Warning: Permanently added '3.94.163.203' (ED25519) to the list of known hosts. You can reproduce this build on your computer by running: sudo dnf install copr-rpmbuild /usr/bin/copr-rpmbuild --verbose --drop-resultdir --task-url https://copr.fedorainfracloud.org/backend/get-build-task/6407736-fedora-rawhide-aarch64 --chroot fedora-rawhide-aarch64 Version: 0.69 PID: 11975 Logging PID: 11976 Task: {'appstream': False, 'background': True, 'build_id': 6407736, 'buildroot_pkgs': [], 'chroot': 'fedora-rawhide-aarch64', 'enable_net': False, 'fedora_review': False, 'git_hash': '6c519e4ae7411be48d70d665a66c90b6050bcfa4', 'git_repo': 'https://copr-dist-git.fedorainfracloud.org/git/tuliom/zlib-ng-compat-mpb/bowtie', 'isolation': 'default', 'memory_reqs': 2048, 'package_name': 'bowtie', 'package_version': '1.3.1-2', 'project_dirname': 'zlib-ng-compat-mpb', 'project_name': 'zlib-ng-compat-mpb', 'project_owner': 'tuliom', 'repo_priority': None, 'repos': [{'baseurl': 'https://download.copr.fedorainfracloud.org/results/tuliom/zlib-ng-compat-mpb/fedora-rawhide-aarch64/', 'id': 'copr_base', 'name': 'Copr repository', 'priority': None}], 'sandbox': 'tuliom/zlib-ng-compat-mpb--tuliom', 'source_json': {}, 'source_type': None, 'submitter': 'tuliom', 'tags': [], 'task_id': '6407736-fedora-rawhide-aarch64', 'timeout': 115200, 'uses_devel_repo': False, 'with_opts': [], 'without_opts': []} Running: git clone https://copr-dist-git.fedorainfracloud.org/git/tuliom/zlib-ng-compat-mpb/bowtie /var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie --depth 500 --no-single-branch --recursive cmd: ['git', 'clone', 'https://copr-dist-git.fedorainfracloud.org/git/tuliom/zlib-ng-compat-mpb/bowtie', '/var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie', '--depth', '500', '--no-single-branch', '--recursive'] cwd: . rc: 0 stdout: stderr: Cloning into '/var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie'... Running: git checkout 6c519e4ae7411be48d70d665a66c90b6050bcfa4 -- cmd: ['git', 'checkout', '6c519e4ae7411be48d70d665a66c90b6050bcfa4', '--'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie rc: 0 stdout: stderr: Note: switching to '6c519e4ae7411be48d70d665a66c90b6050bcfa4'. You are in 'detached HEAD' state. You can look around, make experimental changes and commit them, and you can discard any commits you make in this state without impacting any branches by switching back to a branch. If you want to create a new branch to retain commits you create, you may do so (now or later) by using -c with the switch command. Example: git switch -c Or undo this operation with: git switch - Turn off this advice by setting config variable advice.detachedHead to false HEAD is now at 6c519e4 automatic import of bowtie Running: copr-distgit-client sources cmd: ['copr-distgit-client', 'sources'] cwd: /var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie rc: 0 stdout: stderr: INFO: Reading stdout from command: git rev-parse --abbrev-ref HEAD INFO: Reading stdout from command: git rev-parse HEAD INFO: Reading sources specification file: sources INFO: Downloading bowtie-1.3.1-src.zip INFO: Reading stdout from command: curl --help all INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-src.zip --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/tuliom/zlib-ng-compat-mpb/bowtie/bowtie-1.3.1-src.zip/md5/192c0c8d77e352efaa202b5bb684200d/bowtie-1.3.1-src.zip % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed /usr/bin/tail: /var/lib/copr-rpmbuild/main.log: file truncated 100 7293k 100 7293k 0 0 82.4M 0 --:--:-- --:--:-- --:--:-- 82.8M INFO: Reading stdout from command: md5sum bowtie-1.3.1-src.zip INFO: Downloading bowtie-1.3.1-tests.tgz INFO: Calling: curl -H Pragma: -o bowtie-1.3.1-tests.tgz --location --connect-timeout 60 --retry 3 --retry-delay 10 --remote-time --show-error --fail --retry-all-errors https://copr-dist-git.fedorainfracloud.org/repo/pkgs/tuliom/zlib-ng-compat-mpb/bowtie/bowtie-1.3.1-tests.tgz/md5/efa4aeb774a0cd0255fe3f24caf64187/bowtie-1.3.1-tests.tgz % Total % Received % Xferd Average Speed Time Time Time Current Dload Upload Total Spent Left Speed 100 34134 100 34134 0 0 994k 0 --:--:-- --:--:-- --:--:-- 1010k INFO: Reading stdout from command: md5sum bowtie-1.3.1-tests.tgz Running (timeout=115200): unbuffer mock --spec /var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie/bowtie.spec --sources /var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie --resultdir /var/lib/copr-rpmbuild/results --uniqueext 1694959012.757365 -r /var/lib/copr-rpmbuild/results/configs/child.cfg INFO: mock.py version 5.1 starting (python version = 3.11.3, NVR = mock-5.1-1.fc38)... Start(bootstrap): init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish(bootstrap): init plugins Start: init plugins INFO: tmpfs initialized INFO: selinux enabled INFO: chroot_scan: initialized INFO: compress_logs: initialized Finish: init plugins INFO: Signal handler active Start: run INFO: Start(/var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie/bowtie.spec) Config(fedora-rawhide-aarch64) Start: clean chroot Finish: clean chroot Mock Version: 5.1 INFO: Mock Version: 5.1 Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-aarch64-bootstrap-1694959012.757365/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata INFO: Guessed host environment type: unknown INFO: Using bootstrap image: registry.fedoraproject.org/fedora:rawhide INFO: Pulling image: registry.fedoraproject.org/fedora:rawhide INFO: Copy content of container registry.fedoraproject.org/fedora:rawhide to /var/lib/mock/fedora-rawhide-aarch64-bootstrap-1694959012.757365/root INFO: Checking that registry.fedoraproject.org/fedora:rawhide image matches host's architecture INFO: mounting registry.fedoraproject.org/fedora:rawhide with podman image mount INFO: image registry.fedoraproject.org/fedora:rawhide as /var/lib/containers/storage/overlay/e5f044ed8989be9cd40b2c2f59c88ac61d88bd9a229f7883760df7f5fca6dba7/merged INFO: umounting image registry.fedoraproject.org/fedora:rawhide (/var/lib/containers/storage/overlay/e5f044ed8989be9cd40b2c2f59c88ac61d88bd9a229f7883760df7f5fca6dba7/merged) with podman image umount INFO: Package manager dnf detected and used (fallback) INFO: Bootstrap image not marked ready Start(bootstrap): installing dnf tooling No matches found for the following disable plugin patterns: local, spacewalk, versionlock Copr repository 5.9 MB/s | 933 kB 00:00 fedora 51 MB/s | 69 MB 00:01 Package python3-dnf-4.16.2-4.fc40.noarch is already installed. Dependencies resolved. ================================================================================ Package Arch Version Repository Size ================================================================================ Installing: python3-dnf-plugins-core noarch 4.4.2-1.fc39 fedora 293 k Installing dependencies: dbus-libs aarch64 1:1.14.10-1.fc40 fedora 156 k python3-dateutil noarch 1:2.8.2-10.fc39 fedora 355 k python3-dbus aarch64 1.3.2-4.fc39 fedora 157 k python3-distro noarch 1.8.0-6.fc39 fedora 49 k python3-six noarch 1.16.0-12.fc39 fedora 41 k python3-systemd aarch64 235-5.fc39 fedora 107 k Transaction Summary ================================================================================ Install 7 Packages Total download size: 1.1 M Installed size: 4.6 M Downloading Packages: (1/7): python3-dbus-1.3.2-4.fc39.aarch64.rpm 8.1 MB/s | 157 kB 00:00 (2/7): python3-dateutil-2.8.2-10.fc39.noarch.rp 17 MB/s | 355 kB 00:00 (3/7): python3-distro-1.8.0-6.fc39.noarch.rpm 9.7 MB/s | 49 kB 00:00 (4/7): dbus-libs-1.14.10-1.fc40.aarch64.rpm 5.8 MB/s | 156 kB 00:00 (5/7): python3-six-1.16.0-12.fc39.noarch.rpm 12 MB/s | 41 kB 00:00 (6/7): python3-dnf-plugins-core-4.4.2-1.fc39.no 31 MB/s | 293 kB 00:00 (7/7): python3-systemd-235-5.fc39.aarch64.rpm 25 MB/s | 107 kB 00:00 -------------------------------------------------------------------------------- Total 19 MB/s | 1.1 MB 00:00 Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Preparing : 1/1 Installing : python3-systemd-235-5.fc39.aarch64 1/7 Installing : python3-six-1.16.0-12.fc39.noarch 2/7 Installing : python3-dateutil-1:2.8.2-10.fc39.noarch 3/7 Installing : python3-distro-1.8.0-6.fc39.noarch 4/7 Installing : dbus-libs-1:1.14.10-1.fc40.aarch64 5/7 Installing : python3-dbus-1.3.2-4.fc39.aarch64 6/7 Installing : python3-dnf-plugins-core-4.4.2-1.fc39.noarch 7/7 Running scriptlet: python3-dnf-plugins-core-4.4.2-1.fc39.noarch 7/7 Verifying : dbus-libs-1:1.14.10-1.fc40.aarch64 1/7 Verifying : python3-dateutil-1:2.8.2-10.fc39.noarch 2/7 Verifying : python3-dbus-1.3.2-4.fc39.aarch64 3/7 Verifying : python3-distro-1.8.0-6.fc39.noarch 4/7 Verifying : python3-dnf-plugins-core-4.4.2-1.fc39.noarch 5/7 Verifying : python3-six-1.16.0-12.fc39.noarch 6/7 Verifying : python3-systemd-235-5.fc39.aarch64 7/7 Installed: dbus-libs-1:1.14.10-1.fc40.aarch64 python3-dateutil-1:2.8.2-10.fc39.noarch python3-dbus-1.3.2-4.fc39.aarch64 python3-distro-1.8.0-6.fc39.noarch python3-dnf-plugins-core-4.4.2-1.fc39.noarch python3-six-1.16.0-12.fc39.noarch python3-systemd-235-5.fc39.aarch64 Complete! Finish(bootstrap): installing dnf tooling Start(bootstrap): creating root cache Finish(bootstrap): creating root cache Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-aarch64-1694959012.757365/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin INFO: Package manager dnf detected and used (direct choice) Start: installing minimal buildroot with dnf No matches found for the following disable plugin patterns: local, spacewalk, versionlock Copr repository 78 kB/s | 1.5 kB 00:00 Copr repository 16 MB/s | 935 kB 00:00 fedora 119 kB/s | 7.3 kB 00:00 Dependencies resolved. ================================================================================ Package Arch Version Repo Size ================================================================================ Installing group/module packages: bash aarch64 5.2.15-5.fc39 fedora 1.8 M bzip2 aarch64 1.0.8-16.fc39 fedora 52 k coreutils aarch64 9.4-1.fc40 fedora 1.2 M cpio aarch64 2.14-4.fc39 fedora 277 k diffutils aarch64 3.10-3.fc39 fedora 396 k fedora-release-common noarch 40-0.7 fedora 18 k findutils aarch64 1:4.9.0-6.fc40 fedora 495 k gawk aarch64 5.2.2-2.fc39 fedora 1.1 M glibc-minimal-langpack aarch64 2.38.9000-8.fc40 fedora 73 k grep aarch64 3.11-5.fc40 fedora 296 k gzip aarch64 1.12-6.fc39 fedora 164 k info aarch64 7.0.3-3.fc39 fedora 179 k patch aarch64 2.7.6-22.fc39 fedora 123 k redhat-rpm-config noarch 270-1.fc40 copr_base 74 k rpm-build aarch64 4.18.99-1.fc40 fedora 79 k sed aarch64 4.8-14.fc39 fedora 304 k shadow-utils aarch64 2:4.14.0-1.fc40 fedora 1.3 M tar aarch64 2:1.35-2.fc40 fedora 854 k unzip aarch64 6.0-62.fc39 fedora 183 k util-linux aarch64 2.39.2-1.fc40 fedora 1.2 M which aarch64 2.21-40.fc39 fedora 42 k xz aarch64 5.4.4-1.fc39 fedora 556 k Installing dependencies: alternatives aarch64 1.25-1.fc39 fedora 38 k ansible-srpm-macros noarch 1-11.fc39 fedora 21 k audit-libs aarch64 3.1.2-4.fc40 fedora 118 k authselect aarch64 1.4.2-3.fc39 fedora 144 k authselect-libs aarch64 1.4.2-3.fc39 fedora 249 k basesystem noarch 11-18.fc39 fedora 7.2 k binutils aarch64 2.41-5.fc40 fedora 6.7 M binutils-gold aarch64 2.41-5.fc40 fedora 948 k bzip2-libs aarch64 1.0.8-16.fc39 fedora 43 k ca-certificates noarch 2023.2.60_v7.0.306-3.fc40 fedora 837 k coreutils-common aarch64 9.4-1.fc40 fedora 2.1 M cracklib aarch64 2.9.11-2.fc40 copr_base 84 k crypto-policies noarch 20230731-1.git5ed06e0.fc39 fedora 99 k curl aarch64 8.3.0-1.fc40 fedora 350 k cyrus-sasl-lib aarch64 2.1.28-11.fc39 fedora 781 k debugedit aarch64 5.0-10.fc39 fedora 77 k dwz aarch64 0.15-3.fc39 fedora 136 k ed aarch64 1.19-4.fc39 fedora 78 k efi-srpm-macros noarch 5-9.fc39 fedora 22 k elfutils aarch64 0.189-6.fc40 fedora 539 k elfutils-debuginfod-client aarch64 0.189-6.fc40 fedora 38 k elfutils-default-yama-scope noarch 0.189-6.fc40 fedora 13 k elfutils-libelf aarch64 0.189-6.fc40 fedora 194 k elfutils-libs aarch64 0.189-6.fc40 fedora 258 k fedora-gpg-keys noarch 40-0.1 fedora 130 k fedora-release noarch 40-0.7 fedora 8.0 k fedora-release-identity-basic noarch 40-0.7 fedora 8.8 k fedora-repos noarch 40-0.1 fedora 9.4 k fedora-repos-rawhide noarch 40-0.1 fedora 9.0 k file aarch64 5.45-1.fc40 fedora 49 k file-libs aarch64 5.45-1.fc40 fedora 761 k filesystem aarch64 3.18-6.fc39 fedora 1.1 M fonts-srpm-macros noarch 1:2.0.5-12.fc39 fedora 26 k forge-srpm-macros noarch 0.1.0-1.fc40 fedora 18 k fpc-srpm-macros noarch 1.3-8.fc39 fedora 7.4 k gdb-minimal aarch64 13.2-8.fc40 fedora 3.8 M gdbm-libs aarch64 1:1.23-4.fc39 fedora 56 k ghc-srpm-macros noarch 1.6.1-2.fc39 fedora 7.8 k glibc aarch64 2.38.9000-8.fc40 fedora 1.7 M glibc-common aarch64 2.38.9000-8.fc40 fedora 351 k glibc-gconv-extra aarch64 2.38.9000-8.fc40 fedora 2.0 M gmp aarch64 1:6.2.1-5.fc39 fedora 266 k gnat-srpm-macros noarch 6-3.fc39 fedora 8.8 k go-srpm-macros noarch 3.2.0-7.fc40 fedora 27 k jansson aarch64 2.13.1-7.fc39 fedora 46 k kernel-srpm-macros noarch 1.0-20.fc39 fedora 10 k keyutils-libs aarch64 1.6.1-7.fc39 fedora 31 k krb5-libs aarch64 1.21.2-1.fc40 fedora 772 k libacl aarch64 2.3.1-9.fc40 fedora 23 k libarchive aarch64 3.7.2-1.fc40 fedora 402 k libattr aarch64 2.5.1-9.fc40 fedora 18 k libblkid aarch64 2.39.2-1.fc40 fedora 115 k libbrotli aarch64 1.1.0-1.fc40 fedora 344 k libcap aarch64 2.48-7.fc39 fedora 68 k libcap-ng aarch64 0.8.3-8.fc40 fedora 32 k libcom_err aarch64 1.47.0-2.fc39 fedora 26 k libcurl aarch64 8.3.0-1.fc40 fedora 337 k libdb aarch64 5.3.28-58.fc40 fedora 735 k libeconf aarch64 0.5.2-1.fc40 fedora 30 k libevent aarch64 2.1.12-9.fc39 fedora 254 k libfdisk aarch64 2.39.2-1.fc40 fedora 158 k libffi aarch64 3.4.4-4.fc39 fedora 38 k libgcc aarch64 13.2.1-1.fc40 copr_base 94 k libgomp aarch64 13.2.1-1.fc40 copr_base 311 k libidn2 aarch64 2.3.4-3.fc39 fedora 118 k libmount aarch64 2.39.2-1.fc40 fedora 153 k libnghttp2 aarch64 1.56.0-1.fc40 fedora 75 k libnsl2 aarch64 2.0.0-6.fc39 fedora 30 k libpkgconf aarch64 1.9.5-2.fc39 fedora 38 k libpsl aarch64 0.21.2-4.fc39 fedora 63 k libpwquality aarch64 1.4.5-6.fc39 fedora 120 k libselinux aarch64 3.5-5.fc39 fedora 86 k libsemanage aarch64 3.5-4.fc39 fedora 117 k libsepol aarch64 3.5-2.fc39 fedora 311 k libsigsegv aarch64 2.14-5.fc39 fedora 27 k libsmartcols aarch64 2.39.2-1.fc40 fedora 65 k libssh aarch64 0.10.5-2.fc39 fedora 212 k libssh-config noarch 0.10.5-2.fc39 fedora 9.2 k libstdc++ aarch64 13.2.1-1.fc40 copr_base 810 k libtasn1 aarch64 4.19.0-3.fc39 fedora 73 k libtirpc aarch64 1.3.3-1.rc2.fc39 fedora 95 k libunistring aarch64 1.1-5.fc40 fedora 540 k libutempter aarch64 1.2.1-10.fc39 fedora 27 k libuuid aarch64 2.39.2-1.fc40 fedora 28 k libverto aarch64 0.3.2-6.fc39 fedora 21 k libxcrypt aarch64 4.4.36-2.fc39 fedora 123 k libxml2 aarch64 2.11.5-1.fc40 fedora 687 k libzstd aarch64 1.5.5-4.fc40 copr_base 281 k lua-libs aarch64 5.4.6-3.fc39 fedora 131 k lua-srpm-macros noarch 1-9.fc39 fedora 8.6 k lz4-libs aarch64 1.9.4-4.fc39 fedora 68 k mpfr aarch64 4.2.0-3.fc39 fedora 319 k ncurses-base noarch 6.4-7.20230520.fc40 fedora 88 k ncurses-libs