sztot, refparams, s, out1, out2, seed); | ~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = S2bDnaString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = S2bDnaString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:606:25: 606 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ ebwt.h:3890:28: warning: variable ‘patoff’ set but not used [-Wunused-but-set-variable=] 3890 | TIndexOffU patoff = 0; | ^~~~~~ In file included from blockwise_sa.h:17, from ebwt.h:25: diff_sample.h: In instantiation of ‘EList getDeltaMap(T, const EList&) [with T = unsigned int]’: required from ‘DifferenceCoverSample::DifferenceCoverSample(const TStr&, uint32_t, bool, bool, std::ostream&) [with TStr = SString; uint32_t = unsigned int; std::ostream = std::basic_ostream]’ diff_sample.h:534:20: 534 | _dmap(getDeltaMap(_v, _ds)), | ~~~~~~~~~~~^~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::build() [with TStr = SString]’ blockwise_sa.h:378:10: 378 | _dc = new TDC(this->text(), _dcV, this->verbose(), this->sanityCheck()); | ^~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~ required from ‘void KarkkainenBlockwiseSA::reset() [with TStr = SString]’ blockwise_sa.h:358:4: 358 | build(); | ^~~~~ required from ‘KarkkainenBlockwiseSA::KarkkainenBlockwiseSA(const TStr&, TIndexOffU, int, uint32_t, uint32_t, bool, bool, bool, std::string, std::ostream&) [with TStr = SString; TIndexOffU = long unsigned int; uint32_t = unsigned int; std::string = std::__cxx11::basic_string; std::ostream = std::basic_ostream]’ blockwise_sa.h:199:30: 199 | { _randomSrc.init(__seed); reset(); } | ^~~~~ required from ‘void Ebwt::initFromVector(EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, std::ofstream&, std::ofstream&, const std::string&, int, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, uint32_t) [with TStr = SString; TIndexOffU = long unsigned int; std::ofstream = std::basic_ofstream; std::string = std::__cxx11::basic_string; uint32_t = unsigned int]’ ebwt.h:778:33: 778 | KarkkainenBlockwiseSA bsa(s, bmax, nthreads, dcv, seed, _sanity, _passMemExc, _verbose, outfile); | ^~~ required from ‘Ebwt::Ebwt(TStr, bool, int32_t, int32_t, int32_t, int32_t, int32_t, int, const std::string&, bool, bool, TIndexOffU, TIndexOffU, TIndexOffU, int, EList&, EList&, EList&, TIndexOffU, const RefReadInParams&, uint32_t, int32_t, int32_t, bool, bool, bool, bool) [with TStr = SString; int32_t = int; std::string = std::__cxx11::basic_string; TIndexOffU = long unsigned int; uint32_t = unsigned int]’ ebwt.h:516:23: 516 | initFromVector( | ~~~~~~~~~~~~~~~~~~~~^ 517 | is, | ~~~ 518 | szs, | ~~~~ 519 | plens, | ~~~~~~ 520 | sztot, | ~~~~~~ 521 | refparams, | ~~~~~~~~~~ 522 | fout1, | ~~~~~~ 523 | fout2, | ~~~~~~ 524 | file, | ~~~~~ 525 | nthreads, | ~~~~~~~~~ 526 | useBlockwise, | ~~~~~~~~~~~~~ 527 | bmax, | ~~~~~ 528 | bmaxSqrtMult, | ~~~~~~~~~~~~~ 529 | bmaxDivN, | ~~~~~~~~~ 530 | dcv, | ~~~~ 531 | seed); | ~~~~~ required from ‘void driver(const std::string&, EList >&, const std::string&, bool) [with TStr = SString; std::string = std::__cxx11::basic_string]’ ebwt_build.cpp:420:7: 420 | Ebwt ebwt(TStr(), | ^~~~ required from here ebwt_build.cpp:595:26: 595 | driver(infile, infiles, outfile); | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~~~~~~~~~~~~~~~~~~~ diff_sample.h:464:16: warning: variable ‘amapEnts’ set but not used [-Wunused-but-set-variable=] 464 | size_t amapEnts = 1; | ^~~~~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(S2bDnaString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’ at ebwt.h:496:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt >(SString, bool, int, int, int, int, int, int, std::__cxx11::basic_string, std::allocator > const&, bool, bool, unsigned long, unsigned long, unsigned long, int, EList&, EList&, EList&, unsigned long, RefReadInParams const&, unsigned int, int, int, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_build_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_inspect.cpp:7: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from bowtie_inspect.cpp:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_inspect.cpp:7: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from bowtie_inspect.cpp:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from aligner.h:17, from ebwt_search.cpp:17: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from aligner.h:18: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt_search.cpp: In function ‘void exactSearch(PatternComposer&, HitSink&, Ebwt&, EList >&)’: ebwt_search.cpp:1426:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1426 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void mismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:1807:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1807 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void twoOrThreeMismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&, bool)’: ebwt_search.cpp:2303:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2303 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void