aarch64 6.4-7.20230520.fc40 fedora 326 k ocaml-srpm-macros noarch 8-2.fc39 fedora 14 k openblas-srpm-macros noarch 2-14.fc39 fedora 7.5 k openldap aarch64 2.6.6-1.fc39 fedora 251 k openssl-libs aarch64 1:3.1.1-4.fc40 copr_base 2.0 M p11-kit aarch64 0.25.0-2.fc39 fedora 481 k p11-kit-trust aarch64 0.25.0-2.fc39 fedora 140 k package-notes-srpm-macros noarch 0.5-9.fc39 fedora 11 k pam aarch64 1.5.3-2.fc39 fedora 558 k pam-libs aarch64 1.5.3-2.fc39 fedora 58 k pcre2 aarch64 10.42-1.fc39.2 fedora 219 k pcre2-syntax noarch 10.42-1.fc39.2 fedora 143 k perl-srpm-macros noarch 1-51.fc39 fedora 8.0 k pkgconf aarch64 1.9.5-2.fc39 fedora 42 k pkgconf-m4 noarch 1.9.5-2.fc39 fedora 14 k pkgconf-pkg-config aarch64 1.9.5-2.fc39 fedora 9.6 k popt aarch64 1.19-3.fc39 fedora 66 k publicsuffix-list-dafsa noarch 20230812-1.fc40 fedora 57 k pyproject-srpm-macros noarch 1.9.0-2.fc39 fedora 14 k python-srpm-macros noarch 3.12-4.fc40 fedora 25 k qt5-srpm-macros noarch 5.15.10-2.fc39 fedora 8.3 k qt6-srpm-macros noarch 6.5.2-2.fc39 fedora 9.2 k readline aarch64 8.2-4.fc39 fedora 211 k rpm aarch64 4.18.99-1.fc40 fedora 537 k rpm-build-libs aarch64 4.18.99-1.fc40 fedora 92 k rpm-libs aarch64 4.18.99-1.fc40 fedora 305 k rpm-sequoia aarch64 1.5.0-1.fc40 fedora 842 k rust-srpm-macros noarch 24-5.fc40 fedora 12 k setup noarch 2.14.4-1.fc39 fedora 154 k sqlite-libs aarch64 3.43.1-1.fc40 fedora 679 k systemd-libs aarch64 254.1-2.fc40 fedora 668 k tzdata noarch 2023c-3.fc40 fedora 718 k util-linux-core aarch64 2.39.2-1.fc40 fedora 490 k xxhash-libs aarch64 0.8.2-1.fc39 fedora 35 k xz-libs aarch64 5.4.4-1.fc39 fedora 106 k zip aarch64 3.0-38.fc39 fedora 262 k zlib-ng-compat aarch64 2.1.3-3.fc40 copr_base 68 k zstd aarch64 1.5.5-4.fc40 copr_base 446 k Installing Groups: Buildsystem building group Transaction Summary ================================================================================ Install 153 Packages Total size: 53 M Installed size: 304 M Downloading Packages: [SKIPPED] cracklib-2.9.11-2.fc40.aarch64.rpm: Already downloaded [SKIPPED] libgcc-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libgomp-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libstdc++-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libzstd-1.5.5-4.fc40.aarch64.rpm: Already downloaded [SKIPPED] openssl-libs-3.1.1-4.fc40.aarch64.rpm: Already downloaded [SKIPPED] redhat-rpm-config-270-1.fc40.noarch.rpm: Already downloaded [SKIPPED] zlib-ng-compat-2.1.3-3.fc40.aarch64.rpm: Already downloaded [SKIPPED] zstd-1.5.5-4.fc40.aarch64.rpm: Already downloaded [SKIPPED] alternatives-1.25-1.fc39.aarch64.rpm: Already downloaded [SKIPPED] ansible-srpm-macros-1-11.fc39.noarch.rpm: Already downloaded [SKIPPED] audit-libs-3.1.2-4.fc40.aarch64.rpm: Already downloaded [SKIPPED] authselect-1.4.2-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] authselect-libs-1.4.2-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] basesystem-11-18.fc39.noarch.rpm: Already downloaded [SKIPPED] bash-5.2.15-5.fc39.aarch64.rpm: Already downloaded [SKIPPED] binutils-2.41-5.fc40.aarch64.rpm: Already downloaded [SKIPPED] binutils-gold-2.41-5.fc40.aarch64.rpm: Already downloaded [SKIPPED] bzip2-1.0.8-16.fc39.aarch64.rpm: Already downloaded [SKIPPED] bzip2-libs-1.0.8-16.fc39.aarch64.rpm: Already downloaded [SKIPPED] ca-certificates-2023.2.60_v7.0.306-3.fc40.noarch.rpm: Already downloaded [SKIPPED] coreutils-9.4-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] coreutils-common-9.4-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] cpio-2.14-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] crypto-policies-20230731-1.git5ed06e0.fc39.noarch.rpm: Already downloaded [SKIPPED] curl-8.3.0-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] cyrus-sasl-lib-2.1.28-11.fc39.aarch64.rpm: Already downloaded [SKIPPED] debugedit-5.0-10.fc39.aarch64.rpm: Already downloaded [SKIPPED] diffutils-3.10-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] dwz-0.15-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] ed-1.19-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] efi-srpm-macros-5-9.fc39.noarch.rpm: Already downloaded [SKIPPED] elfutils-0.189-6.fc40.aarch64.rpm: Already downloaded [SKIPPED] elfutils-debuginfod-client-0.189-6.fc40.aarch64.rpm: Already downloaded [SKIPPED] elfutils-default-yama-scope-0.189-6.fc40.noarch.rpm: Already downloaded [SKIPPED] elfutils-libelf-0.189-6.fc40.aarch64.rpm: Already downloaded [SKIPPED] elfutils-libs-0.189-6.fc40.aarch64.rpm: Already downloaded [SKIPPED] fedora-gpg-keys-40-0.1.noarch.rpm: Already downloaded [SKIPPED] fedora-release-40-0.7.noarch.rpm: Already downloaded [SKIPPED] fedora-release-common-40-0.7.noarch.rpm: Already downloaded [SKIPPED] fedora-release-identity-basic-40-0.7.noarch.rpm: Already downloaded [SKIPPED] fedora-repos-40-0.1.noarch.rpm: Already downloaded [SKIPPED] fedora-repos-rawhide-40-0.1.noarch.rpm: Already downloaded [SKIPPED] file-5.45-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] file-libs-5.45-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] filesystem-3.18-6.fc39.aarch64.rpm: Already downloaded [SKIPPED] findutils-4.9.0-6.fc40.aarch64.rpm: Already downloaded [SKIPPED] fonts-srpm-macros-2.0.5-12.fc39.noarch.rpm: Already downloaded [SKIPPED] forge-srpm-macros-0.1.0-1.fc40.noarch.rpm: Already downloaded [SKIPPED] fpc-srpm-macros-1.3-8.fc39.noarch.rpm: Already downloaded [SKIPPED] gawk-5.2.2-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] gdb-minimal-13.2-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] gdbm-libs-1.23-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] ghc-srpm-macros-1.6.1-2.fc39.noarch.rpm: Already downloaded [SKIPPED] glibc-2.38.9000-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] glibc-common-2.38.9000-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] glibc-gconv-extra-2.38.9000-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] glibc-minimal-langpack-2.38.9000-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] gmp-6.2.1-5.fc39.aarch64.rpm: Already downloaded [SKIPPED] gnat-srpm-macros-6-3.fc39.noarch.rpm: Already downloaded [SKIPPED] go-srpm-macros-3.2.0-7.fc40.noarch.rpm: Already downloaded [SKIPPED] grep-3.11-5.fc40.aarch64.rpm: Already downloaded [SKIPPED] gzip-1.12-6.fc39.aarch64.rpm: Already downloaded [SKIPPED] info-7.0.3-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] jansson-2.13.1-7.fc39.aarch64.rpm: Already downloaded [SKIPPED] kernel-srpm-macros-1.0-20.fc39.noarch.rpm: Already downloaded [SKIPPED] keyutils-libs-1.6.1-7.fc39.aarch64.rpm: Already downloaded [SKIPPED] krb5-libs-1.21.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libacl-2.3.1-9.fc40.aarch64.rpm: Already downloaded [SKIPPED] libarchive-3.7.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libattr-2.5.1-9.fc40.aarch64.rpm: Already downloaded [SKIPPED] libblkid-2.39.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libbrotli-1.1.0-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libcap-2.48-7.fc39.aarch64.rpm: Already downloaded [SKIPPED] libcap-ng-0.8.3-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] libcom_err-1.47.0-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] libcurl-8.3.0-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libdb-5.3.28-58.fc40.aarch64.rpm: Already downloaded [SKIPPED] libeconf-0.5.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libevent-2.1.12-9.fc39.aarch64.rpm: Already downloaded [SKIPPED] libfdisk-2.39.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libffi-3.4.4-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] libidn2-2.3.4-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] libmount-2.39.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libnghttp2-1.56.0-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libnsl2-2.0.0-6.fc39.aarch64.rpm: Already downloaded [SKIPPED] libpkgconf-1.9.5-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] libpsl-0.21.2-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] libpwquality-1.4.5-6.fc39.aarch64.rpm: Already downloaded [SKIPPED] libselinux-3.5-5.fc39.aarch64.rpm: Already downloaded [SKIPPED] libsemanage-3.5-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] libsepol-3.5-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] libsigsegv-2.14-5.fc39.aarch64.rpm: Already downloaded [SKIPPED] libsmartcols-2.39.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libssh-0.10.5-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] libssh-config-0.10.5-2.fc39.noarch.rpm: Already downloaded [SKIPPED] libtasn1-4.19.0-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] libtirpc-1.3.3-1.rc2.fc39.aarch64.rpm: Already downloaded [SKIPPED] libunistring-1.1-5.fc40.aarch64.rpm: Already downloaded [SKIPPED] libutempter-1.2.1-10.fc39.aarch64.rpm: Already downloaded [SKIPPED] libuuid-2.39.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libverto-0.3.2-6.fc39.aarch64.rpm: Already downloaded [SKIPPED] libxcrypt-4.4.36-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] libxml2-2.11.5-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] lua-libs-5.4.6-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] lua-srpm-macros-1-9.fc39.noarch.rpm: Already downloaded [SKIPPED] lz4-libs-1.9.4-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] mpfr-4.2.0-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] ncurses-base-6.4-7.20230520.fc40.noarch.rpm: Already downloaded [SKIPPED] ncurses-libs-6.4-7.20230520.fc40.aarch64.rpm: Already downloaded [SKIPPED] ocaml-srpm-macros-8-2.fc39.noarch.rpm: Already downloaded [SKIPPED] openblas-srpm-macros-2-14.fc39.noarch.rpm: Already downloaded [SKIPPED] openldap-2.6.6-1.fc39.aarch64.rpm: Already downloaded [SKIPPED] p11-kit-0.25.0-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] p11-kit-trust-0.25.0-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] package-notes-srpm-macros-0.5-9.fc39.noarch.rpm: Already downloaded [SKIPPED] pam-1.5.3-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] pam-libs-1.5.3-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] patch-2.7.6-22.fc39.aarch64.rpm: Already downloaded [SKIPPED] pcre2-10.42-1.fc39.2.aarch64.rpm: Already downloaded [SKIPPED] pcre2-syntax-10.42-1.fc39.2.noarch.rpm: Already downloaded [SKIPPED] perl-srpm-macros-1-51.fc39.noarch.rpm: Already downloaded [SKIPPED] pkgconf-1.9.5-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] pkgconf-m4-1.9.5-2.fc39.noarch.rpm: Already downloaded [SKIPPED] pkgconf-pkg-config-1.9.5-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] popt-1.19-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] publicsuffix-list-dafsa-20230812-1.fc40.noarch.rpm: Already downloaded [SKIPPED] pyproject-srpm-macros-1.9.0-2.fc39.noarch.rpm: Already downloaded [SKIPPED] python-srpm-macros-3.12-4.fc40.noarch.rpm: Already downloaded [SKIPPED] qt5-srpm-macros-5.15.10-2.fc39.noarch.rpm: Already downloaded [SKIPPED] qt6-srpm-macros-6.5.2-2.fc39.noarch.rpm: Already downloaded [SKIPPED] readline-8.2-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] rpm-4.18.99-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] rpm-build-4.18.99-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] rpm-build-libs-4.18.99-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] rpm-libs-4.18.99-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] rpm-sequoia-1.5.0-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] rust-srpm-macros-24-5.fc40.noarch.rpm: Already downloaded [SKIPPED] sed-4.8-14.fc39.aarch64.rpm: Already downloaded [SKIPPED] setup-2.14.4-1.fc39.noarch.rpm: Already downloaded [SKIPPED] shadow-utils-4.14.0-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] sqlite-libs-3.43.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] systemd-libs-254.1-2.fc40.aarch64.rpm: Already downloaded [SKIPPED] tar-1.35-2.fc40.aarch64.rpm: Already downloaded [SKIPPED] tzdata-2023c-3.fc40.noarch.rpm: Already downloaded [SKIPPED] unzip-6.0-62.fc39.aarch64.rpm: Already downloaded [SKIPPED] util-linux-2.39.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] util-linux-core-2.39.2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] which-2.21-40.fc39.aarch64.rpm: Already downloaded [SKIPPED] xxhash-libs-0.8.2-1.fc39.aarch64.rpm: Already downloaded [SKIPPED] xz-5.4.4-1.fc39.aarch64.rpm: Already downloaded [SKIPPED] xz-libs-5.4.4-1.fc39.aarch64.rpm: Already downloaded [SKIPPED] zip-3.0-38.fc39.aarch64.rpm: Already downloaded fedora 1.6 MB/s | 1.6 kB 00:00 Importing GPG key 0xA15B79CC: Userid : "Fedora (40) " Fingerprint: 115D F9AE F857 853E E844 5D0A 0727 707E A15B 79CC From : /usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-40-primary Key imported successfully fedora 1.6 MB/s | 1.6 kB 00:00 GPG key at file:///usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-40-primary (0xA15B79CC) is already installed fedora 1.6 MB/s | 1.6 kB 00:00 Importing GPG key 0x18B8E74C: Userid : "Fedora (39) " Fingerprint: E8F2 3996 F232 1864 0CB4 4CBE 75CF 5AC4 18B8 E74C From : /usr/share/distribution-gpg-keys/fedora/RPM-GPG-KEY-fedora-39-primary Key imported successfully Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Running scriptlet: filesystem-3.18-6.fc39.aarch64 1/1 Preparing : 1/1 Installing : libgcc-13.2.1-1.fc40.aarch64 1/153 Running scriptlet: libgcc-13.2.1-1.fc40.aarch64 1/153 Installing : crypto-policies-20230731-1.git5ed06e0.fc39.noarc 2/153 Running scriptlet: crypto-policies-20230731-1.git5ed06e0.fc39.noarc 2/153 Installing : tzdata-2023c-3.fc40.noarch 3/153 Installing : fedora-release-identity-basic-40-0.7.noarch 4/153 Installing : fedora-repos-rawhide-40-0.1.noarch 5/153 Installing : fedora-gpg-keys-40-0.1.noarch 6/153 Installing : fedora-repos-40-0.1.noarch 7/153 Installing : fedora-release-common-40-0.7.noarch 8/153 Installing : fedora-release-40-0.7.noarch 9/153 Installing : setup-2.14.4-1.fc39.noarch 10/153 warning: /etc/hosts created as /etc/hosts.rpmnew Running scriptlet: setup-2.14.4-1.fc39.noarch 10/153 Installing : filesystem-3.18-6.fc39.aarch64 11/153 Installing : basesystem-11-18.fc39.noarch 12/153 Installing : rust-srpm-macros-24-5.fc40.noarch 13/153 Installing : qt6-srpm-macros-6.5.2-2.fc39.noarch 14/153 Installing : qt5-srpm-macros-5.15.10-2.fc39.noarch 15/153 Installing : pyproject-srpm-macros-1.9.0-2.fc39.noarch 16/153 Installing : publicsuffix-list-dafsa-20230812-1.fc40.noarch 17/153 Installing : pkgconf-m4-1.9.5-2.fc39.noarch 18/153 Installing : perl-srpm-macros-1-51.fc39.noarch 19/153 Installing : pcre2-syntax-10.42-1.fc39.2.noarch 20/153 Installing : package-notes-srpm-macros-0.5-9.fc39.noarch 21/153 Installing : openblas-srpm-macros-2-14.fc39.noarch 22/153 Installing : ocaml-srpm-macros-8-2.fc39.noarch 23/153 Installing : ncurses-base-6.4-7.20230520.fc40.noarch 24/153 Installing : glibc-gconv-extra-2.38.9000-8.fc40.aarch64 25/153 Running scriptlet: glibc-gconv-extra-2.38.9000-8.fc40.aarch64 25/153 Installing : glibc-minimal-langpack-2.38.9000-8.fc40.aarch64 26/153 Installing : glibc-common-2.38.9000-8.fc40.aarch64 27/153 Running scriptlet: glibc-2.38.9000-8.fc40.aarch64 28/153 