seededQualCutoffSearchFull(int, int, int, PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:2849:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2849 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from pat.h:17, from pat.cpp:10: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ pat.cpp: In member function ‘virtual std::pair SoloPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:148:33: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 148 | cur_++; | ^~~~ pat.cpp: In member function ‘virtual std::pair DualPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:176:52: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 176 | if(cur + 1 > cur_) cur_++; | ^~~~ pat.cpp:205:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 205 | cur_++; | ^~~~ ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_search_util.h:8, from ebwt_search_util.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt_search_util.h:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from log.h:5, from log.cpp:5: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit_set.cpp:11: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from bitset.h:10, from hit.h:15, from sam.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from hit.cpp:2: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -DPOPCNT_CAPABILITY -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2025-07-23T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from aligner.h:17, from ebwt_search.cpp:17: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt.h:28, from aligner.h:18: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ In file included from ebwt.h:1525: ebwt_search_backtrack.h: In member function ‘virtual void EbwtRangeSourceDriver::initRangeSource(const BTString&)’: ebwt_search_backtrack.h:2726:26: warning: variable ‘sLeft’ set but not used [-Wunused-but-set-variable=] 2726 | uint32_t sLeft = s >> 1; | ^~~~~ ebwt_search.cpp: In function ‘void exactSearch(PatternComposer&, HitSink&, Ebwt&, EList >&)’: ebwt_search.cpp:1426:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1426 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void mismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:1807:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 1807 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void twoOrThreeMismatchSearchFull(PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&, bool)’: ebwt_search.cpp:2303:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2303 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ ebwt_search.cpp: In function ‘void seededQualCutoffSearchFull(int, int, int, PatternComposer&, HitSink&, Ebwt&, Ebwt&, EList >&)’: ebwt_search.cpp:2849:54: warning: variable ‘steal_ctr’ set but not used [-Wunused-but-set-variable=] 2849 | int orig_threads = nthreads, steal_ctr = 1; | ^~~~~~~~~ In file included from ebwt.h:42: In member function ‘ProcessorSupport::POPCNTenabled()’, inlined from ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’ at ebwt.h:422:49: processor_support.h:55:26: warning: ‘MEM[(unsigned int *)®s + 8B]’ may be used uninitialized [-Wmaybe-uninitialized] 55 | if( !( (regs.ECX & BIT(20)) && (regs.ECX & BIT(23)) ) ) return false; | ~~~~~~~~~~^~~~~~~~~~ processor_support.h: In member function ‘Ebwt::Ebwt(std::__cxx11::basic_string, std::allocator > const&, int, bool, int, int, bool, bool, bool, bool, bool, bool, bool, bool, bool)’: processor_support.h:43:12: note: ‘MEM[(unsigned int *)®s + 8B]’ was declared here 43 | regs_t regs; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ref_read.h:13, from ref_read.cpp:2: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from bt2_locks.cpp:3: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from pat.h:17, from pat.cpp:10: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ pat.cpp: In member function ‘virtual std::pair SoloPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:148:33: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 148 | cur_++; | ^~~~ pat.cpp: In member function ‘virtual std::pair DualPatternComposer::nextBatch(PerThreadReadBuf&)’: pat.cpp:176:52: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 176 | if(cur + 1 > cur_) cur_++; | ^~~~ pat.cpp:205:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 205 | cur_++; | ^~~~ ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from ebwt_search_util.h:8, from ebwt_search_util.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from ebwt_search_util.h:9: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from log.h:5, from log.cpp:5: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit_set.cpp:11: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from bitset.h:10, from hit.h:15, from sam.cpp:8: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from hit.cpp:1: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ In file included from hit.cpp:2: hit.h: In member function ‘void HitSink::tallyAlignments(size_t, size_t, bool)’: hit.h:215:31: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 215 | ptNumAligned_[threadId] ++; | ~~~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportMaxed(EList&, size_t, PatternSourcePerThread&)’: hit.h:499:37: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 499 | ptNumMaxed_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~^ hit.h: In member function ‘virtual void HitSink::reportUnaligned(size_t, PatternSourcePerThread&)’: hit.h:510:41: warning: ‘++’ expression of ‘volatile’-qualified type is deprecated [-Wvolatile] 510 | ptNumUnaligned_[threadId]++; | ~~~~~~~~~~~~~~~~~~~~~~~~^ bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from threading.h:36, from ds.h:30, from bowtie_main.cpp:13: bt2_locks.h:65:88: warning: ‘volatile’-qualified parameter is deprecated [-Wvolatile] 65 | void spin_while_eq(const volatile std::atomic_bool& value, const volatile bool expected) { | ~~~~~~~~~~~~~~~~~~~~^~~~~~~~ btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here + RPM_EC=0 ++ jobs -p + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.lm3qKj + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + '[' /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT '!=' / ']' + rm -rf /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT ++ dirname /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT + mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build + mkdir /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/bin ; \ done + mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie + cp -a reads /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT//usr/bin/ + /usr/bin/find-debuginfo -j4 --strict-build-id -m -i --build-id-seed 1.3.1-8.fc44 --unique-debug-suffix -1.3.1-8.fc44.x86_64 --unique-debug-src-base bowtie-1.3.1-8.fc44.x86_64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 110000000 --remove-section .gnu.build.attributes -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src find-debuginfo: starting Extracting debug info from 12 files DWARF-compressing 12 files sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. Creating .debug symlinks for symlinks to ELF files Copying sources found by 'debugedit -l' to /usr/src/debug/bowtie-1.3.1-8.fc44.x86_64 find-debuginfo: done + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig + COMPRESS='gzip -9 -n' + COMPRESS_EXT=.gz + /usr/lib/rpm/brp-compress + /usr/lib/rpm/redhat/brp-strip-lto /usr/bin/strip + /usr/lib/rpm/check-rpaths + /usr/lib/rpm/redhat/brp-mangle-shebangs mangling shebang in /usr/share/bowtie/scripts/make_mm8.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg19.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/run-hbb.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/build_test.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg18.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm9.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_c_elegans.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/bowtie-hbb.sh from /bin/bash to #!/usr/bin/bash mangling shebang in /usr/share/bowtie/scripts/make_canFam2.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_a_thaliana_tair.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_m_musculus_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_b_taurus_UMD3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_s_cerevisiae.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_d_melanogaster.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_galGal3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi36.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_e_coli.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_rn4.sh from /bin/sh to #!/usr/bin/sh + /usr/lib/rpm/brp-remove-la-files + /usr/lib/rpm/redhat/brp-python-rpm-in-distinfo + env /usr/lib/rpm/redhat/brp-python-bytecompile '' 1 0 -j4 + /usr/lib/rpm/redhat/brp-python-hardlink + /usr/bin/add-det --brp -j4 /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT Scanned 17 directories and 168 files, processed 0 inodes, 0 modified (0 replaced + 0 rewritten), 0 unsupported format, 0 errors + /usr/bin/linkdupes --brp /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr Scanned 16 directories and 168 files, considered 168 files, read 4 files, linked 0 files, 0 errors sum of sizes of linked files: 0 bytes Reading /builddir/build/BUILD/bowtie-1.3.1-build/SPECPARTS/rpm-debuginfo.specpart Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.8Byw9N + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -m64 -march=x86-64 -mtune=generic -fasynchronous-unwind-tables -fstack-clash-protection -fcf-protection -mtls-dialect=gnu2 -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cstrip=none -Cforce-frame-pointers=yes -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,pack-relative-relocs -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-hardened-ld-errors -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl scripts/test/cs_dec.pl scripts/test/random_bowtie_tests.sh scripts/test/btface.py scripts/test/long_read.