Installing : glibc-2.38.9000-8.fc40.aarch64 28/153 Running scriptlet: glibc-2.38.9000-8.fc40.aarch64 28/153 Installing : ncurses-libs-6.4-7.20230520.fc40.aarch64 29/153 Installing : bash-5.2.15-5.fc39.aarch64 30/153 Running scriptlet: bash-5.2.15-5.fc39.aarch64 30/153 Installing : zlib-ng-compat-2.1.3-3.fc40.aarch64 31/153 Installing : xz-libs-5.4.4-1.fc39.aarch64 32/153 Installing : bzip2-libs-1.0.8-16.fc39.aarch64 33/153 Installing : libstdc++-13.2.1-1.fc40.aarch64 34/153 Installing : libzstd-1.5.5-4.fc40.aarch64 35/153 Installing : elfutils-libelf-0.189-6.fc40.aarch64 36/153 Installing : libuuid-2.39.2-1.fc40.aarch64 37/153 Installing : popt-1.19-3.fc39.aarch64 38/153 Installing : libblkid-2.39.2-1.fc40.aarch64 39/153 Installing : readline-8.2-4.fc39.aarch64 40/153 Installing : gmp-1:6.2.1-5.fc39.aarch64 41/153 Installing : libattr-2.5.1-9.fc40.aarch64 42/153 Installing : libacl-2.3.1-9.fc40.aarch64 43/153 Installing : libcap-2.48-7.fc39.aarch64 44/153 Installing : libxcrypt-4.4.36-2.fc39.aarch64 45/153 Installing : lz4-libs-1.9.4-4.fc39.aarch64 46/153 Installing : systemd-libs-254.1-2.fc40.aarch64 47/153 Installing : mpfr-4.2.0-3.fc39.aarch64 48/153 Installing : dwz-0.15-3.fc39.aarch64 49/153 Installing : unzip-6.0-62.fc39.aarch64 50/153 Installing : file-libs-5.45-1.fc40.aarch64 51/153 Installing : file-5.45-1.fc40.aarch64 52/153 Installing : alternatives-1.25-1.fc39.aarch64 53/153 Installing : jansson-2.13.1-7.fc39.aarch64 54/153 Installing : libcap-ng-0.8.3-8.fc40.aarch64 55/153 Installing : audit-libs-3.1.2-4.fc40.aarch64 56/153 Installing : pam-libs-1.5.3-2.fc39.aarch64 57/153 Installing : libcom_err-1.47.0-2.fc39.aarch64 58/153 Installing : libsepol-3.5-2.fc39.aarch64 59/153 Installing : libsmartcols-2.39.2-1.fc40.aarch64 60/153 Installing : libunistring-1.1-5.fc40.aarch64 61/153 Installing : libidn2-2.3.4-3.fc39.aarch64 62/153 Installing : lua-libs-5.4.6-3.fc39.aarch64 63/153 Installing : pcre2-10.42-1.fc39.2.aarch64 64/153 Installing : libselinux-3.5-5.fc39.aarch64 65/153 Installing : sed-4.8-14.fc39.aarch64 66/153 Installing : grep-3.11-5.fc40.aarch64 67/153 Installing : findutils-1:4.9.0-6.fc40.aarch64 68/153 Installing : xz-5.4.4-1.fc39.aarch64 69/153 Installing : libmount-2.39.2-1.fc40.aarch64 70/153 Installing : util-linux-core-2.39.2-1.fc40.aarch64 71/153 Installing : libsemanage-3.5-4.fc39.aarch64 72/153 Installing : tar-2:1.35-2.fc40.aarch64 73/153 Installing : libpsl-0.21.2-4.fc39.aarch64 74/153 Installing : zip-3.0-38.fc39.aarch64 75/153 Installing : zstd-1.5.5-4.fc40.aarch64 76/153 Installing : libfdisk-2.39.2-1.fc40.aarch64 77/153 Installing : bzip2-1.0.8-16.fc39.aarch64 78/153 Installing : libxml2-2.11.5-1.fc40.aarch64 79/153 Installing : sqlite-libs-3.43.1-1.fc40.aarch64 80/153 Installing : ed-1.19-4.fc39.aarch64 81/153 Installing : patch-2.7.6-22.fc39.aarch64 82/153 Installing : elfutils-default-yama-scope-0.189-6.fc40.noarch 83/153 Running scriptlet: elfutils-default-yama-scope-0.189-6.fc40.noarch 83/153 Installing : libgomp-13.2.1-1.fc40.aarch64 84/153 Installing : cpio-2.14-4.fc39.aarch64 85/153 Installing : diffutils-3.10-3.fc39.aarch64 86/153 Installing : gdbm-libs-1:1.23-4.fc39.aarch64 87/153 Installing : cyrus-sasl-lib-2.1.28-11.fc39.aarch64 88/153 Installing : keyutils-libs-1.6.1-7.fc39.aarch64 89/153 Installing : libbrotli-1.1.0-1.fc40.aarch64 90/153 Installing : libdb-5.3.28-58.fc40.aarch64 91/153 Installing : libeconf-0.5.2-1.fc40.aarch64 92/153 Installing : shadow-utils-2:4.14.0-1.fc40.aarch64 93/153 Running scriptlet: libutempter-1.2.1-10.fc39.aarch64 94/153 Installing : libutempter-1.2.1-10.fc39.aarch64 94/153 Installing : libffi-3.4.4-4.fc39.aarch64 95/153 Installing : p11-kit-0.25.0-2.fc39.aarch64 96/153 Installing : libnghttp2-1.56.0-1.fc40.aarch64 97/153 Installing : libpkgconf-1.9.5-2.fc39.aarch64 98/153 Installing : pkgconf-1.9.5-2.fc39.aarch64 99/153 Installing : pkgconf-pkg-config-1.9.5-2.fc39.aarch64 100/153 Installing : libsigsegv-2.14-5.fc39.aarch64 101/153 Installing : gawk-5.2.2-2.fc39.aarch64 102/153 Installing : libtasn1-4.19.0-3.fc39.aarch64 103/153 Installing : p11-kit-trust-0.25.0-2.fc39.aarch64 104/153 Running scriptlet: p11-kit-trust-0.25.0-2.fc39.aarch64 104/153 Installing : libverto-0.3.2-6.fc39.aarch64 105/153 Installing : xxhash-libs-0.8.2-1.fc39.aarch64 106/153 Installing : libssh-config-0.10.5-2.fc39.noarch 107/153 Installing : kernel-srpm-macros-1.0-20.fc39.noarch 108/153 Installing : gnat-srpm-macros-6-3.fc39.noarch 109/153 Installing : ghc-srpm-macros-1.6.1-2.fc39.noarch 110/153 Installing : fpc-srpm-macros-1.3-8.fc39.noarch 111/153 Installing : coreutils-common-9.4-1.fc40.aarch64 112/153 Installing : openssl-libs-1:3.1.1-4.fc40.aarch64 113/153 Installing : coreutils-9.4-1.fc40.aarch64 114/153 Running scriptlet: ca-certificates-2023.2.60_v7.0.306-3.fc40.noarch 115/153 Installing : ca-certificates-2023.2.60_v7.0.306-3.fc40.noarch 115/153 Running scriptlet: ca-certificates-2023.2.60_v7.0.306-3.fc40.noarch 115/153 Installing : krb5-libs-1.21.2-1.fc40.aarch64 116/153 Installing : libtirpc-1.3.3-1.rc2.fc39.aarch64 117/153 Running scriptlet: authselect-libs-1.4.2-3.fc39.aarch64 118/153 Installing : authselect-libs-1.4.2-3.fc39.aarch64 118/153 Installing : gzip-1.12-6.fc39.aarch64 119/153 Installing : cracklib-2.9.11-2.fc40.aarch64 120/153 Installing : libpwquality-1.4.5-6.fc39.aarch64 121/153 Installing : authselect-1.4.2-3.fc39.aarch64 122/153 Installing : libnsl2-2.0.0-6.fc39.aarch64 123/153 Installing : pam-1.5.3-2.fc39.aarch64 124/153 Installing : libssh-0.10.5-2.fc39.aarch64 125/153 Installing : libarchive-3.7.2-1.fc40.aarch64 126/153 Installing : libevent-2.1.12-9.fc39.aarch64 127/153 Installing : openldap-2.6.6-1.fc39.aarch64 128/153 Installing : libcurl-8.3.0-1.fc40.aarch64 129/153 Installing : elfutils-libs-0.189-6.fc40.aarch64 130/153 Installing : elfutils-debuginfod-client-0.189-6.fc40.aarch64 131/153 Installing : binutils-gold-2.41-5.fc40.aarch64 132/153 Running scriptlet: binutils-gold-2.41-5.fc40.aarch64 132/153 Installing : binutils-2.41-5.fc40.aarch64 133/153 Running scriptlet: binutils-2.41-5.fc40.aarch64 133/153 Installing : elfutils-0.189-6.fc40.aarch64 134/153 Installing : gdb-minimal-13.2-8.fc40.aarch64 135/153 Installing : debugedit-5.0-10.fc39.aarch64 136/153 Installing : curl-8.3.0-1.fc40.aarch64 137/153 Installing : rpm-sequoia-1.5.0-1.fc40.aarch64 138/153 Installing : rpm-libs-4.18.99-1.fc40.aarch64 139/153 Running scriptlet: rpm-4.18.99-1.fc40.aarch64 140/153 Installing : rpm-4.18.99-1.fc40.aarch64 140/153 Installing : efi-srpm-macros-5-9.fc39.noarch 141/153 Installing : lua-srpm-macros-1-9.fc39.noarch 142/153 Installing : rpm-build-libs-4.18.99-1.fc40.aarch64 143/153 Installing : ansible-srpm-macros-1-11.fc39.noarch 144/153 Installing : fonts-srpm-macros-1:2.0.5-12.fc39.noarch 145/153 Installing : forge-srpm-macros-0.1.0-1.fc40.noarch 146/153 Installing : go-srpm-macros-3.2.0-7.fc40.noarch 147/153 Installing : python-srpm-macros-3.12-4.fc40.noarch 148/153 Installing : redhat-rpm-config-270-1.fc40.noarch 149/153 Installing : rpm-build-4.18.99-1.fc40.aarch64 150/153 Installing : util-linux-2.39.2-1.fc40.aarch64 151/153 Installing : which-2.21-40.fc39.aarch64 152/153 Installing : info-7.0.3-3.fc39.aarch64 153/153 Running scriptlet: filesystem-3.18-6.fc39.aarch64 153/153 Running scriptlet: ca-certificates-2023.2.60_v7.0.306-3.fc40.noarch 153/153 Running scriptlet: authselect-libs-1.4.2-3.fc39.aarch64 153/153 Running scriptlet: rpm-4.18.99-1.fc40.aarch64 153/153 Running scriptlet: info-7.0.3-3.fc39.aarch64 153/153 Verifying : cracklib-2.9.11-2.fc40.aarch64 1/153 Verifying : libgcc-13.2.1-1.fc40.aarch64 2/153 Verifying : libgomp-13.2.1-1.fc40.aarch64 3/153 Verifying : libstdc++-13.2.1-1.fc40.aarch64 4/153 Verifying : libzstd-1.5.5-4.fc40.aarch64 5/153 Verifying : openssl-libs-1:3.1.1-4.fc40.aarch64 6/153 Verifying : redhat-rpm-config-270-1.fc40.noarch 7/153 Verifying : zlib-ng-compat-2.1.3-3.fc40.aarch64 8/153 Verifying : zstd-1.5.5-4.fc40.aarch64 9/153 Verifying : alternatives-1.25-1.fc39.aarch64 10/153 Verifying : ansible-srpm-macros-1-11.fc39.noarch 11/153 Verifying : audit-libs-3.1.2-4.fc40.aarch64 12/153 Verifying : authselect-1.4.2-3.fc39.aarch64 13/153 Verifying : authselect-libs-1.4.2-3.fc39.aarch64 14/153 Verifying : basesystem-11-18.fc39.noarch 15/153 Verifying : bash-5.2.15-5.fc39.aarch64 16/153 Verifying : binutils-2.41-5.fc40.aarch64 17/153 Verifying : binutils-gold-2.41-5.fc40.aarch64 18/153 Verifying : bzip2-1.0.8-16.fc39.aarch64 19/153 Verifying : bzip2-libs-1.0.8-16.fc39.aarch64 20/153 Verifying : ca-certificates-2023.2.60_v7.0.306-3.fc40.noarch 21/153 Verifying : coreutils-9.4-1.fc40.aarch64 22/153 Verifying : coreutils-common-9.4-1.fc40.aarch64 23/153 Verifying : cpio-2.14-4.fc39.aarch64 24/153 Verifying : crypto-policies-20230731-1.git5ed06e0.fc39.noarc 25/153 Verifying : curl-8.3.0-1.fc40.aarch64 26/153 Verifying : cyrus-sasl-lib-2.1.28-11.fc39.aarch64 27/153 Verifying : debugedit-5.0-10.fc39.aarch64 28/153 Verifying : diffutils-3.10-3.fc39.aarch64 29/153 Verifying : dwz-0.15-3.fc39.aarch64 30/153 Verifying : ed-1.19-4.fc39.aarch64 31/153 Verifying : efi-srpm-macros-5-9.fc39.noarch 32/153 Verifying : elfutils-0.189-6.fc40.aarch64 33/153 Verifying : elfutils-debuginfod-client-0.189-6.fc40.aarch64 34/153 Verifying : elfutils-default-yama-scope-0.189-6.fc40.noarch 35/153 Verifying : elfutils-libelf-0.189-6.fc40.aarch64 36/153 Verifying : elfutils-libs-0.189-6.fc40.aarch64 37/153 Verifying : fedora-gpg-keys-40-0.1.noarch 38/153 Verifying : fedora-release-40-0.7.noarch 39/153 Verifying : fedora-release-common-40-0.7.noarch 40/153 Verifying : fedora-release-identity-basic-40-0.7.noarch 41/153 Verifying : fedora-repos-40-0.1.noarch 42/153 Verifying : fedora-repos-rawhide-40-0.1.noarch 43/153 Verifying : file-5.45-1.fc40.aarch64 44/153 Verifying : file-libs-5.45-1.fc40.aarch64 45/153 Verifying : filesystem-3.18-6.fc39.aarch64 46/153 Verifying : findutils-1:4.9.0-6.fc40.aarch64 47/153 Verifying : fonts-srpm-macros-1:2.0.5-12.fc39.noarch 48/153 Verifying : forge-srpm-macros-0.1.0-1.fc40.noarch 49/153 Verifying : fpc-srpm-macros-1.3-8.fc39.noarch 50/153 Verifying : gawk-5.2.2-2.fc39.aarch64 51/153 Verifying : gdb-minimal-13.2-8.fc40.aarch64 52/153 Verifying : gdbm-libs-1:1.23-4.fc39.aarch64 53/153 Verifying : ghc-srpm-macros-1.6.1-2.fc39.noarch 54/153 Verifying : glibc-2.38.9000-8.fc40.aarch64 55/153 Verifying : glibc-common-2.38.9000-8.fc40.aarch64 56/153 Verifying : glibc-gconv-extra-2.38.9000-8.fc40.aarch64 57/153 Verifying : glibc-minimal-langpack-2.38.9000-8.fc40.aarch64 58/153 Verifying : gmp-1:6.2.1-5.fc39.aarch64 59/153 Verifying : gnat-srpm-macros-6-3.fc39.noarch 60/153 Verifying : go-srpm-macros-3.2.0-7.fc40.noarch 61/153 Verifying : grep-3.11-5.fc40.aarch64 62/153 Verifying : gzip-1.12-6.fc39.aarch64 63/153 Verifying : info-7.0.3-3.fc39.aarch64 64/153 Verifying : jansson-2.13.1-7.fc39.aarch64 65/153 Verifying : kernel-srpm-macros-1.0-20.fc39.noarch 66/153 Verifying : keyutils-libs-1.6.1-7.fc39.aarch64 67/153 Verifying : krb5-libs-1.21.2-1.fc40.aarch64 68/153 Verifying : libacl-2.3.1-9.fc40.aarch64 69/153 Verifying : libarchive-3.7.2-1.fc40.aarch64 70/153 Verifying : libattr-2.5.1-9.fc40.aarch64 71/153 Verifying : libblkid-2.39.2-1.fc40.aarch64 72/153 Verifying : libbrotli-1.1.0-1.fc40.aarch64 73/153 Verifying : libcap-2.48-7.fc39.aarch64 74/153 Verifying : libcap-ng-0.8.3-8.fc40.aarch64 75/153 Verifying : libcom_err-1.47.0-2.fc39.aarch64 76/153 Verifying : libcurl-8.3.0-1.fc40.aarch64 77/153 Verifying : libdb-5.3.28-58.fc40.aarch64 78/153 Verifying : libeconf-0.5.2-1.fc40.aarch64 79/153 Verifying : libevent-2.1.12-9.fc39.aarch64 80/153 Verifying : libfdisk-2.39.2-1.fc40.aarch64 81/153 Verifying : libffi-3.4.4-4.fc39.aarch64 82/153 Verifying : libidn2-2.3.4-3.fc39.aarch64 83/153 Verifying : libmount-2.39.2-1.fc40.aarch64 84/153 Verifying : libnghttp2-1.56.0-1.fc40.aarch64 85/153 Verifying : libnsl2-2.0.0-6.fc39.aarch64 86/153 Verifying : libpkgconf-1.9.5-2.fc39.aarch64 87/153 Verifying : libpsl-0.21.2-4.fc39.aarch64 88/153 Verifying : libpwquality-1.4.5-6.fc39.aarch64 89/153 Verifying : libselinux-3.5-5.fc39.aarch64 90/153 Verifying : libsemanage-3.5-4.fc39.aarch64 91/153 Verifying : libsepol-3.5-2.fc39.aarch64 92/153 Verifying : libsigsegv-2.14-5.fc39.aarch64 93/153 Verifying : libsmartcols-2.39.2-1.fc40.aarch64 94/153 Verifying : libssh-0.10.5-2.fc39.aarch64 95/153 Verifying : libssh-config-0.10.5-2.fc39.noarch 96/153 Verifying : libtasn1-4.19.0-3.fc39.aarch64 97/153 Verifying : libtirpc-1.3.3-1.rc2.fc39.aarch64 98/153 Verifying : libunistring-1.1-5.fc40.aarch64 99/153 Verifying : libutempter-1.2.1-10.fc39.aarch64 100/153 Verifying : libuuid-2.39.2-1.fc40.aarch64 101/153 Verifying : libverto-0.3.2-6.fc39.aarch64 102/153 Verifying : libxcrypt-4.4.36-2.fc39.aarch64 103/153 Verifying : libxml2-2.11.5-1.fc40.aarch64 104/153 Verifying : lua-libs-5.4.6-3.fc39.aarch64 105/153 Verifying : lua-srpm-macros-1-9.fc39.noarch 106/153 Verifying : lz4-libs-1.9.4-4.fc39.aarch64 107/153 Verifying : mpfr-4.2.0-3.fc39.aarch64 108/153 Verifying : ncurses-base-6.4-7.20230520.fc40.noarch 109/153 Verifying : ncurses-libs-6.4-7.20230520.fc40.aarch64 110/153 Verifying : ocaml-srpm-macros-8-2.fc39.noarch 111/153 Verifying : openblas-srpm-macros-2-14.fc39.noarch 112/153 Verifying : openldap-2.6.6-1.fc39.aarch64 113/153 Verifying : p11-kit-0.25.0-2.fc39.aarch64 114/153 Verifying : p11-kit-trust-0.25.0-2.fc39.aarch64 115/153 Verifying : package-notes-srpm-macros-0.5-9.fc39.noarch 116/153 Verifying : pam-1.5.3-2.fc39.aarch64 117/153 Verifying : pam-libs-1.5.3-2.fc39.aarch64 118/153 Verifying : patch-2.7.6-22.fc39.aarch64 119/153 Verifying : pcre2-10.42-1.fc39.2.aarch64 120/153 Verifying : pcre2-syntax-10.42-1.fc39.2.noarch 121/153 Verifying : perl-srpm-macros-1-51.fc39.noarch 122/153 Verifying : pkgconf-1.9.5-2.fc39.aarch64 123/153 Verifying : pkgconf-m4-1.9.5-2.fc39.noarch 124/153 Verifying : pkgconf-pkg-config-1.9.5-2.fc39.aarch64 125/153 Verifying : popt-1.19-3.fc39.aarch64 126/153 Verifying : publicsuffix-list-dafsa-20230812-1.fc40.noarch 127/153 Verifying : pyproject-srpm-macros-1.9.0-2.fc39.noarch 128/153 Verifying : python-srpm-macros-3.12-4.fc40.noarch 129/153 Verifying : qt5-srpm-macros-5.15.10-2.fc39.noarch 130/153 Verifying : qt6-srpm-macros-6.5.2-2.fc39.noarch 131/153 Verifying : readline-8.2-4.fc39.aarch64 132/153 Verifying : rpm-4.18.99-1.fc40.aarch64 133/153 Verifying : rpm-build-4.18.99-1.fc40.aarch64 134/153 Verifying : rpm-build-libs-4.18.99-1.fc40.aarch64 135/153 Verifying : rpm-libs-4.18.99-1.fc40.aarch64 136/153 Verifying : rpm-sequoia-1.5.0-1.fc40.aarch64 137/153 Verifying : rust-srpm-macros-24-5.fc40.noarch 138/153 Verifying : sed-4.8-14.fc39.aarch64 139/153 Verifying : setup-2.14.4-1.fc39.noarch 140/153 Verifying : shadow-utils-2:4.14.0-1.fc40.aarch64 141/153 Verifying : sqlite-libs-3.43.1-1.fc40.aarch64 142/153 Verifying : systemd-libs-254.1-2.fc40.aarch64 143/153 Verifying : tar-2:1.35-2.fc40.aarch64 144/153 Verifying : tzdata-2023c-3.fc40.noarch 145/153 Verifying : unzip-6.0-62.fc39.aarch64 146/153 Verifying : util-linux-2.39.2-1.fc40.aarch64 147/153 Verifying : util-linux-core-2.39.2-1.fc40.aarch64 148/153 Verifying : which-2.21-40.fc39.aarch64 149/153 Verifying : xxhash-libs-0.8.2-1.fc39.aarch64 150/153 Verifying : xz-5.4.4-1.fc39.aarch64 151/153 Verifying : xz-libs-5.4.4-1.fc39.aarch64 152/153 Verifying : zip-3.0-38.fc39.aarch64 153/153 Installed: alternatives-1.25-1.fc39.aarch64 ansible-srpm-macros-1-11.fc39.noarch audit-libs-3.1.2-4.fc40.aarch64 authselect-1.4.2-3.fc39.aarch64 authselect-libs-1.4.2-3.fc39.aarch64 basesystem-11-18.fc39.noarch bash-5.2.15-5.fc39.aarch64 binutils-2.41-5.fc40.aarch64 binutils-gold-2.41-5.fc40.aarch64 bzip2-1.0.8-16.fc39.aarch64 bzip2-libs-1.0.8-16.fc39.aarch64 ca-certificates-2023.2.60_v7.0.306-3.fc40.noarch coreutils-9.4-1.fc40.aarch64 coreutils-common-9.4-1.fc40.aarch64 cpio-2.14-4.fc39.aarch64 cracklib-2.9.11-2.fc40.aarch64 crypto-policies-20230731-1.git5ed06e0.fc39.noarch curl-8.3.0-1.fc40.aarch64 cyrus-sasl-lib-2.1.28-11.fc39.aarch64 debugedit-5.0-10.fc39.aarch64 diffutils-3.10-3.fc39.aarch64 dwz-0.15-3.fc39.aarch64 ed-1.19-4.fc39.aarch64 efi-srpm-macros-5-9.fc39.noarch elfutils-0.189-6.fc40.aarch64 elfutils-debuginfod-client-0.189-6.fc40.aarch64 elfutils-default-yama-scope-0.189-6.fc40.noarch elfutils-libelf-0.189-6.fc40.aarch64 elfutils-libs-0.189-6.fc40.aarch64 fedora-gpg-keys-40-0.1.noarch fedora-release-40-0.7.noarch fedora-release-common-40-0.7.noarch fedora-release-identity-basic-40-0.7.noarch fedora-repos-40-0.1.noarch fedora-repos-rawhide-40-0.1.noarch file-5.45-1.fc40.aarch64 file-libs-5.45-1.fc40.aarch64 filesystem-3.18-6.fc39.aarch64 findutils-1:4.9.0-6.fc40.aarch64 fonts-srpm-macros-1:2.0.5-12.fc39.noarch forge-srpm-macros-0.1.0-1.fc40.noarch fpc-srpm-macros-1.3-8.fc39.noarch gawk-5.2.2-2.fc39.aarch64 gdb-minimal-13.2-8.fc40.aarch64 gdbm-libs-1:1.23-4.fc39.aarch64 ghc-srpm-macros-1.6.1-2.fc39.noarch glibc-2.38.9000-8.fc40.aarch64 glibc-common-2.38.9000-8.fc40.aarch64 glibc-gconv-extra-2.38.9000-8.fc40.aarch64 glibc-minimal-langpack-2.38.9000-8.fc40.aarch64 gmp-1:6.2.1-5.fc39.aarch64 gnat-srpm-macros-6-3.fc39.noarch go-srpm-macros-3.2.0-7.fc40.noarch grep-3.11-5.fc40.aarch64 gzip-1.12-6.fc39.aarch64 info-7.0.3-3.fc39.aarch64 jansson-2.13.1-7.fc39.aarch64 kernel-srpm-macros-1.0-20.fc39.noarch keyutils-libs-1.6.1-7.fc39.aarch64 krb5-libs-1.21.2-1.fc40.aarch64 libacl-2.3.1-9.fc40.aarch64 libarchive-3.7.2-1.fc40.aarch64 libattr-2.5.1-9.fc40.aarch64 libblkid-2.39.2-1.fc40.aarch64 libbrotli-1.1.0-1.fc40.aarch64 libcap-2.48-7.fc39.aarch64 libcap-ng-0.8.3-8.fc40.aarch64 libcom_err-1.47.0-2.fc39.aarch64 libcurl-8.3.0-1.fc40.aarch64 libdb-5.3.28-58.fc40.aarch64 libeconf-0.5.2-1.fc40.aarch64 libevent-2.1.12-9.fc39.aarch64 libfdisk-2.39.2-1.fc40.aarch64 libffi-3.4.4-4.fc39.aarch64 libgcc-13.2.1-1.fc40.aarch64 libgomp-13.2.1-1.fc40.aarch64 libidn2-2.3.4-3.fc39.aarch64 libmount-2.39.2-1.fc40.aarch64 libnghttp2-1.56.0-1.fc40.aarch64 libnsl2-2.0.0-6.fc39.aarch64 libpkgconf-1.9.5-2.fc39.aarch64 libpsl-0.21.2-4.fc39.aarch64 libpwquality-1.4.5-6.fc39.aarch64 libselinux-3.5-5.fc39.aarch64 libsemanage-3.5-4.fc39.aarch64 libsepol-3.5-2.fc39.aarch64 libsigsegv-2.14-5.fc39.aarch64 libsmartcols-2.39.2-1.fc40.aarch64 libssh-0.10.5-2.fc39.aarch64 libssh-config-0.10.5-2.fc39.noarch libstdc++-13.2.1-1.fc40.aarch64 libtasn1-4.19.0-3.fc39.aarch64 libtirpc-1.3.3-1.rc2.fc39.aarch64 libunistring-1.1-5.fc40.aarch64 libutempter-1.2.1-10.fc39.aarch64 libuuid-2.39.2-1.fc40.aarch64 libverto-0.3.2-6.fc39.aarch64 libxcrypt-4.4.36-2.fc39.aarch64 libxml2-2.11.5-1.fc40.aarch64 libzstd-1.5.5-4.fc40.aarch64 lua-libs-5.4.6-3.fc39.aarch64 lua-srpm-macros-1-9.fc39.noarch lz4-libs-1.9.4-4.fc39.aarch64 mpfr-4.2.0-3.fc39.aarch64 ncurses-base-6.4-7.20230520.fc40.noarch ncurses-libs-6.4-7.20230520.fc40.aarch64 ocaml-srpm-macros-8-2.fc39.noarch openblas-srpm-macros-2-14.fc39.noarch openldap-2.6.6-1.fc39.aarch64 openssl-libs-1:3.1.1-4.fc40.aarch64 p11-kit-0.25.0-2.fc39.aarch64 p11-kit-trust-0.25.0-2.fc39.aarch64 package-notes-srpm-macros-0.5-9.fc39.noarch pam-1.5.3-2.fc39.aarch64 pam-libs-1.5.3-2.fc39.aarch64 patch-2.7.6-22.fc39.aarch64 pcre2-10.42-1.fc39.2.aarch64 pcre2-syntax-10.42-1.fc39.2.noarch perl-srpm-macros-1-51.fc39.noarch pkgconf-1.9.5-2.fc39.aarch64 pkgconf-m4-1.9.5-2.fc39.noarch pkgconf-pkg-config-1.9.5-2.fc39.aarch64 popt-1.19-3.fc39.aarch64 publicsuffix-list-dafsa-20230812-1.fc40.noarch pyproject-srpm-macros-1.9.0-2.fc39.noarch python-srpm-macros-3.12-4.fc40.noarch qt5-srpm-macros-5.15.10-2.fc39.noarch qt6-srpm-macros-6.5.2-2.fc39.noarch readline-8.2-4.fc39.aarch64 redhat-rpm-config-270-1.fc40.noarch rpm-4.18.99-1.fc40.aarch64 rpm-build-4.18.99-1.fc40.aarch64 rpm-build-libs-4.18.99-1.fc40.aarch64 rpm-libs-4.18.99-1.fc40.aarch64 rpm-sequoia-1.5.0-1.fc40.aarch64 rust-srpm-macros-24-5.fc40.noarch sed-4.8-14.fc39.aarch64 setup-2.14.4-1.fc39.noarch shadow-utils-2:4.14.0-1.fc40.aarch64 sqlite-libs-3.43.1-1.fc40.aarch64 systemd-libs-254.1-2.fc40.aarch64 tar-2:1.35-2.fc40.aarch64 tzdata-2023c-3.fc40.noarch unzip-6.0-62.fc39.aarch64 util-linux-2.39.2-1.fc40.aarch64 util-linux-core-2.39.2-1.fc40.aarch64 which-2.21-40.fc39.aarch64 xxhash-libs-0.8.2-1.fc39.aarch64 xz-5.4.4-1.fc39.aarch64 xz-libs-5.4.4-1.fc39.aarch64 zip-3.0-38.fc39.aarch64 zlib-ng-compat-2.1.3-3.fc40.aarch64 zstd-1.5.5-4.fc40.aarch64 Complete! Finish: installing minimal buildroot with dnf Start: creating root cache Finish: creating root cache Finish: chroot init INFO: Installed packages: INFO: alternatives-1.25-1.fc39.aarch64 ansible-srpm-macros-1-11.fc39.noarch audit-libs-3.1.2-4.fc40.aarch64 authselect-1.4.2-3.fc39.aarch64 authselect-libs-1.4.2-3.fc39.aarch64 basesystem-11-18.fc39.noarch bash-5.2.15-5.fc39.aarch64 binutils-2.41-5.fc40.aarch64 binutils-gold-2.41-5.fc40.aarch64 bzip2-1.0.8-16.fc39.aarch64 bzip2-libs-1.0.8-16.fc39.aarch64 ca-certificates-2023.2.60_v7.0.306-3.fc40.noarch coreutils-9.4-1.fc40.aarch64 coreutils-common-9.4-1.fc40.aarch64 cpio-2.14-4.fc39.aarch64 cracklib-2.9.11-2.fc40.aarch64 crypto-policies-20230731-1.git5ed06e0.fc39.noarch curl-8.3.0-1.fc40.aarch64 cyrus-sasl-lib-2.1.28-11.fc39.aarch64 debugedit-5.0-10.fc39.aarch64 diffutils-3.10-3.fc39.aarch64 dwz-0.15-3.fc39.aarch64 ed-1.19-4.fc39.aarch64 efi-srpm-macros-5-9.fc39.noarch elfutils-0.189-6.fc40.aarch64 elfutils-debuginfod-client-0.189-6.fc40.aarch64 elfutils-default-yama-scope-0.189-6.fc40.noarch elfutils-libelf-0.189-6.fc40.aarch64 elfutils-libs-0.189-6.fc40.aarch64 fedora-gpg-keys-40-0.1.noarch fedora-release-40-0.7.noarch fedora-release-common-40-0.7.noarch fedora-release-identity-basic-40-0.7.noarch fedora-repos-40-0.1.noarch fedora-repos-rawhide-40-0.1.noarch file-5.45-1.fc40.aarch64 file-libs-5.45-1.fc40.aarch64 filesystem-3.18-6.fc39.aarch64 findutils-4.9.0-6.fc40.aarch64 fonts-srpm-macros-2.0.5-12.fc39.noarch forge-srpm-macros-0.1.0-1.fc40.noarch fpc-srpm-macros-1.3-8.fc39.noarch gawk-5.2.2-2.fc39.aarch64 gdb-minimal-13.2-8.fc40.aarch64 gdbm-libs-1.23-4.fc39.aarch64 ghc-srpm-macros-1.6.1-2.fc39.noarch glibc-2.38.9000-8.fc40.aarch64 glibc-common-2.38.9000-8.fc40.aarch64 glibc-gconv-extra-2.38.9000-8.fc40.aarch64 glibc-minimal-langpack-2.38.9000-8.fc40.aarch64 gmp-6.2.1-5.fc39.aarch64 gnat-srpm-macros-6-3.fc39.noarch go-srpm-macros-3.2.0-7.fc40.noarch gpg-pubkey-18b8e74c-62f2920f gpg-pubkey-a15b79cc-63d04c2c grep-3.11-5.fc40.aarch64 gzip-1.12-6.fc39.aarch64 info-7.0.3-3.fc39.aarch64 jansson-2.13.1-7.fc39.aarch64 kernel-srpm-macros-1.0-20.fc39.noarch keyutils-libs-1.6.1-7.fc39.aarch64 krb5-libs-1.21.2-1.fc40.aarch64 libacl-2.3.1-9.fc40.aarch64 libarchive-3.7.2-1.fc40.aarch64 libattr-2.5.1-9.fc40.aarch64 libblkid-2.39.2-1.fc40.aarch64 libbrotli-1.1.0-1.fc40.aarch64 libcap-2.48-7.fc39.aarch64 libcap-ng-0.8.3-8.fc40.aarch64 libcom_err-1.47.0-2.fc39.aarch64 libcurl-8.3.0-1.fc40.aarch64 libdb-5.3.28-58.fc40.aarch64 libeconf-0.5.2-1.fc40.aarch64 libevent-2.1.12-9.fc39.aarch64 libfdisk-2.39.2-1.fc40.aarch64 libffi-3.4.4-4.fc39.aarch64 libgcc-13.2.1-1.fc40.aarch64 libgomp-13.2.1-1.fc40.aarch64 libidn2-2.3.4-3.fc39.aarch64 libmount-2.39.2-1.fc40.aarch64 libnghttp2-1.56.0-1.fc40.aarch64 libnsl2-2.0.0-6.fc39.aarch64 libpkgconf-1.9.5-2.fc39.aarch64 libpsl-0.21.2-4.fc39.aarch64 libpwquality-1.4.5-6.fc39.aarch64 libselinux-3.5-5.fc39.aarch64 libsemanage-3.5-4.fc39.aarch64 libsepol-3.5-2.fc39.aarch64 libsigsegv-2.14-5.fc39.aarch64 libsmartcols-2.39.2-1.fc40.aarch64 libssh-0.10.5-2.fc39.aarch64 libssh-config-0.10.5-2.fc39.noarch libstdc++-13.2.1-1.fc40.aarch64 libtasn1-4.19.0-3.fc39.aarch64 libtirpc-1.3.3-1.rc2.fc39.aarch64 libunistring-1.1-5.fc40.aarch64 libutempter-1.2.1-10.fc39.aarch64 libuuid-2.39.2-1.fc40.aarch64 libverto-0.3.2-6.fc39.aarch64 libxcrypt-4.4.36-2.fc39.aarch64 libxml2-2.11.5-1.fc40.aarch64 libzstd-1.5.5-4.fc40.aarch64 lua-libs-5.4.6-3.fc39.aarch64 lua-srpm-macros-1-9.fc39.noarch lz4-libs-1.9.4-4.fc39.aarch64 mpfr-4.2.0-3.fc39.aarch64 ncurses-base-6.4-7.20230520.fc40.noarch ncurses-libs-6.4-7.20230520.fc40.aarch64 ocaml-srpm-macros-8-2.fc39.noarch openblas-srpm-macros-2-14.fc39.noarch openldap-2.6.6-1.fc39.aarch64 openssl-libs-3.1.1-4.fc40.aarch64 p11-kit-0.25.0-2.fc39.aarch64 p11-kit-trust-0.25.0-2.fc39.aarch64 package-notes-srpm-macros-0.5-9.fc39.noarch pam-1.5.3-2.fc39.aarch64 pam-libs-1.5.3-2.fc39.aarch64 patch-2.7.6-22.fc39.aarch64 pcre2-10.42-1.fc39.2.aarch64 pcre2-syntax-10.42-1.fc39.2.noarch perl-srpm-macros-1-51.fc39.noarch pkgconf-1.9.5-2.fc39.aarch64 pkgconf-m4-1.9.5-2.fc39.noarch pkgconf-pkg-config-1.9.5-2.fc39.aarch64 popt-1.19-3.fc39.aarch64 publicsuffix-list-dafsa-20230812-1.fc40.noarch pyproject-srpm-macros-1.9.0-2.fc39.noarch python-srpm-macros-3.12-4.fc40.noarch qt5-srpm-macros-5.15.10-2.fc39.noarch qt6-srpm-macros-6.5.2-2.fc39.noarch readline-8.2-4.fc39.aarch64 redhat-rpm-config-270-1.fc40.noarch rpm-4.18.99-1.fc40.aarch64 rpm-build-4.18.99-1.fc40.aarch64 rpm-build-libs-4.18.99-1.fc40.aarch64 rpm-libs-4.18.99-1.fc40.aarch64 rpm-sequoia-1.5.0-1.fc40.aarch64 rust-srpm-macros-24-5.fc40.noarch sed-4.8-14.fc39.aarch64 setup-2.14.4-1.fc39.noarch shadow-utils-4.14.0-1.fc40.aarch64 sqlite-libs-3.43.1-1.fc40.aarch64 systemd-libs-254.1-2.fc40.aarch64 tar-1.35-2.fc40.aarch64 tzdata-2023c-3.fc40.noarch unzip-6.0-62.fc39.aarch64 util-linux-2.39.2-1.fc40.aarch64 util-linux-core-2.39.2-1.fc40.aarch64 which-2.21-40.fc39.aarch64 xxhash-libs-0.8.2-1.fc39.aarch64 xz-5.4.4-1.fc39.aarch64 xz-libs-5.4.4-1.fc39.aarch64 zip-3.0-38.fc39.aarch64 zlib-ng-compat-2.1.3-3.fc40.aarch64 zstd-1.5.5-4.fc40.aarch64 Start: buildsrpm Start: rpmbuild -bs Building target platforms: aarch64 Building for target aarch64 setting SOURCE_DATE_EPOCH=1689724800 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-2.fc40.src.rpm Finish: rpmbuild -bs INFO: chroot_scan: 3 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-aarch64-1694959012.757365/root/var/log/dnf.rpm.log /var/lib/mock/fedora-rawhide-aarch64-1694959012.757365/root/var/log/dnf.librepo.log /var/lib/mock/fedora-rawhide-aarch64-1694959012.757365/root/var/log/dnf.log Finish: buildsrpm INFO: Done(/var/lib/copr-rpmbuild/workspace/workdir-5w6klzz8/bowtie/bowtie.spec) Config(child) 0 minutes 37 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot INFO: Start(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-2.fc40.src.rpm) Config(fedora-rawhide-aarch64) Start(bootstrap): chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-aarch64-bootstrap-1694959012.757365/root. INFO: reusing tmpfs at /var/lib/mock/fedora-rawhide-aarch64-bootstrap-1694959012.757365/root. INFO: calling preinit hooks INFO: enabled root cache INFO: enabled package manager cache Start(bootstrap): cleaning package manager metadata Finish(bootstrap): cleaning package manager metadata Finish(bootstrap): chroot init Start: chroot init INFO: mounting tmpfs at /var/lib/mock/fedora-rawhide-aarch64-1694959012.757365/root. INFO: calling preinit hooks INFO: enabled root cache Start: unpacking root cache Finish: unpacking root cache INFO: enabled package manager cache Start: cleaning package manager metadata Finish: cleaning package manager metadata INFO: enabled HW Info plugin Finish: chroot init INFO: Buildroot is handled by package management downloaded with a bootstrap image: rpm-4.18.99-1.fc40.aarch64 rpm-sequoia-1.5.0-1.fc40.aarch64 python3-dnf-4.16.2-4.fc40.noarch python3-dnf-plugins-core-4.4.2-1.fc39.noarch yum-4.16.2-4.fc40.noarch Start: build phase for bowtie-1.3.1-2.fc40.src.rpm Start: build setup for bowtie-1.3.1-2.fc40.src.rpm Building target platforms: aarch64 Building for target aarch64 setting SOURCE_DATE_EPOCH=1689724800 Wrote: /builddir/build/SRPMS/bowtie-1.3.1-2.fc40.src.rpm No matches found for the following disable plugin patterns: local, spacewalk, versionlock Copr repository 77 kB/s | 1.5 kB 00:00 fedora 252 kB/s | 7.3 kB 00:00 Dependencies resolved. ================================================================================ Package Arch Version Repository Size ================================================================================ Installing: gcc-c++ aarch64 13.2.1-1.fc40 copr_base 12 M hostname aarch64 3.23-9.fc39 fedora 28 k make aarch64 1:4.4.1-2.fc39 fedora 585 k perl-Clone aarch64 0.46-4.fc39 fedora 22 k perl-Data-Dumper aarch64 2.188-501.fc39 fedora 55 k perl-FindBin noarch 1.53-500.fc39 fedora 14 k perl-Getopt-Long noarch 1:2.54-500.fc39 fedora 60 k perl-Test-Deep noarch 1.204-3.fc39 fedora 121 k perl-interpreter aarch64 4:5.38.0-500.fc39 fedora 72 k perl-lib aarch64 0.65-500.fc39 fedora 15 k python3 aarch64 3.12.0~rc2-1.fc40 fedora 26 k tbb-devel aarch64 2020.3-21.fc40 fedora 335 k zlib-ng-compat-devel aarch64 2.1.3-3.fc40 copr_base 34 k Installing dependencies: annobin-docs noarch 12.26-1.fc40 fedora 94 k annobin-plugin-gcc aarch64 12.26-1.fc40 fedora 958 k cmake-filesystem aarch64 3.27.4-8.fc40 fedora 19 k cpp aarch64 13.2.1-1.fc40 copr_base 9.7 M expat aarch64 2.5.0-3.fc39 fedora 108 k gc aarch64 8.2.2-4.fc39 fedora 110 k gcc aarch64 13.2.1-1.fc40 copr_base 31 M gcc-plugin-annobin aarch64 13.2.1-1.fc40 copr_base 47 k glibc-devel aarch64 2.38.9000-8.fc40 fedora 581 k groff-base aarch64 1.23.0-2.fc39 fedora 1.1 M guile22 aarch64 2.2.7-9.fc39 fedora 6.5 M kernel-headers aarch64 6.6.0-0.rc1.git0.1.fc40 fedora 1.5 M libasan aarch64 13.2.1-1.fc40 copr_base 455 k libatomic aarch64 13.2.1-1.fc40 copr_base 36 k libb2 aarch64 0.98.1-9.fc39 fedora 24 k libmpc aarch64 1.3.1-3.fc39 fedora 72 k libstdc++-devel aarch64 13.2.1-1.fc40 copr_base 2.5 M libtool-ltdl aarch64 2.4.7-8.fc40 fedora 36 k libubsan aarch64 13.2.1-1.fc40 copr_base 204 k libxcrypt-devel aarch64 4.4.36-2.fc39 fedora 30 k mpdecimal aarch64 2.5.1-7.fc39 fedora 90 k ncurses aarch64 6.4-7.20230520.fc40 fedora 415 k perl-AutoLoader noarch 5.74-500.fc39 fedora 21 k perl-B aarch64 1.88-500.fc39 fedora 178 k perl-Carp noarch 1.54-500.fc39 fedora 29 k perl-Class-Struct noarch 0.68-500.fc39 fedora 22 k perl-Digest noarch 1.20-500.fc39 fedora 25 k perl-Digest-MD5 aarch64 2.58-500.fc39 fedora 36 k perl-DynaLoader aarch64 1.54-500.fc39 fedora 26 k perl-Encode aarch64 4:3.19-500.fc39 fedora 1.7 M perl-Errno