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/random_bowtie_tests.pl scripts/test/args.pl scripts/test/DNA.pm scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/cs_trim.pl scripts/test/btdata.py scripts/test/build_big.py scripts/test/large_idx.py scripts/test/all.sh + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%)@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 %) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 0 (0.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (0.00%) # reads that failed to align: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 PASSED + RPM_EC=0 ++ jobs -p + exit 0 Processing files: bowtie-1.3.1-8.fc44.x86_64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.IEbs4w + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + export LC_ALL=C.UTF-8 + LC_ALL=C.UTF-8 + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/MANUAL /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/NEWS /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/VERSION /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/AUTHORS /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/TUTORIAL /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/doc/manual.html /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/doc/style.css /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/doc/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.Ko79Hs + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + export LC_ALL=C.UTF-8 + LC_ALL=C.UTF-8 + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-build/bowtie-1.3.1-src/LICENSE /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT/usr/share/licenses/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Provides: bowtie = 1.3.1-8.fc44 bowtie(x86-64) = 1.3.1-8.fc44 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /usr/bin/bash /usr/bin/perl /usr/bin/python3 /usr/bin/sh libc.so.6()(64bit) libc.so.6(GLIBC_2.14)(64bit) libc.so.6(GLIBC_2.2.5)(64bit) libc.so.6(GLIBC_2.3.4)(64bit) libc.so.6(GLIBC_2.32)(64bit) libc.so.6(GLIBC_2.33)(64bit) libc.so.6(GLIBC_2.34)(64bit) libc.so.6(GLIBC_2.38)(64bit) libc.so.6(GLIBC_2.4)(64bit) libc.so.6(GLIBC_2.7)(64bit) libc.so.6(GLIBC_ABI_DT_RELR)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.3.1)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.2.5)(64bit) libm.so.6(GLIBC_2.27)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.15)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.26)(64bit) libstdc++.so.6(GLIBCXX_3.4.29)(64bit) libstdc++.so.6(GLIBCXX_3.4.30)(64bit) libstdc++.so.6(GLIBCXX_3.4.31)(64bit) libstdc++.so.6(GLIBCXX_3.4.32)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-8.fc44.x86_64 Provides: bowtie-debugsource = 1.3.1-8.fc44 bowtie-debugsource(x86-64) = 1.3.1-8.fc44 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-8.fc44.x86_64 Provides: bowtie-debuginfo = 1.3.1-8.fc44 bowtie-debuginfo(x86-64) = 1.3.1-8.fc44 debuginfo(build-id) = 1fdf711b664621c275a69c55e255a8be1807d8e5 debuginfo(build-id) = 35a45fdf5c89b77cd80d453b979f6dd55f74d3b1 debuginfo(build-id) = 4144032ac15114e994a9b7849945e2f70707e629 debuginfo(build-id) = 56fd7d3c033f163504299bb75119b58a279df4a4 debuginfo(build-id) = 5d8b0eaf55b86081670bbceab7d83631a1237938 debuginfo(build-id) = 84b61acbc9550467c08a162dd4dc046f09d9410f debuginfo(build-id) = c00432d91176512e9115c4c7539106e80bed2abf debuginfo(build-id) = d3014f8e36c863290fff779015fb8b60eb26501b debuginfo(build-id) = df3cff3ba69bb2bd703951a3661d29b38b525e04 debuginfo(build-id) = e5cd22f75ca2307b14fd53f1d63b0042fd03ab01 debuginfo(build-id) = e95f627f0473314281135e919618792e965e408c debuginfo(build-id) = f370481b141f167104625887963d4b63670ca108 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(x86-64) = 1.3.1-8.fc44 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILD/bowtie-1.3.1-build/BUILDROOT Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-8.fc44.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-1.3.1-8.fc44.x86_64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-8.fc44.x86_64.rpm Executing(rmbuild): /bin/sh -e /var/tmp/rpm-tmp.ZHuZ45 + umask 022 + cd /builddir/build/BUILD/bowtie-1.3.1-build + test -d /builddir/build/BUILD/bowtie-1.3.1-build + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w /builddir/build/BUILD/bowtie-1.3.1-build + rm -rf /builddir/build/BUILD/bowtie-1.3.1-build + RPM_EC=0 ++ jobs -p + exit 0 Finish: rpmbuild bowtie-1.3.1-8.fc44.src.rpm Finish: build phase for bowtie-1.3.1-8.fc44.src.rpm INFO: chroot_scan: 1 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-x86_64-1766684798.158760/root/var/log/dnf5.log INFO: chroot_scan: creating tarball /var/lib/copr-rpmbuild/results/chroot_scan.tar.gz /bin/tar: Removing leading `/' from member names INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-8.fc44.src.rpm) Config(child) 3 minutes 35 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool Package info: { "packages": [ { "name": "bowtie-debuginfo", "epoch": null, "version": "1.3.1", "release": "8.fc44", "arch": "x86_64" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "8.fc44", "arch": "src" }, { "name": "bowtie-debugsource", "epoch": null, "version": "1.3.1", "release": "8.fc44", "arch": "x86_64" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "8.fc44", "arch": "x86_64" } ] } RPMResults finished