aarch64 1.37-500.fc39 fedora 15 k perl-Exporter noarch 5.77-500.fc39 fedora 31 k perl-Fcntl aarch64 1.15-500.fc39 fedora 21 k perl-File-Basename noarch 2.86-500.fc39 fedora 17 k perl-File-Path noarch 2.18-500.fc39 fedora 35 k perl-File-Temp noarch 1:0.231.100-500.fc39 fedora 58 k perl-File-stat noarch 1.13-500.fc39 fedora 17 k perl-FileHandle noarch 2.05-500.fc39 fedora 16 k perl-Getopt-Std noarch 1.13-500.fc39 fedora 16 k perl-HTTP-Tiny noarch 0.088-3.fc39 fedora 56 k perl-IO aarch64 1.52-500.fc39 fedora 83 k perl-IO-Socket-IP noarch 0.42-1.fc39 fedora 42 k perl-IO-Socket-SSL noarch 2.083-3.fc39 fedora 225 k perl-IPC-Open3 noarch 1.22-500.fc39 fedora 22 k perl-JSON-PP noarch 1:4.16-501.fc39 fedora 67 k perl-MIME-Base64 aarch64 3.16-500.fc39 fedora 30 k perl-Math-BigInt noarch 1:1.9998.39-2.fc39 fedora 203 k perl-Math-BigRat noarch 0.2624-500.fc39 fedora 41 k perl-Math-Complex noarch 1.62-500.fc39 fedora 46 k perl-Mozilla-CA noarch 20230821-1.fc40 fedora 13 k perl-Net-SSLeay aarch64 1.92-10.fc39 fedora 356 k perl-Object-HashBase noarch 0.009-13.fc39 fedora 25 k perl-POSIX aarch64 2.13-500.fc39 fedora 98 k perl-PathTools aarch64 3.89-500.fc39 fedora 88 k perl-Pod-Escapes noarch 1:1.07-501.fc40 fedora 19 k perl-Pod-Perldoc noarch 3.28.01-501.fc39 fedora 86 k perl-Pod-Simple noarch 1:3.45-4.fc39 fedora 218 k perl-Pod-Usage noarch 4:2.03-500.fc39 fedora 39 k perl-Scalar-List-Utils aarch64 5:1.63-500.fc39 fedora 71 k perl-SelectSaver noarch 1.02-500.fc39 fedora 12 k perl-Socket aarch64 4:2.037-3.fc39 fedora 56 k perl-Storable aarch64 1:3.32-500.fc39 fedora 97 k perl-Symbol noarch 1.09-500.fc39 fedora 14 k perl-Term-ANSIColor noarch 5.01-501.fc39 fedora 47 k perl-Term-Cap noarch 1.18-500.fc39 fedora 22 k perl-Term-Table noarch 0.017-1.fc40 fedora 34 k perl-Test-Simple noarch 3:1.302195-5.fc39 fedora 575 k perl-Text-ParseWords noarch 3.31-500.fc39 fedora 16 k perl-Text-Tabs+Wrap noarch 2023.0511-3.fc39 fedora 22 k perl-Time-HiRes aarch64 4:1.9775-500.fc39 fedora 58 k perl-Time-Local noarch 2:1.350-3.fc39 fedora 34 k perl-URI noarch 5.21-1.fc40 fedora 125 k perl-base noarch 2.27-500.fc39 fedora 16 k perl-constant noarch 1.33-501.fc39 fedora 22 k perl-if noarch 0.61.000-500.fc39 fedora 14 k perl-libnet noarch 3.15-501.fc39 fedora 129 k perl-libs aarch64 4:5.38.0-500.fc39 fedora 2.3 M perl-locale noarch 1.10-500.fc39 fedora 14 k perl-mro aarch64 1.28-500.fc39 fedora 29 k perl-overload noarch 1.37-500.fc39 fedora 46 k perl-overloading noarch 0.02-500.fc39 fedora 13 k perl-parent noarch 1:0.241-500.fc39 fedora 14 k perl-podlators noarch 1:5.01-500.fc39 fedora 125 k perl-vars noarch 1.05-500.fc39 fedora 13 k python-pip-wheel noarch 23.2.1-1.fc39 fedora 1.5 M python3-libs aarch64 3.12.0~rc2-1.fc40 fedora 9.1 M tbb aarch64 2020.3-21.fc40 fedora 140 k Transaction Summary ================================================================================ Install 100 Packages Total size: 87 M Total download size: 10 M Installed size: 316 M Downloading Packages: [SKIPPED] cpp-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] gcc-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] gcc-c++-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] gcc-plugin-annobin-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libasan-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libatomic-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libstdc++-devel-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libubsan-13.2.1-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] zlib-ng-compat-devel-2.1.3-3.fc40.aarch64.rpm: Already downloaded [SKIPPED] annobin-docs-12.26-1.fc40.noarch.rpm: Already downloaded [SKIPPED] annobin-plugin-gcc-12.26-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] cmake-filesystem-3.27.4-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] expat-2.5.0-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] gc-8.2.2-4.fc39.aarch64.rpm: Already downloaded [SKIPPED] glibc-devel-2.38.9000-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] guile22-2.2.7-9.fc39.aarch64.rpm: Already downloaded [SKIPPED] kernel-headers-6.6.0-0.rc1.git0.1.fc40.aarch64.rpm: Already downloaded [SKIPPED] libb2-0.98.1-9.fc39.aarch64.rpm: Already downloaded [SKIPPED] libmpc-1.3.1-3.fc39.aarch64.rpm: Already downloaded [SKIPPED] libtool-ltdl-2.4.7-8.fc40.aarch64.rpm: Already downloaded [SKIPPED] libxcrypt-devel-4.4.36-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] make-4.4.1-2.fc39.aarch64.rpm: Already downloaded [SKIPPED] mpdecimal-2.5.1-7.fc39.aarch64.rpm: Already downloaded [SKIPPED] python-pip-wheel-23.2.1-1.fc39.noarch.rpm: Already downloaded [SKIPPED] python3-3.12.0~rc2-1.fc40.aarch64.rpm: Already downloaded [SKIPPED] python3-libs-3.12.0~rc2-1.fc40.aarch64.rpm: Already downloaded (27/100): ncurses-6.4-7.20230520.fc40.aarch64.r 20 MB/s | 415 kB 00:00 (28/100): hostname-3.23-9.fc39.aarch64.rpm 1.2 MB/s | 28 kB 00:00 (29/100): groff-base-1.23.0-2.fc39.aarch64.rpm 42 MB/s | 1.1 MB 00:00 (30/100): perl-AutoLoader-5.74-500.fc39.noarch. 3.4 MB/s | 21 kB 00:00 (31/100): perl-B-1.88-500.fc39.aarch64.rpm 39 MB/s | 178 kB 00:00 (32/100): perl-Class-Struct-0.68-500.fc39.noarc 7.4 MB/s | 22 kB 00:00 (33/100): perl-Carp-1.54-500.fc39.noarch.rpm 7.2 MB/s | 29 kB 00:00 (34/100): perl-Digest-1.20-500.fc39.noarch.rpm 12 MB/s | 25 kB 00:00 (35/100): perl-Data-Dumper-2.188-501.fc39.aarch 17 MB/s | 55 kB 00:00 (36/100): perl-Digest-MD5-2.58-500.fc39.aarch64 15 MB/s | 36 kB 00:00 (37/100): perl-DynaLoader-1.54-500.fc39.aarch64 9.3 MB/s | 26 kB 00:00 (38/100): perl-Errno-1.37-500.fc39.aarch64.rpm 6.2 MB/s | 15 kB 00:00 (39/100): perl-Exporter-5.77-500.fc39.noarch.rp 12 MB/s | 31 kB 00:00 (40/100): perl-Clone-0.46-4.fc39.aarch64.rpm 1.4 MB/s | 22 kB 00:00 (41/100): perl-Fcntl-1.15-500.fc39.aarch64.rpm 9.2 MB/s | 21 kB 00:00 (42/100): perl-File-Basename-2.86-500.fc39.noar 6.4 MB/s | 17 kB 00:00 (43/100): perl-File-Path-2.18-500.fc39.noarch.r 17 MB/s | 35 kB 00:00 (44/100): perl-File-Temp-0.231.100-500.fc39.noa 28 MB/s | 58 kB 00:00 (45/100): perl-File-stat-1.13-500.fc39.noarch.r 7.5 MB/s | 17 kB 00:00 (46/100): perl-FileHandle-2.05-500.fc39.noarch. 7.3 MB/s | 16 kB 00:00 (47/100): perl-FindBin-1.53-500.fc39.noarch.rpm 4.9 MB/s | 14 kB 00:00 (48/100): perl-Getopt-Std-1.13-500.fc39.noarch. 8.3 MB/s | 16 kB 00:00 (49/100): perl-Getopt-Long-2.54-500.fc39.noarch 16 MB/s | 60 kB 00:00 (50/100): perl-HTTP-Tiny-0.088-3.fc39.noarch.rp 20 MB/s | 56 kB 00:00 (51/100): perl-IO-1.52-500.fc39.aarch64.rpm 17 MB/s | 83 kB 00:00 (52/100): perl-IO-Socket-IP-0.42-1.fc39.noarch. 12 MB/s | 42 kB 00:00 (53/100): perl-IPC-Open3-1.22-500.fc39.noarch.r 11 MB/s | 22 kB 00:00 (54/100): perl-IO-Socket-SSL-2.083-3.fc39.noarc 33 MB/s | 225 kB 00:00 (55/100): perl-Encode-3.19-500.fc39.aarch64.rpm 51 MB/s | 1.7 MB 00:00 (56/100): perl-MIME-Base64-3.16-500.fc39.aarch6 12 MB/s | 30 kB 00:00 (57/100): perl-Math-BigRat-0.2624-500.fc39.noar 8.5 MB/s | 41 kB 00:00 (58/100): perl-Math-BigInt-1.9998.39-2.fc39.noa 24 MB/s | 203 kB 00:00 (59/100): perl-Math-Complex-1.62-500.fc39.noarc 8.9 MB/s | 46 kB 00:00 (60/100): perl-Mozilla-CA-20230821-1.fc40.noarc 3.5 MB/s | 13 kB 00:00 (61/100): perl-Net-SSLeay-1.92-10.fc39.aarch64. 47 MB/s | 356 kB 00:00 (62/100): perl-JSON-PP-4.16-501.fc39.noarch.rpm 2.4 MB/s | 67 kB 00:00 (63/100): perl-POSIX-2.13-500.fc39.aarch64.rpm 21 MB/s | 98 kB 00:00 (64/100): perl-Pod-Escapes-1.07-501.fc40.noarch 8.0 MB/s | 19 kB 00:00 (65/100): perl-PathTools-3.89-500.fc39.aarch64. 20 MB/s | 88 kB 00:00 (66/100): perl-Object-HashBase-0.009-13.fc39.no 1.7 MB/s | 25 kB 00:00 (67/100): perl-Pod-Simple-3.45-4.fc39.noarch.rp 69 MB/s | 218 kB 00:00 (68/100): perl-Pod-Perldoc-3.28.01-501.fc39.noa 20 MB/s | 86 kB 00:00 (69/100): perl-Pod-Usage-2.03-500.fc39.noarch.r 12 MB/s | 39 kB 00:00 (70/100): perl-SelectSaver-1.02-500.fc39.noarch 6.9 MB/s | 12 kB 00:00 (71/100): perl-Scalar-List-Utils-1.63-500.fc39. 21 MB/s | 71 kB 00:00 (72/100): perl-Socket-2.037-3.fc39.aarch64.rpm 18 MB/s | 56 kB 00:00 (73/100): perl-Storable-3.32-500.fc39.aarch64.r 35 MB/s | 97 kB 00:00 (74/100): perl-Symbol-1.09-500.fc39.noarch.rpm 6.3 MB/s | 14 kB 00:00 (75/100): perl-Term-ANSIColor-5.01-501.fc39.noa 20 MB/s | 47 kB 00:00 (76/100): perl-Term-Cap-1.18-500.fc39.noarch.rp 8.3 MB/s | 22 kB 00:00 (77/100): perl-Term-Table-0.017-1.fc40.noarch.r 2.6 MB/s | 34 kB 00:00 (78/100): perl-Test-Deep-1.204-3.fc39.noarch.rp 8.4 MB/s | 121 kB 00:00 (79/100): perl-Text-ParseWords-3.31-500.fc39.no 5.1 MB/s | 16 kB 00:00 (80/100): perl-Text-Tabs+Wrap-2023.0511-3.fc39. 8.0 MB/s | 22 kB 00:00 (81/100): perl-Time-Local-1.350-3.fc39.noarch.r 12 MB/s | 34 kB 00:00 (82/100): perl-Test-Simple-1.302195-5.fc39.noar 30 MB/s | 575 kB 00:00 (83/100): perl-Time-HiRes-1.9775-500.fc39.aarch 10 MB/s | 58 kB 00:00 (84/100): perl-base-2.27-500.fc39.noarch.rpm 6.8 MB/s | 16 kB 00:00 (85/100): perl-constant-1.33-501.fc39.noarch.rp 11 MB/s | 22 kB 00:00 (86/100): perl-URI-5.21-1.fc40.noarch.rpm 20 MB/s | 125 kB 00:00 (87/100): perl-if-0.61.000-500.fc39.noarch.rpm 4.6 MB/s | 14 kB 00:00 (88/100): perl-interpreter-5.38.0-500.fc39.aarc 20 MB/s | 72 kB 00:00 (89/100): perl-libnet-3.15-501.fc39.noarch.rpm 36 MB/s | 129 kB 00:00 (90/100): perl-locale-1.10-500.fc39.noarch.rpm 4.9 MB/s | 14 kB 00:00 (91/100): perl-mro-1.28-500.fc39.aarch64.rpm 11 MB/s | 29 kB 00:00 (92/100): perl-overload-1.37-500.fc39.noarch.rp 23 MB/s | 46 kB 00:00 (93/100): perl-overloading-0.02-500.fc39.noarch 6.1 MB/s | 13 kB 00:00 (94/100): perl-parent-0.241-500.fc39.noarch.rpm 8.8 MB/s | 14 kB 00:00 (95/100): perl-lib-0.65-500.fc39.aarch64.rpm 827 kB/s | 15 kB 00:00 (96/100): perl-podlators-5.01-500.fc39.noarch.r 35 MB/s | 125 kB 00:00 (97/100): perl-vars-1.05-500.fc39.noarch.rpm 5.7 MB/s | 13 kB 00:00 (98/100): tbb-2020.3-21.fc40.aarch64.rpm 11 MB/s | 140 kB 00:00 (99/100): tbb-devel-2020.3-21.fc40.aarch64.rpm 21 MB/s | 335 kB 00:00 (100/100): perl-libs-5.38.0-500.fc39.aarch64.rp 55 MB/s | 2.3 MB 00:00 -------------------------------------------------------------------------------- Total 31 MB/s | 10 MB 00:00 Running transaction check Transaction check succeeded. Running transaction test Transaction test succeeded. Running transaction Preparing : 1/1 Installing : libmpc-1.3.1-3.fc39.aarch64 1/100 Installing : cpp-13.2.1-1.fc40.aarch64 2/100 Installing : tbb-2020.3-21.fc40.aarch64 3/100 Installing : python-pip-wheel-23.2.1-1.fc39.noarch 4/100 Installing : ncurses-6.4-7.20230520.fc40.aarch64 5/100 Installing : mpdecimal-2.5.1-7.fc39.aarch64 6/100 Installing : libtool-ltdl-2.4.7-8.fc40.aarch64 7/100 Installing : libb2-0.98.1-9.fc39.aarch64 8/100 Installing : kernel-headers-6.6.0-0.rc1.git0.1.fc40.aarch64 9/100 Installing : libxcrypt-devel-4.4.36-2.fc39.aarch64 10/100 Installing : glibc-devel-2.38.9000-8.fc40.aarch64 11/100 Running scriptlet: groff-base-1.23.0-2.fc39.aarch64 12/100 Installing : groff-base-1.23.0-2.fc39.aarch64 12/100 Running scriptlet: groff-base-1.23.0-2.fc39.aarch64 12/100 Installing : perl-Digest-1.20-500.fc39.noarch 13/100 Installing : perl-Digest-MD5-2.58-500.fc39.aarch64 14/100 Installing : perl-B-1.88-500.fc39.aarch64 15/100 Installing : perl-FileHandle-2.05-500.fc39.noarch 16/100 Installing : perl-Data-Dumper-2.188-501.fc39.aarch64 17/100 Installing : perl-libnet-3.15-501.fc39.noarch 18/100 Installing : perl-AutoLoader-5.74-500.fc39.noarch 19/100 Installing : perl-base-2.27-500.fc39.noarch 20/100 Installing : perl-URI-5.21-1.fc40.noarch 21/100 Installing : perl-Text-Tabs+Wrap-2023.0511-3.fc39.noarch 22/100 Installing : perl-Mozilla-CA-20230821-1.fc40.noarch 23/100 Installing : perl-if-0.61.000-500.fc39.noarch 24/100 Installing : perl-locale-1.10-500.fc39.noarch 25/100 Installing : perl-IO-Socket-IP-0.42-1.fc39.noarch 26/100 Installing : perl-Time-Local-2:1.350-3.fc39.noarch 27/100 Installing : perl-File-Path-2.18-500.fc39.noarch 28/100 Installing : perl-IO-Socket-SSL-2.083-3.fc39.noarch 29/100 Installing : perl-Net-SSLeay-1.92-10.fc39.aarch64 30/100 Installing : perl-Pod-Escapes-1:1.07-501.fc40.noarch 31/100 Installing : perl-Class-Struct-0.68-500.fc39.noarch 32/100 Installing : perl-Term-ANSIColor-5.01-501.fc39.noarch 33/100 Installing : perl-POSIX-2.13-500.fc39.aarch64 34/100 Installing : perl-IPC-Open3-1.22-500.fc39.noarch 35/100 Installing : perl-File-Temp-1:0.231.100-500.fc39.noarch 36/100 Installing : perl-HTTP-Tiny-0.088-3.fc39.noarch 37/100 Installing : perl-Term-Cap-1.18-500.fc39.noarch 38/100 Installing : perl-Pod-Simple-1:3.45-4.fc39.noarch 39/100 Installing : perl-Socket-4:2.037-3.fc39.aarch64 40/100 Installing : perl-SelectSaver-1.02-500.fc39.noarch 41/100 Installing : perl-Symbol-1.09-500.fc39.noarch 42/100 Installing : perl-File-stat-1.13-500.fc39.noarch 43/100 Installing : perl-podlators-1:5.01-500.fc39.noarch 44/100 Installing : perl-Pod-Perldoc-3.28.01-501.fc39.noarch 45/100 Installing : perl-Fcntl-1.15-500.fc39.aarch64 46/100 Installing : perl-Text-ParseWords-3.31-500.fc39.noarch 47/100 Installing : perl-mro-1.28-500.fc39.aarch64 48/100 Installing : perl-IO-1.52-500.fc39.aarch64 49/100 Installing : perl-overloading-0.02-500.fc39.noarch 50/100 Installing : perl-Pod-Usage-4:2.03-500.fc39.noarch 51/100 Installing : perl-Errno-1.37-500.fc39.aarch64 52/100 Installing : perl-File-Basename-2.86-500.fc39.noarch 53/100 Installing : perl-Getopt-Std-1.13-500.fc39.noarch 54/100 Installing : perl-MIME-Base64-3.16-500.fc39.aarch64 55/100 Installing : perl-Scalar-List-Utils-5:1.63-500.fc39.aarch64 56/100 Installing : perl-constant-1.33-501.fc39.noarch 57/100 Installing : perl-Storable-1:3.32-500.fc39.aarch64 58/100 Installing : perl-overload-1.37-500.fc39.noarch 59/100 Installing : perl-parent-1:0.241-500.fc39.noarch 60/100 Installing : perl-vars-1.05-500.fc39.noarch 61/100 Installing : perl-Getopt-Long-1:2.54-500.fc39.noarch 62/100 Installing : perl-Carp-1.54-500.fc39.noarch 63/100 Installing : perl-Exporter-5.77-500.fc39.noarch 64/100 Installing : perl-PathTools-3.89-500.fc39.aarch64 65/100 Installing : perl-DynaLoader-1.54-500.fc39.aarch64 66/100 Installing : perl-Encode-4:3.19-500.fc39.aarch64 67/100 Installing : perl-libs-4:5.38.0-500.fc39.aarch64 68/100 Installing : perl-interpreter-4:5.38.0-500.fc39.aarch64 69/100 Installing : perl-Math-Complex-1.62-500.fc39.noarch 70/100 Installing : perl-Math-BigInt-1:1.9998.39-2.fc39.noarch 71/100 Installing : perl-Math-BigRat-0.2624-500.fc39.noarch 72/100 Installing : perl-JSON-PP-1:4.16-501.fc39.noarch 73/100 Installing : perl-Object-HashBase-0.009-13.fc39.noarch 74/100 Installing : perl-Term-Table-0.017-1.fc40.noarch 75/100 Installing : perl-Time-HiRes-4:1.9775-500.fc39.aarch64 76/100 Installing : perl-Test-Simple-3:1.302195-5.fc39.noarch 77/100 Installing : gc-8.2.2-4.fc39.aarch64 78/100 Installing : guile22-2.2.7-9.fc39.aarch64 79/100 Installing : make-1:4.4.1-2.fc39.aarch64 80/100 Installing : expat-2.5.0-3.fc39.aarch64 81/100 Installing : python3-3.12.0~rc2-1.fc40.aarch64 82/100 Installing : python3-libs-3.12.0~rc2-1.fc40.aarch64 83/100 Installing : cmake-filesystem-3.27.4-8.fc40.aarch64 84/100 Installing : annobin-docs-12.26-1.fc40.noarch 85/100 Installing : libubsan-13.2.1-1.fc40.aarch64 86/100 Installing : libstdc++-devel-13.2.1-1.fc40.aarch64 87/100 Installing : libatomic-13.2.1-1.fc40.aarch64 88/100 Installing : libasan-13.2.1-1.fc40.aarch64 89/100 Installing : gcc-13.2.1-1.fc40.aarch64 90/100 Running scriptlet: gcc-13.2.1-1.fc40.aarch64 90/100 Installing : gcc-c++-13.2.1-1.fc40.aarch64 91/100 Installing : gcc-plugin-annobin-13.2.1-1.fc40.aarch64 92/100 Running scriptlet: gcc-plugin-annobin-13.2.1-1.fc40.aarch64 92/100 Installing : annobin-plugin-gcc-12.26-1.fc40.aarch64 93/100 Running scriptlet: annobin-plugin-gcc-12.26-1.fc40.aarch64 93/100 Installing : tbb-devel-2020.3-21.fc40.aarch64 94/100 Installing : perl-Test-Deep-1.204-3.fc39.noarch 95/100 Installing : perl-Clone-0.46-4.fc39.aarch64 96/100 Installing : perl-FindBin-1.53-500.fc39.noarch 97/100 Installing : perl-lib-0.65-500.fc39.aarch64 98/100 Installing : hostname-3.23-9.fc39.aarch64 99/100 Running scriptlet: hostname-3.23-9.fc39.aarch64 99/100 Installing : zlib-ng-compat-devel-2.1.3-3.fc40.aarch64 100/100 Running scriptlet: zlib-ng-compat-devel-2.1.3-3.fc40.aarch64 100/100 Verifying : cpp-13.2.1-1.fc40.aarch64 1/100 Verifying : gcc-13.2.1-1.fc40.aarch64 2/100 Verifying : gcc-c++-13.2.1-1.fc40.aarch64 3/100 Verifying : gcc-plugin-annobin-13.2.1-1.fc40.aarch64 4/100 Verifying : libasan-13.2.1-1.fc40.aarch64 5/100 Verifying : libatomic-13.2.1-1.fc40.aarch64 6/100 Verifying : libstdc++-devel-13.2.1-1.fc40.aarch64 7/100 Verifying : libubsan-13.2.1-1.fc40.aarch64 8/100 Verifying : zlib-ng-compat-devel-2.1.3-3.fc40.aarch64 9/100 Verifying : annobin-docs-12.26-1.fc40.noarch 10/100 Verifying : annobin-plugin-gcc-12.26-1.fc40.aarch64 11/100 Verifying : cmake-filesystem-3.27.4-8.fc40.aarch64 12/100 Verifying : expat-2.5.0-3.fc39.aarch64 13/100 Verifying : gc-8.2.2-4.fc39.aarch64 14/100 Verifying : glibc-devel-2.38.9000-8.fc40.aarch64 15/100 Verifying : groff-base-1.23.0-2.fc39.aarch64 16/100 Verifying : guile22-2.2.7-9.fc39.aarch64 17/100 Verifying : hostname-3.23-9.fc39.aarch64 18/100 Verifying : kernel-headers-6.6.0-0.rc1.git0.1.fc40.aarch64 19/100 Verifying : libb2-0.98.1-9.fc39.aarch64 20/100 Verifying : libmpc-1.3.1-3.fc39.aarch64 21/100 Verifying : libtool-ltdl-2.4.7-8.fc40.aarch64 22/100 Verifying : libxcrypt-devel-4.4.36-2.fc39.aarch64 23/100 Verifying : make-1:4.4.1-2.fc39.aarch64 24/100 Verifying : mpdecimal-2.5.1-7.fc39.aarch64 25/100 Verifying : ncurses-6.4-7.20230520.fc40.aarch64 26/100 Verifying : perl-AutoLoader-5.74-500.fc39.noarch 27/100 Verifying : perl-B-1.88-500.fc39.aarch64 28/100 Verifying : perl-Carp-1.54-500.fc39.noarch 29/100 Verifying : perl-Class-Struct-0.68-500.fc39.noarch 30/100 Verifying : perl-Clone-0.46-4.fc39.aarch64 31/100 Verifying : perl-Data-Dumper-2.188-501.fc39.aarch64 32/100 Verifying : perl-Digest-1.20-500.fc39.noarch 33/100 Verifying : perl-Digest-MD5-2.58-500.fc39.aarch64 34/100 Verifying : perl-DynaLoader-1.54-500.fc39.aarch64 35/100 Verifying : perl-Encode-4:3.19-500.fc39.aarch64 36/100 Verifying : perl-Errno-1.37-500.fc39.aarch64 37/100 Verifying : perl-Exporter-5.77-500.fc39.noarch 38/100 Verifying : perl-Fcntl-1.15-500.fc39.aarch64 39/100 Verifying : perl-File-Basename-2.86-500.fc39.noarch 40/100 Verifying : perl-File-Path-2.18-500.fc39.noarch 41/100 Verifying : perl-File-Temp-1:0.231.100-500.fc39.noarch 42/100 Verifying : perl-File-stat-1.13-500.fc39.noarch 43/100 Verifying : perl-FileHandle-2.05-500.fc39.noarch 44/100 Verifying : perl-FindBin-1.53-500.fc39.noarch 45/100 Verifying : perl-Getopt-Long-1:2.54-500.fc39.noarch 46/100 Verifying : perl-Getopt-Std-1.13-500.fc39.noarch 47/100 Verifying : perl-HTTP-Tiny-0.088-3.fc39.noarch 48/100 Verifying : perl-IO-1.52-500.fc39.aarch64 49/100 Verifying : perl-IO-Socket-IP-0.42-1.fc39.noarch 50/100 Verifying : perl-IO-Socket-SSL-2.083-3.fc39.noarch 51/100 Verifying : perl-IPC-Open3-1.22-500.fc39.noarch 52/100 Verifying : perl-JSON-PP-1:4.16-501.fc39.noarch 53/100 Verifying : perl-MIME-Base64-3.16-500.fc39.aarch64 54/100 Verifying : perl-Math-BigInt-1:1.9998.39-2.fc39.noarch 55/100 Verifying : perl-Math-BigRat-0.2624-500.fc39.noarch 56/100 Verifying : perl-Math-Complex-1.62-500.fc39.noarch 57/100 Verifying : perl-Mozilla-CA-20230821-1.fc40.noarch 58/100 Verifying : perl-Net-SSLeay-1.92-10.fc39.aarch64 59/100 Verifying : perl-Object-HashBase-0.009-13.fc39.noarch 60/100 Verifying : perl-POSIX-2.13-500.fc39.aarch64 61/100 Verifying : perl-PathTools-3.89-500.fc39.aarch64 62/100 Verifying : perl-Pod-Escapes-1:1.07-501.fc40.noarch 63/100 Verifying : perl-Pod-Perldoc-3.28.01-501.fc39.noarch 64/100 Verifying : perl-Pod-Simple-1:3.45-4.fc39.noarch 65/100 Verifying : perl-Pod-Usage-4:2.03-500.fc39.noarch 66/100 Verifying : perl-Scalar-List-Utils-5:1.63-500.fc39.aarch64 67/100 Verifying : perl-SelectSaver-1.02-500.fc39.noarch 68/100 Verifying : perl-Socket-4:2.037-3.fc39.aarch64 69/100 Verifying : perl-Storable-1:3.32-500.fc39.aarch64 70/100 Verifying : perl-Symbol-1.09-500.fc39.noarch 71/100 Verifying : perl-Term-ANSIColor-5.01-501.fc39.noarch 72/100 Verifying : perl-Term-Cap-1.18-500.fc39.noarch 73/100 Verifying : perl-Term-Table-0.017-1.fc40.noarch 74/100 Verifying : perl-Test-Deep-1.204-3.fc39.noarch 75/100 Verifying : perl-Test-Simple-3:1.302195-5.fc39.noarch 76/100 Verifying : perl-Text-ParseWords-3.31-500.fc39.noarch 77/100 Verifying : perl-Text-Tabs+Wrap-2023.0511-3.fc39.noarch 78/100 Verifying : perl-Time-HiRes-4:1.9775-500.fc39.aarch64 79/100 Verifying : perl-Time-Local-2:1.350-3.fc39.noarch 80/100 Verifying : perl-URI-5.21-1.fc40.noarch 81/100 Verifying : perl-base-2.27-500.fc39.noarch 82/100 Verifying : perl-constant-1.33-501.fc39.noarch 83/100 Verifying : perl-if-0.61.000-500.fc39.noarch 84/100 Verifying : perl-interpreter-4:5.38.0-500.fc39.aarch64 85/100 Verifying : perl-lib-0.65-500.fc39.aarch64 86/100 Verifying : perl-libnet-3.15-501.fc39.noarch 87/100 Verifying : perl-libs-4:5.38.0-500.fc39.aarch64 88/100 Verifying : perl-locale-1.10-500.fc39.noarch 89/100 Verifying : perl-mro-1.28-500.fc39.aarch64 90/100 Verifying : perl-overload-1.37-500.fc39.noarch 91/100 Verifying : perl-overloading-0.02-500.fc39.noarch 92/100 Verifying : perl-parent-1:0.241-500.fc39.noarch 93/100 Verifying : perl-podlators-1:5.01-500.fc39.noarch 94/100 Verifying : perl-vars-1.05-500.fc39.noarch 95/100 Verifying : python-pip-wheel-23.2.1-1.fc39.noarch 96/100 Verifying : python3-3.12.0~rc2-1.fc40.aarch64 97/100 Verifying : python3-libs-3.12.0~rc2-1.fc40.aarch64 98/100 Verifying : tbb-2020.3-21.fc40.aarch64 99/100 Verifying : tbb-devel-2020.3-21.fc40.aarch64 100/100 Installed: annobin-docs-12.26-1.fc40.noarch annobin-plugin-gcc-12.26-1.fc40.aarch64 cmake-filesystem-3.27.4-8.fc40.aarch64 cpp-13.2.1-1.fc40.aarch64 expat-2.5.0-3.fc39.aarch64 gc-8.2.2-4.fc39.aarch64 gcc-13.2.1-1.fc40.aarch64 gcc-c++-13.2.1-1.fc40.aarch64 gcc-plugin-annobin-13.2.1-1.fc40.aarch64 glibc-devel-2.38.9000-8.fc40.aarch64 groff-base-1.23.0-2.fc39.aarch64 guile22-2.2.7-9.fc39.aarch64 hostname-3.23-9.fc39.aarch64 kernel-headers-6.6.0-0.rc1.git0.1.fc40.aarch64 libasan-13.2.1-1.fc40.aarch64 libatomic-13.2.1-1.fc40.aarch64 libb2-0.98.1-9.fc39.aarch64 libmpc-1.3.1-3.fc39.aarch64 libstdc++-devel-13.2.1-1.fc40.aarch64 libtool-ltdl-2.4.7-8.fc40.aarch64 libubsan-13.2.1-1.fc40.aarch64 libxcrypt-devel-4.4.36-2.fc39.aarch64 make-1:4.4.1-2.fc39.aarch64 mpdecimal-2.5.1-7.fc39.aarch64 ncurses-6.4-7.20230520.fc40.aarch64 perl-AutoLoader-5.74-500.fc39.noarch perl-B-1.88-500.fc39.aarch64 perl-Carp-1.54-500.fc39.noarch perl-Class-Struct-0.68-500.fc39.noarch perl-Clone-0.46-4.fc39.aarch64 perl-Data-Dumper-2.188-501.fc39.aarch64 perl-Digest-1.20-500.fc39.noarch perl-Digest-MD5-2.58-500.fc39.aarch64 perl-DynaLoader-1.54-500.fc39.aarch64 perl-Encode-4:3.19-500.fc39.aarch64 perl-Errno-1.37-500.fc39.aarch64 perl-Exporter-5.77-500.fc39.noarch perl-Fcntl-1.15-500.fc39.aarch64 perl-File-Basename-2.86-500.fc39.noarch perl-File-Path-2.18-500.fc39.noarch perl-File-Temp-1:0.231.100-500.fc39.noarch perl-File-stat-1.13-500.fc39.noarch perl-FileHandle-2.05-500.fc39.noarch perl-FindBin-1.53-500.fc39.noarch perl-Getopt-Long-1:2.54-500.fc39.noarch perl-Getopt-Std-1.13-500.fc39.noarch perl-HTTP-Tiny-0.088-3.fc39.noarch perl-IO-1.52-500.fc39.aarch64 perl-IO-Socket-IP-0.42-1.fc39.noarch perl-IO-Socket-SSL-2.083-3.fc39.noarch perl-IPC-Open3-1.22-500.fc39.noarch perl-JSON-PP-1:4.16-501.fc39.noarch perl-MIME-Base64-3.16-500.fc39.aarch64 perl-Math-BigInt-1:1.9998.39-2.fc39.noarch perl-Math-BigRat-0.2624-500.fc39.noarch perl-Math-Complex-1.62-500.fc39.noarch perl-Mozilla-CA-20230821-1.fc40.noarch perl-Net-SSLeay-1.92-10.fc39.aarch64 perl-Object-HashBase-0.009-13.fc39.noarch perl-POSIX-2.13-500.fc39.aarch64 perl-PathTools-3.89-500.fc39.aarch64 perl-Pod-Escapes-1:1.07-501.fc40.noarch perl-Pod-Perldoc-3.28.01-501.fc39.noarch perl-Pod-Simple-1:3.45-4.fc39.noarch perl-Pod-Usage-4:2.03-500.fc39.noarch perl-Scalar-List-Utils-5:1.63-500.fc39.aarch64 perl-SelectSaver-1.02-500.fc39.noarch perl-Socket-4:2.037-3.fc39.aarch64 perl-Storable-1:3.32-500.fc39.aarch64 perl-Symbol-1.09-500.fc39.noarch perl-Term-ANSIColor-5.01-501.fc39.noarch perl-Term-Cap-1.18-500.fc39.noarch perl-Term-Table-0.017-1.fc40.noarch perl-Test-Deep-1.204-3.fc39.noarch perl-Test-Simple-3:1.302195-5.fc39.noarch perl-Text-ParseWords-3.31-500.fc39.noarch perl-Text-Tabs+Wrap-2023.0511-3.fc39.noarch perl-Time-HiRes-4:1.9775-500.fc39.aarch64 perl-Time-Local-2:1.350-3.fc39.noarch perl-URI-5.21-1.fc40.noarch perl-base-2.27-500.fc39.noarch perl-constant-1.33-501.fc39.noarch perl-if-0.61.000-500.fc39.noarch perl-interpreter-4:5.38.0-500.fc39.aarch64 perl-lib-0.65-500.fc39.aarch64 perl-libnet-3.15-501.fc39.noarch perl-libs-4:5.38.0-500.fc39.aarch64 perl-locale-1.10-500.fc39.noarch perl-mro-1.28-500.fc39.aarch64 perl-overload-1.37-500.fc39.noarch perl-overloading-0.02-500.fc39.noarch perl-parent-1:0.241-500.fc39.noarch perl-podlators-1:5.01-500.fc39.noarch perl-vars-1.05-500.fc39.noarch python-pip-wheel-23.2.1-1.fc39.noarch python3-3.12.0~rc2-1.fc40.aarch64 python3-libs-3.12.0~rc2-1.fc40.aarch64 tbb-2020.3-21.fc40.aarch64 tbb-devel-2020.3-21.fc40.aarch64 zlib-ng-compat-devel-2.1.3-3.fc40.aarch64 Complete! Finish: build setup for bowtie-1.3.1-2.fc40.src.rpm Start: rpmbuild bowtie-1.3.1-2.fc40.src.rpm Building target platforms: aarch64 Building for target aarch64 setting SOURCE_DATE_EPOCH=1689724800 Executing(%prep): /bin/sh -e /var/tmp/rpm-tmp.uZFILS + umask 022 + cd /builddir/build/BUILD + cd /builddir/build/BUILD + rm -rf bowtie-1.3.1-src + /usr/lib/rpm/rpmuncompress -x /builddir/build/SOURCES/bowtie-1.3.1-src.zip + STATUS=0 + '[' 0 -ne 0 ']' + cd bowtie-1.3.1-src + rm -rf /builddir/build/BUILD/bowtie-1.3.1-src-SPECPARTS + /usr/bin/mkdir -p /builddir/build/BUILD/bowtie-1.3.1-src-SPECPARTS + /usr/bin/chmod -Rf a+rX,u+w,g-w,o-w . + rm -rf third_party/ ++ find . -name '*.py' + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-build + for file in $(find . -name "*.py") bowtie bowtie-* + sed -E -i '1s|/usr/bin/env python[3]?|/usr/bin/python3|' bowtie-inspect + RPM_EC=0 ++ jobs -p + exit 0 Executing(%build): /bin/sh -e /var/tmp/rpm-tmp.932N52 + umask 022 + cd /builddir/build/BUILD + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + export POPCNT_CAPABILITY=0 + POPCNT_CAPABILITY=0 ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS ++ echo '-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' ++ sed -e s/-Wp,-D_GLIBCXX_ASSERTIONS// + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + /usr/bin/make -O -j4 V=1 VERBOSE=1 allall EXTRA_FLAGS=-g g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt_build.cpp:8: In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ In file included from diff_sample.h:14, from blockwise_sa.h:17, from ebwt.h:25, from ebwt_build.cpp:10: multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned long*, unsigned long, unsigned long*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘buildSamples’ at blockwise_sa.h:619:17, inlined from ‘build’ at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘build’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘buildSamples’ at blockwise_sa.h:619:17, inlined from ‘build’ at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘build’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1034:29, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1034:29, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23, inlined from ‘mkeyQSortSufDcU8.constprop.isra’ at multikey_qsort.h:1154:20: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘mkeyQSortSufDcU8.constprop.isra’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined In file included from ebwt_build.cpp:8: In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ In file included from diff_sample.h:14, from blockwise_sa.h:17, from ebwt.h:25, from ebwt_build.cpp:10: multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2(S2bDnaString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:597:31: ds.h:497:17: warning: ‘tmp2’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:596:36: note: ‘tmp2’ declared here 596 | QSortRange tmp2; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:606:31: ds.h:497:17: warning: ‘tmp3’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:605:36: note: ‘tmp3’ declared here 605 | QSortRange tmp3; | ^~~~ In member function ‘EList::push_back(QSortRange const&)’, inlined from ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’ at multikey_qsort.h:614:31: ds.h:497:17: warning: ‘tmp4’ may be used uninitialized [-Wmaybe-uninitialized] 497 | list_[cur_++] = el; | ^~~~~ multikey_qsort.h: In function ‘mkeyQSortSuf2 >(SString const&, unsigned long, unsigned int*, unsigned long, unsigned int*, int, unsigned long, unsigned long, unsigned long, unsigned long, EList*)void [clone .isra.0]’: multikey_qsort.h:613:36: note: ‘tmp4’ declared here 613 | QSortRange tmp4; | ^~~~ ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘buildSamples’ at blockwise_sa.h:619:17, inlined from ‘build’ at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘build’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘buildSamples’ at blockwise_sa.h:619:17, inlined from ‘build’ at blockwise_sa.h:384:16: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘build’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 \ -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct_base ’ at pat.h:330:37: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘__ct_base ’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘patsrcFromStrings’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘__ct_base .constprop’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O3 -DCOMPILER_OPTIONS="\"-O3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DNDEBUG -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandNoCopyExact’ at ds.h:1003:17, inlined from ‘expandNoCopy’ at ds.h:992:20, inlined from ‘operator=’ at ds.h:405:32, inlined from ‘operator=’ at ds.h:394:15, inlined from ‘__ct_base ’ at pat.h:330:37: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘__ct_base ’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopyExact’ at ds.h:965:7, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘patsrcFromStrings’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘__ct_base .constprop’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-l-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘bucketSortSufDcU8’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘mkeyQSortSuf2.constprop’ at multikey_qsort.h:593:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘mkeyQSortSuf2.constprop’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘bucketSortSufDcU8’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘bucketSortSufDcU8’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-build-s-debug ebwt_build.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp bowtie_build_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_build.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_build_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘bucketSortSufDcU8’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1034:29: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘bucketSortSufDcU8’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘push_back’ at ds.h:496:29, inlined from ‘bucketSortSufDcU8’ at multikey_qsort.h:1084:23: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘bucketSortSufDcU8’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-s-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party -I . \ -o bowtie-inspect-l-debug bowtie_inspect.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread bowtie_inspect.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-s-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:22:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 22 | std::string gEbwt_ext("ebwt"); | ^ ebwt.cpp:22:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘patsrcFromStrings’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘__ct_base .constprop’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘naiveFind’ at ref_aligner.h:251:19, inlined from ‘anchor64Find’ at ref_aligner.h:291:13: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘anchor64Find’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘naiveFind’ at ref_aligner.h:587:20, inlined from ‘anchor64Find’ at ref_aligner.h:632:14: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘anchor64Find’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ g++ -O0 -g3 \ -DCOMPILER_OPTIONS="\"-O0 -g3 -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \"" -g -Wl,--hash-style=both -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer \ -fno-strict-aliasing -DBOWTIE_VERSION="\"`cat VERSION`\"" -DBUILD_HOST="\"reproduciblebuild\"" -DBUILD_TIME="\"2023-07-19T00:00:00\"" -DCOMPILER_VERSION="\"`g++ -v 2>&1 | tail -1`\"" -D_LARGEFILE_SOURCE -D_FILE_OFFSET_BITS=64 -D_GNU_SOURCE -DPREFETCH_LOCALITY=2 -DBOWTIE_MM -DBOWTIE_SHARED_MEM -DBOWTIE_64BIT_INDEX -Wall -Wno-unused-parameter -Wno-reorder \ -I third_party \ -o bowtie-align-l-debug ebwt_search.cpp \ ccnt_lut.cpp ref_read.cpp alphabet.cpp shmem.cpp edit.cpp ebwt.cpp bt2_locks.cpp tinythread.cpp qual.cpp pat.cpp ebwt_search_util.cpp ref_aligner.cpp log.cpp hit_set.cpp sam.cpp hit.cpp bowtie_main.cpp \ -Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes -lz -lpthread ebwt_search.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ccnt_lut.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_read.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined alphabet.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined shmem.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined edit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bt2_locks.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined tinythread.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined qual.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined pat.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ebwt_search_util.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined ref_aligner.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined log.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit_set.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined sam.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined hit.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined bowtie_main.cpp: warning: -D_GLIBCXX_ASSERTIONS not defined btypes.h:30:26: warning: ‘gEbwt_ext’ violates the C++ One Definition Rule [-Wodr] 30 | extern const std::string gEbwt_ext; | ^ ebwt.cpp:18:13: note: type ‘struct string’ itself violates the C++ One Definition Rule 18 | std::string gEbwt_ext("ebwtl"); | ^ ebwt.cpp:18:13: note: ‘gEbwt_ext’ was previously declared here In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct ’ at pat.cpp:379:15, inlined from ‘patsrcFromStrings’ at ebwt_search.cpp:2945:54: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In function ‘patsrcFromStrings’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘__ct_base .constprop’ at hit.h:176:17: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘__ct_base .constprop’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘naiveFind’ at ref_aligner.h:251:19, inlined from ‘anchor64Find’ at ref_aligner.h:291:13: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘anchor64Find’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ In member function ‘alloc’, inlined from ‘expandCopyExact’ at ds.h:967:17, inlined from ‘expandCopy’ at ds.h:958:18, inlined from ‘resize’ at ds.h:569:14, inlined from ‘resize’ at ds.h:562:7, inlined from ‘naiveFind’ at ref_aligner.h:587:20, inlined from ‘anchor64Find’ at ref_aligner.h:632:14: ds.h:923:26: warning: argument 1 value ‘18446744073709551615’ exceeds maximum object size 9223372036854775807 [-Walloc-size-larger-than=] 923 | T* tmp = new T[sz]; | ^ /usr/include/c++/13/new: In member function ‘anchor64Find’: /usr/include/c++/13/new:128:26: note: in a call to allocation function ‘operator new []’ declared here 128 | _GLIBCXX_NODISCARD void* operator new[](std::size_t) _GLIBCXX_THROW (std::bad_alloc) | ^ + RPM_EC=0 ++ jobs -p + exit 0 Executing(%install): /bin/sh -e /var/tmp/rpm-tmp.CTjsON + umask 022 + cd /builddir/build/BUILD + '[' /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64 '!=' / ']' + rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64 ++ dirname /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64 + mkdir -p /builddir/build/BUILDROOT + mkdir /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64 + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + /usr/bin/make install DESTDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64 'INSTALL=/usr/bin/install -p' prefix=/usr mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/bin for file in bowtie-build-s bowtie-build-l bowtie-align-s bowtie-align-l bowtie-inspect-s bowtie-inspect-l bowtie-inspect bowtie-build bowtie ; do \ cp -f $file /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/bin ; \ done + mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/share/bowtie + cp -a reads /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/share/bowtie/ + cp -a indexes /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/share/bowtie/ + cp -a genomes /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/share/bowtie/ + cp -a scripts /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/share/bowtie/ + for cmd in bowtie-*-debug + cp -p bowtie-align-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-align-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-build-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-l-debug /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/bin/ + for cmd in bowtie-*-debug + cp -p bowtie-inspect-s-debug /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64//usr/bin/ + /usr/bin/find-debuginfo -j4 --strict-build-id -m -i --build-id-seed 1.3.1-2.fc40 --unique-debug-suffix -1.3.1-2.fc40.aarch64 --unique-debug-src-base bowtie-1.3.1-2.fc40.aarch64 --run-dwz --dwz-low-mem-die-limit 10000000 --dwz-max-die-limit 50000000 -S debugsourcefiles.list /builddir/build/BUILD/bowtie-1.3.1-src find-debuginfo: starting Extracting debug info from 12 files DWARF-compressing 12 files sepdebugcrcfix: Updated 12 CRC32s, 0 CRC32s did match. Creating .debug symlinks for symlinks to ELF files Copying sources found by 'debugedit -l' to /usr/src/debug/bowtie-1.3.1-2.fc40.aarch64 2930 blocks find-debuginfo: done + /usr/lib/rpm/check-buildroot + /usr/lib/rpm/redhat/brp-ldconfig + /usr/lib/rpm/brp-compress + /usr/lib/rpm/redhat/brp-strip-lto /usr/bin/strip + /usr/lib/rpm/brp-strip-static-archive /usr/bin/strip + /usr/lib/rpm/check-rpaths + /usr/lib/rpm/redhat/brp-mangle-shebangs mangling shebang in /usr/share/bowtie/scripts/make_mm8.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg19.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/run-hbb.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/build_test.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_hg18.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_mm9.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_c_elegans.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/bowtie-hbb.sh from /bin/bash to #!/usr/bin/bash mangling shebang in /usr/share/bowtie/scripts/make_canFam2.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_a_thaliana_tair.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_m_musculus_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi37.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_b_taurus_UMD3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_s_cerevisiae.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_d_melanogaster.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_galGal3.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_h_sapiens_ncbi36.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_e_coli.sh from /bin/sh to #!/usr/bin/sh mangling shebang in /usr/share/bowtie/scripts/make_rn4.sh from /bin/sh to #!/usr/bin/sh + /usr/lib/rpm/brp-remove-la-files + env /usr/lib/rpm/redhat/brp-python-bytecompile '' 1 0 -j4 + /usr/lib/rpm/redhat/brp-python-hardlink Executing(%check): /bin/sh -e /var/tmp/rpm-tmp.XnRcCF + umask 022 + cd /builddir/build/BUILD + CFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CFLAGS + CXXFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Werror=format-security -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer ' + export CXXFLAGS + FFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FFLAGS + FCFLAGS='-O2 -flto=auto -ffat-lto-objects -fexceptions -g -grecord-gcc-switches -pipe -Wall -Wp,-U_FORTIFY_SOURCE,-D_FORTIFY_SOURCE=3 -Wp,-D_GLIBCXX_ASSERTIONS -specs=/usr/lib/rpm/redhat/redhat-hardened-cc1 -fstack-protector-strong -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -mbranch-protection=standard -fasynchronous-unwind-tables -fstack-clash-protection -fno-omit-frame-pointer -mno-omit-leaf-frame-pointer -I/usr/lib64/gfortran/modules ' + export FCFLAGS + VALAFLAGS=-g + export VALAFLAGS + RUSTFLAGS='-Copt-level=3 -Cdebuginfo=2 -Ccodegen-units=1 -Cforce-frame-pointers=yes -Clink-arg=-Wl,-z,relro -Clink-arg=-Wl,-z,now -Clink-arg=-specs=/usr/lib/rpm/redhat/redhat-package-notes --cap-lints=warn' + export RUSTFLAGS + LDFLAGS='-Wl,-z,relro -Wl,--as-needed -Wl,-z,now -specs=/usr/lib/rpm/redhat/redhat-hardened-ld -specs=/usr/lib/rpm/redhat/redhat-annobin-cc1 -Wl,--build-id=sha1 -specs=/usr/lib/rpm/redhat/redhat-package-notes ' + export LDFLAGS + LT_SYS_LIBRARY_PATH=/usr/lib64: + export LT_SYS_LIBRARY_PATH + CC=gcc + export CC + CXX=g++ + export CXX + cd bowtie-1.3.1-src + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie --version + grep 'version 1.3.1' /builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-build --version + grep 'version 1.3.1' bowtie-build version 1.3.1 + for cmd in bowtie bowtie-build bowtie-inspect + ./bowtie-inspect --version + grep 'version 1.3.1' bowtie-inspect version 1.3.1 + tar xzvf /builddir/build/SOURCES/bowtie-1.3.1-tests.tgz scripts/test/ scripts/test/random_bowtie_tests_p.sh scripts/test/samtools.pl scripts/test/simple_tests.pl scripts/test/cs_dec.pl scripts/test/random_bowtie_tests.sh scripts/test/btface.py scripts/test/long_read.pl scripts/test/dataface.py scripts/test/inspect.pl scripts/test/random_bowtie_tests.pl scripts/test/args.pl scripts/test/DNA.pm scripts/test/big_data/ scripts/test/big_data/reads/ scripts/test/big_data/reads/human_reads.fa scripts/test/big_data/reads/mouse_reads.fa scripts/test/cs_trim.pl scripts/test/btdata.py scripts/test/build_big.py scripts/test/large_idx.py scripts/test/all.sh + cat /builddir/build/SOURCES/bowtie-test-remove-perl-Sys-Info-dep.patch + patch -p1 patching file scripts/test/simple_tests.pl + scripts/test/simple_tests.pl --bowtie=./bowtie --bowtie-build=./bowtie-build FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-s --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --debug --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --debug --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --debug --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --debug --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --debug --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l-debug --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 1 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments FASTA-continuous 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq2_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments FASTA-continuous 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 4 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_9 0 0 10 255 10M * 0 0 CAGTATCTGA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 FASTA-continuous 5 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,9 -u 1 -s 1 -S --quiet -a .simple_tests.tmp .simple_tests" seq2_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments FASTA-continuous 6 (fw:1, sam:1) References: >0 AGCATCGATCAG ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 3 # reads with at least one alignment: 3 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:12 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -F 10,1 -S --quiet -a .simple_tests.tmp .simple_tests" seq1_0 0 0 1 255 10M * 0 0 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 3 alignments seq1_1 0 0 2 255 10M * 0 0 GCATCGATCA IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 seq1_2 0 0 3 255 10M * 0 0 CATCGATCAG IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 Cline 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Cline 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Cline multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG:IIIIIIIIIIIIIIII,ATCGATCAGTATCTG:IIIIIIIIIIIIIII" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Cline multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -c CATCGATCAGTATCTG,ATCGATCAGTATCTG" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Cline paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -c -1 AGCATCGATC:IIIIIIIIII,TCAGTTTTTGA:IIIIIIIIIII -2 TCAGTTTTTGA:IIIIIIIIIII,AGCATCGATC:IIIIIIIIII" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Cline paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -c -1 AGCATCG:IIIIIII -2 GATCAAAAACTGA:IIIIIIIIIIIII" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Fastq 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fastq multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fastq multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.fq" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fastq paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fastq paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Fasta 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Fasta 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 0.00%) # reads that failed to align: 1 (100.00%) No alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 4 * 0 0 * * 0 0 XM:i:0 Fasta 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Fasta multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 Fasta multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -f .simple_tests.fa" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Fasta paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r1 163 0 1 255 9M = 9 19 AGCATCGAT IIIIIIIII XA:i:0 MD:Z:9 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Fasta paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -f -1 .simple_tests.1.fa -2 .simple_tests.2.fa" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 16 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Raw 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Raw multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Raw multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp -r .simple_tests.raw" 0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments 1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 Raw paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Raw paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp -r -1 .simple_tests.1.raw -2 .simple_tests.2.raw" 0 77 * 0 0 * * 0 0 XM:i:0 0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 7 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim3 4 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 12M * 0 0 CATCGATCAGTA IIIIIIIIIIII XA:i:0 MD:Z:12 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed 8 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --trim5 16 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 4 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Tabbed 9 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 0 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" 0.00%) # reads that failed to align: 0 (0.00%) No alignments Tabbed multiread 2 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Tabbed multiread 3 (fw:1, sam:1) References: >0 AGCATCGATCAGTATCTGA ./bowtie --large-index -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 2 # reads with at least one alignment: 2 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 2 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 0 0 3 255 16M * 0 0 CATCGATCAGTATCTG IIIIIIIIIIIIIIII XA:i:0 MD:Z:16 NM:i:0 XM:i:1 r1 0 0 4 255 15M * 0 0 ATCGATCAGTATCTG IIIIIIIIIIIIIII XA:i:0 MD:Z:15 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Tabbed paired 2 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -s 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r1 163 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r1 83 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 3 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -u 1 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 99 0 1 255 10M = 9 19 AGCATCGATC IIIIIIIIII XA:i:0 MD:Z:10 NM:i:0 XM:i:1 r0 147 0 9 255 11M = 1 -19 TCAAAAACTGA IIIIIIIIIII XA:i:0 MD:Z:11 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Tabbed paired 4 (fw:1, sam:1) References: >0 AGCATCGATCAAAAACTGA ./bowtie --large-index -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:19 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -3 7 -S --quiet -a .simple_tests.tmp --12 .simple_tests.tab" r0 77 * 0 0 * * 0 0 XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments r0 141 * 0 0 * * 0 0 GATCAA IIIIII XM:i:0 Interleaved 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp --interleaved .simple_tests.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 1 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 17 21 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 17 255 7M = 3 -21 TAGATGG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 2 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 12 16 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 12 255 7M = 3 -16 TTTTATA IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 3 (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 8 12 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 8 255 7M = 3 -12 AAGCTTT IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 4, containment excluded (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 0 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 77 * 0 0 * * 0 0 CTTTCGT IIIIIII XM:i:0 r0 141 * 0 0 * * 0 0 AACGAAAG IIIIIIII XM:i:0 0.00%) # reads that failed to align: 1 (100.00%) No alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 5, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 4 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 4 255 7M = 3 -8 ACGAAAG IIIIIII XA:i:0 MD:Z:7 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 6, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 6, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 7, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 99 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 147 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 7, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 163 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 83 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 8, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 0 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -v 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 Paired-end 9, allow contain (fw:1, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments r0 131 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 Paired-end 9, allow contain (fw:0, sam:1) References: >0 AAAACGAAAGCTTTTATAGATGGGG ./bowtie --large-index --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:25 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 --allow-contain --ff -n 1 -m 1 -S --quiet -a .simple_tests.tmp -q -1 .simple_tests.1.fq -2 .simple_tests.2.fq" r0 67 0 3 255 8M = 3 8 AACGATAG IIIIIIII XA:i:1 MD:Z:5A2 NM:i:1 XM:i:1 r0 131 0 3 255 8M = 3 8 AACGAAAG IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 paired-end alignments Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 Checking -m, 1 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 1 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:16 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 r0 16 0 9 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:0 MD:Z:8 NM:i:0 XM:i:2 100.00%) # reads that failed to align: 0 (0.00%) Reported 2 alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:1, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking -m, 2 (fw:0, sam:1) References: >0 TTGTTCGTTTGTTCGTTTGTTCGT ./bowtie --large-index -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:24 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -m 2 -a .simple_tests.tmp -q .simple_tests.1.fq" 100.00%) # reads that failed to align: 0 (0.00%) # reads with alignments suppressed due to -m: 1 (100.00%) No alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:1, sam:1) References: >0 TTGCCCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 1 (fw:0, sam:1) References: >0 TTGCCCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGTTCGT IIIIIIII XA:i:2 MD:Z:3C0C3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:1, sam:1) References: >0 TTGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 2 (fw:0, sam:1) References: >0 TTGTTCGT ./bowtie --large-index -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 2 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 1 255 8M * 0 0 TTGCCCGT IIIIIIII XA:i:2 MD:Z:3T0T3 NM:i:2 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 1 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -v 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:1, sam:1) References: >0 ACGTTCGT ./bowtie-build --large-index --threads 2 --quiet --sanity .simple_tests.pl.fa .simple_tests.tmp ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 0 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments Checking edits 3 (fw:0, sam:1) References: >0 ACGTTCGT ./bowtie --large-index -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq Setting the index via positional argument will be deprecated in a future release. Please use -x option instead. # reads processed: 1 # reads with at least one alignment: 1 (@HD VN:1.0 SO:unsorted @SQ SN:0 LN:8 @PG ID:Bowtie VN:1.3.1 CL:"/builddir/build/BUILD/bowtie-1.3.1-src/bowtie-align-l --wrapper basic-0 -n 0 -S --quiet -a .simple_tests.tmp -q .simple_tests.1.fq" r0 16 0 3 255 4M * 0 0 GTTC IIII XA:i:0 MD:Z:4 NM:i:0 XM:i:1 100.00%) # reads that failed to align: 0 (0.00%) Reported 1 alignments PASSED + RPM_EC=0 ++ jobs -p + exit 0 Processing files: bowtie-1.3.1-2.fc40.aarch64 Executing(%doc): /bin/sh -e /var/tmp/rpm-tmp.TbQiIE + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + DOCDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + export LC_ALL= + LC_ALL= + export DOCDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/MANUAL /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/NEWS /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/VERSION /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/AUTHORS /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/TUTORIAL /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/doc/manual.html /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/doc/style.css /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/doc/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Executing(%license): /bin/sh -e /var/tmp/rpm-tmp.UdItDV + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + LICENSEDIR=/builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/licenses/bowtie + export LC_ALL= + LC_ALL= + export LICENSEDIR + /usr/bin/mkdir -p /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/licenses/bowtie + cp -pr /builddir/build/BUILD/bowtie-1.3.1-src/LICENSE /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64/usr/share/licenses/bowtie + RPM_EC=0 ++ jobs -p + exit 0 Provides: bowtie = 1.3.1-2.fc40 bowtie(aarch-64) = 1.3.1-2.fc40 bundled(tiny-thread) = 1.1 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Requires: /usr/bin/bash /usr/bin/perl /usr/bin/python3 /usr/bin/sh ld-linux-aarch64.so.1()(64bit) ld-linux-aarch64.so.1(GLIBC_2.17)(64bit) libc.so.6()(64bit) libc.so.6(GLIBC_2.17)(64bit) libc.so.6(GLIBC_2.32)(64bit) libc.so.6(GLIBC_2.33)(64bit) libc.so.6(GLIBC_2.34)(64bit) libc.so.6(GLIBC_2.38)(64bit) libgcc_s.so.1()(64bit) libgcc_s.so.1(GCC_3.0)(64bit) libgcc_s.so.1(GCC_3.3.1)(64bit) libm.so.6()(64bit) libm.so.6(GLIBC_2.17)(64bit) libm.so.6(GLIBC_2.27)(64bit) libstdc++.so.6()(64bit) libstdc++.so.6(CXXABI_1.3)(64bit) libstdc++.so.6(CXXABI_1.3.2)(64bit) libstdc++.so.6(CXXABI_1.3.8)(64bit) libstdc++.so.6(CXXABI_1.3.9)(64bit) libstdc++.so.6(GLIBCXX_3.4)(64bit) libstdc++.so.6(GLIBCXX_3.4.11)(64bit) libstdc++.so.6(GLIBCXX_3.4.20)(64bit) libstdc++.so.6(GLIBCXX_3.4.21)(64bit) libstdc++.so.6(GLIBCXX_3.4.22)(64bit) libstdc++.so.6(GLIBCXX_3.4.26)(64bit) libstdc++.so.6(GLIBCXX_3.4.30)(64bit) libstdc++.so.6(GLIBCXX_3.4.32)(64bit) libstdc++.so.6(GLIBCXX_3.4.9)(64bit) libz.so.1()(64bit) libz.so.1(ZLIB_1.2.0.2)(64bit) libz.so.1(ZLIB_1.2.3.3)(64bit) libz.so.1(ZLIB_1.2.3.5)(64bit) Processing files: bowtie-debugsource-1.3.1-2.fc40.aarch64 Provides: bowtie-debugsource = 1.3.1-2.fc40 bowtie-debugsource(aarch-64) = 1.3.1-2.fc40 Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Processing files: bowtie-debuginfo-1.3.1-2.fc40.aarch64 Provides: bowtie-debuginfo = 1.3.1-2.fc40 bowtie-debuginfo(aarch-64) = 1.3.1-2.fc40 debuginfo(build-id) = 19df8077d681246b9592861fc337d6c59acac151 debuginfo(build-id) = 3152757ca19c232c19beb92aeec9ed0dd05146f5 debuginfo(build-id) = 583c42d89c5528a9c7a6fc501a8e6f2a021f5b84 debuginfo(build-id) = 822dbe940d3077e188f3bb9d29b5e6af8e3364d2 debuginfo(build-id) = 9ba2e4fd7a27b06379e83354c036fdf725863461 debuginfo(build-id) = a0d9afe1dbd40d6acaf5bcedfc9e4425e8ceee3d debuginfo(build-id) = a7c4425892fd48301dbc45db2db6a38079c4db2d debuginfo(build-id) = ba2f3f1293995eeeb95a9aaf5b9cdbbc9334ab2f debuginfo(build-id) = cd52641f6f3fe3dc99436dc4768a17f6019f20c7 debuginfo(build-id) = ce43893fec82341b35e0608c7df9d1bf0f53038f debuginfo(build-id) = d13404abb7be22c4bd1affed4b80306826acf95d debuginfo(build-id) = f61ee1c8aaa0718dad522137a7d19b43a172c6fb Requires(rpmlib): rpmlib(CompressedFileNames) <= 3.0.4-1 rpmlib(FileDigests) <= 4.6.0-1 rpmlib(PayloadFilesHavePrefix) <= 4.0-1 Recommends: bowtie-debugsource(aarch-64) = 1.3.1-2.fc40 Checking for unpackaged file(s): /usr/lib/rpm/check-files /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64 Wrote: /builddir/build/RPMS/bowtie-debugsource-1.3.1-2.fc40.aarch64.rpm Wrote: /builddir/build/RPMS/bowtie-1.3.1-2.fc40.aarch64.rpm Wrote: /builddir/build/RPMS/bowtie-debuginfo-1.3.1-2.fc40.aarch64.rpm Executing(%clean): /bin/sh -e /var/tmp/rpm-tmp.uOv7yl + umask 022 + cd /builddir/build/BUILD + cd bowtie-1.3.1-src + /usr/bin/rm -rf /builddir/build/BUILDROOT/bowtie-1.3.1-2.fc40.aarch64 + RPM_EC=0 ++ jobs -p + exit 0 Executing(rmbuild): /bin/sh -e /var/tmp/rpm-tmp.ICVKAJ + umask 022 + cd /builddir/build/BUILD + rm -rf /builddir/build/BUILD/bowtie-1.3.1-src-SPECPARTS + rm -rf bowtie-1.3.1-src bowtie-1.3.1-src.gemspec + RPM_EC=0 ++ jobs -p + exit 0 Finish: rpmbuild bowtie-1.3.1-2.fc40.src.rpm Finish: build phase for bowtie-1.3.1-2.fc40.src.rpm INFO: chroot_scan: 3 files copied to /var/lib/copr-rpmbuild/results/chroot_scan INFO: /var/lib/mock/fedora-rawhide-aarch64-1694959012.757365/root/var/log/dnf.rpm.log /var/lib/mock/fedora-rawhide-aarch64-1694959012.757365/root/var/log/dnf.librepo.log /var/lib/mock/fedora-rawhide-aarch64-1694959012.757365/root/var/log/dnf.log INFO: Done(/var/lib/copr-rpmbuild/results/bowtie-1.3.1-2.fc40.src.rpm) Config(child) 2 minutes 49 seconds INFO: Results and/or logs in: /var/lib/copr-rpmbuild/results INFO: Cleaning up build root ('cleanup_on_success=True') Start: clean chroot INFO: unmounting tmpfs. Finish: clean chroot Finish: run Running RPMResults tool Package info: { "packages": [ { "name": "bowtie-debugsource", "epoch": null, "version": "1.3.1", "release": "2.fc40", "arch": "aarch64" }, { "name": "bowtie-debuginfo", "epoch": null, "version": "1.3.1", "release": "2.fc40", "arch": "aarch64" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "2.fc40", "arch": "src" }, { "name": "bowtie", "epoch": null, "version": "1.3.1", "release": "2.fc40", "arch": "aarch64" } ] } RPMResults finished